The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_004567	Lactobacillus plantarum WCFS1, complete genome	3308273	321921	408741	3308273	protease,bacteriocin,tRNA	Bacillus_virus(16.67%)	86	NA	NA
WP_003643762.1|321921_322485_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_011100974.1|322678_323347_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_003641930.1|323496_325002_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003643763.1|325266_325635_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_003641932.1|325747_326257_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_011100975.1|326287_327484_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003646440.1|327593_328064_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_011100976.1|328082_328538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641936.1|328641_329214_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_011100977.1|329379_330300_-	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_011100978.1|330436_331336_+	oxidoreductase	NA	NA	NA	NA	NA
WP_011100979.1|331775_333656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011100980.1|333827_334274_-	ribonuclease H	NA	NA	NA	NA	NA
WP_003643770.1|334511_336038_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003641941.1|336038_337010_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_003646444.1|337087_338419_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003643773.1|338884_340402_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003643774.1|340416_342246_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_003641945.1|342260_342983_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.9	3.2e-30
WP_011100981.1|343569_347265_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_162045223.1|348859_349054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011100983.1|349068_349488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011100984.1|349536_349800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011100985.1|349901_350180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074161480.1|350243_350360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011100986.1|350483_351401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526893.1|351407_351581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011100987.1|352125_352668_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011100988.1|352682_352946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643788.1|353062_353266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161503992.1|353390_353630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646453.1|353647_354034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641954.1|354483_354675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157951538.1|354877_355024_+	glycohydrolase toxin TNT-related protein	NA	NA	NA	NA	NA
WP_011100990.1|355100_355508_+	immunity 63 family protein	NA	NA	NA	NA	NA
WP_011100991.1|356778_357057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641962.1|357383_358001_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_011100992.1|358004_359159_-	MFS transporter	NA	NA	NA	NA	NA
WP_011100993.1|359162_359954_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003641965.1|360024_360897_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641966.1|361056_361872_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_011100994.1|362397_363774_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_011100995.1|363818_365003_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_003641969.1|365387_365591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641971.1|366002_366671_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_011100996.1|366667_366841_-|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnK	bacteriocin	NA	NA	NA	NA
WP_003641973.1|366871_367039_-|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnJ	bacteriocin	NA	NA	NA	NA
WP_003641974.1|367900_368101_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003641975.1|368228_368396_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003641976.1|368513_369713_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003641977.1|369743_370490_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641979.1|371367_371514_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_011100998.1|371704_373033_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_011100999.1|373033_373777_+	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003641982.1|373895_374639_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003646470.1|374943_375717_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003643811.1|375815_375974_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
WP_003641985.1|375998_376169_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_003641986.1|376435_378586_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	6.1e-45
WP_003641987.1|378601_379978_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_003641990.1|380824_381493_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641991.1|381579_382260_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011101000.1|382353_383040_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_063722041.1|383155_383443_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_003646479.1|383454_383748_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	48.3	9.9e-07
WP_011101002.1|384037_386347_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011101003.1|386605_387382_+	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_011101004.1|387821_388838_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011101005.1|389245_389956_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641998.1|390028_391390_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641999.1|391396_391585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642000.1|391574_391997_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003643816.1|392219_393575_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003642002.1|393592_395029_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.5	9.7e-31
WP_011101006.1|395149_396046_+	ROK family protein	NA	NA	NA	NA	NA
WP_003642004.1|396195_396942_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011101007.1|397054_398068_+|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_047672680.1|398522_399656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101009.1|399660_400455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101010.1|400624_401542_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_011101011.1|401587_402862_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003642010.1|402854_403814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646490.1|403835_404540_+	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_003642012.1|404539_405382_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_011101012.1|405978_406368_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003643823.1|406689_408741_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
>prophage 2
NC_004567	Lactobacillus plantarum WCFS1, complete genome	3308273	571807	664810	3308273	tRNA,terminase,capsid,tail,plate,protease,portal,integrase,head	Lactobacillus_phage(34.04%)	109	570101:570116	604538:604553
570101:570116	attL	CGTTTGAACTTCTAGT	NA	NA	NA	NA
WP_011101071.1|571807_572500_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_011101072.1|572689_574021_-	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.3	4.1e-68
WP_003640926.1|574096_574780_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_003640927.1|574788_575085_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011101073.1|575223_575760_+	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	46.4	1.1e-35
WP_003643928.1|576648_578028_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003640931.1|578043_579219_+	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_003640932.1|579544_581035_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011101074.1|581312_582725_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.0	2.3e-45
WP_003640934.1|582726_583137_+	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_003640935.1|583108_583894_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_003640936.1|583895_584441_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_003640938.1|584947_585550_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003637768.1|585611_585761_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003640939.1|585772_585958_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_003643932.1|586062_586611_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_003640942.1|587628_588054_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_003640943.1|588154_588844_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_003643933.1|589042_589546_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003637775.1|589607_589976_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_011101076.1|590127_591330_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A126GGK4	Streptococcus_phage	29.8	6.9e-38
WP_011101077.1|591509_592673_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_011101078.1|593162_593339_-	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	53.4	1.2e-07
WP_011101079.1|593480_594527_-	Ltp family lipoprotein	NA	V9QJ01	Oenococcus_phage	44.4	9.3e-23
WP_011101080.1|594556_594925_-	membrane protein	NA	NA	NA	NA	NA
WP_011101081.1|594997_595414_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	29.6	4.5e-05
WP_011101082.1|595425_595788_-	helix-turn-helix domain-containing protein	NA	A0A0U4KKM4	Exiguobacterium_phage	32.0	2.6e-09
WP_011101083.1|595960_596191_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011101084.1|596263_596578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101085.1|596615_596852_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	30.7	8.5e-09
WP_011101086.1|596998_597199_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011101087.1|597357_597540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101088.1|597600_598155_+	hypothetical protein	NA	O03909	Lactobacillus_phage	100.0	3.6e-98
WP_011101089.1|598160_598445_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063733331.1|598765_599203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101092.1|599199_600087_+	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	47.0	2.5e-61
WP_061876303.1|600118_600871_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	52.6	6.3e-74
WP_011101094.1|600952_601885_+	DUF4373 domain-containing protein	NA	A0A0P0HRQ2	Lactobacillus_phage	44.3	1.1e-56
WP_011101095.1|601881_602169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101096.1|602165_602696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101097.1|602692_603226_+	hypothetical protein	NA	O03915	Lactobacillus_phage	51.7	4.9e-36
WP_165442608.1|603221_603638_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	42.2	1.5e-21
WP_011101099.1|603634_603865_+	hypothetical protein	NA	O03916	Lactobacillus_phage	63.2	1.2e-23
WP_011101101.1|603995_604367_+	hypothetical protein	NA	A0A291I9N7	Lactobacillus_phage	67.0	7.8e-41
WP_011101103.1|604487_604670_+	hypothetical protein	NA	NA	NA	NA	NA
604538:604553	attR	ACTAGAAGTTCAAACG	NA	NA	NA	NA
WP_011101104.1|604662_605010_+	hypothetical protein	NA	O03921	Lactobacillus_phage	93.9	1.9e-57
WP_161792467.1|605009_605447_+	DUF1642 domain-containing protein	NA	Q5ULV5	Lactobacillus_virus	45.2	1.9e-14
WP_011101106.1|605443_605611_+	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	87.0	2.3e-13
WP_011101107.1|605738_606200_+	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	56.3	2.4e-39
WP_011101108.1|606571_607354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165442606.1|607574_607724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101110.1|607763_608360_+|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	33.3	5.8e-14
WP_011101111.1|608343_609630_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4IYR5	uncultured_Caudovirales_phage	50.4	3.3e-115
WP_162786275.1|609682_611278_+|portal	phage portal protein	portal	D2IZM0	Enterococcus_phage	34.2	1.0e-65
WP_011101113.1|611277_612222_+|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_011101114.1|612329_612977_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_011101115.1|612990_614061_+|capsid	phage capsid protein	capsid	A0A0S0N2Q7	Pseudomonas_phage	30.6	2.0e-33
WP_011101116.1|614075_614441_+|head,tail	phage head-tail connector protein	head,tail	H9A0V3	Staphylococcus_phage	38.2	3.0e-05
WP_011101117.1|614445_614769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101118.1|614758_615313_+|tail	tail protein	tail	NA	NA	NA	NA
WP_011101119.1|615313_615700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101120.1|615711_616299_+|tail	tail protein	tail	NA	NA	NA	NA
WP_011101121.1|616316_616829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101122.1|616897_617134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101123.1|617133_621138_+	tape measure protein	NA	E9LUR1	Lactobacillus_phage	44.3	5.2e-82
WP_011101124.1|621131_621869_+	hypothetical protein	NA	A0A1S5SA63	Streptococcus_phage	36.6	4.1e-41
WP_011101125.1|621868_623743_+|tail	phage tail protein	tail	A0A1X9IGI5	Lactococcus_phage	33.2	7.9e-49
WP_011101126.1|623747_624740_+	SGNH/GDSL hydrolase family protein	NA	A0A1J0MFI8	Staphylococcus_phage	41.0	4.1e-36
WP_011101127.1|624754_625369_+|plate	phage baseplate upper protein	plate	A0A1J0MFQ3	Staphylococcus_phage	47.8	7.3e-44
WP_011101128.1|625374_626115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101129.1|626115_626436_+	DUF2977 domain-containing protein	NA	NA	NA	NA	NA
WP_011101130.1|626435_626612_+	XkdX family protein	NA	NA	NA	NA	NA
WP_164920196.1|626637_627738_+	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	60.4	1.4e-45
WP_011101132.1|627738_628035_+	hypothetical protein	NA	A0A1I9KK55	Lactobacillus_phage	76.5	4.4e-39
WP_011101134.1|629227_629434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080315010.1|629599_629701_+	hypothetical protein	NA	C1KFN7	Lactobacillus_virus	66.7	9.1e-05
WP_011101135.1|629828_630098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163621584.1|630160_631351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101137.1|632145_633123_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_003640947.1|633135_633804_-	cell surface protein	NA	NA	NA	NA	NA
WP_011101138.1|634107_636711_+	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_003643936.1|636885_637461_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	41.7	4.9e-26
WP_003640950.1|637542_638553_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	60.5	3.1e-108
WP_003643938.1|638580_640746_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.5	5.7e-269
WP_003640952.1|640884_641115_-	redoxin NrdH	NA	X2KRY7	Enterococcus_phage	40.0	2.8e-09
WP_003640953.1|641337_641946_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003640954.1|641948_642455_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_011101139.1|642981_644679_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
WP_003640956.1|644700_645009_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003637790.1|645024_645624_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640957.1|645638_645890_+	YaaL family protein	NA	NA	NA	NA	NA
WP_011101140.1|646287_646953_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640965.1|646949_647279_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_003640966.1|647295_648315_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_003640967.1|648339_648687_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_003643942.1|648785_649682_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	9.9e-82
WP_003640969.1|649685_650471_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_003643943.1|650609_651605_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.2	5.9e-51
WP_003640973.1|653682_654537_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003640974.1|654533_655337_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_003640975.1|655326_656097_-	phosphonate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.8	4.9e-13
WP_003643945.1|656134_657187_-	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_003640977.1|657466_658192_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_011101142.1|658175_658754_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_003640979.1|658746_659202_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_011101143.1|659206_660253_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.4	1.0e-61
WP_003643947.1|661172_663155_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	28.7	2.0e-50
WP_003640983.1|663323_664001_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_011101144.1|664165_664810_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NC_004567	Lactobacillus plantarum WCFS1, complete genome	3308273	1083488	1090553	3308273	integrase	Escherichia_phage(50.0%)	6	1083083:1083096	1097474:1097487
1083083:1083096	attL	TTGTACTTTTCTCG	NA	NA	NA	NA
WP_011101289.1|1083488_1084352_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	62.4	1.5e-98
WP_011101290.1|1084374_1085664_+	glycosyl hydrolase	NA	A0A2K9VCN9	Lactobacillus_phage	24.4	1.5e-27
WP_003644155.1|1085723_1086305_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	45.1	4.3e-38
WP_003643249.1|1086314_1087343_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.1	4.9e-69
WP_011101291.1|1087412_1088255_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.2	4.2e-34
WP_011101297.1|1089965_1090553_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	41.9	2.1e-32
1097474:1097487	attR	TTGTACTTTTCTCG	NA	NA	NA	NA
>prophage 4
NC_004567	Lactobacillus plantarum WCFS1, complete genome	3308273	1300477	1310325	3308273		Lactobacillus_phage(87.5%)	9	NA	NA
WP_011101397.1|1300477_1301716_+	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	97.2	4.2e-216
WP_011101398.1|1301806_1302778_-	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	98.8	2.0e-181
WP_003643099.1|1302963_1303911_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_003643097.1|1304254_1304869_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_011101399.1|1304871_1307310_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.6	0.0e+00
WP_011101400.1|1307397_1307958_+	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	99.5	3.8e-100
WP_011101401.1|1308028_1308469_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	98.6	3.0e-76
WP_080499794.1|1308565_1308703_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003645220.1|1309329_1310325_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	38.8	3.1e-52
>prophage 5
NC_004567	Lactobacillus plantarum WCFS1, complete genome	3308273	2163937	2218340	3308273	capsid,tail,terminase,portal,holin,integrase,head	Lactobacillus_phage(52.94%)	68	2204682:2204703	2218518:2218539
WP_011101731.1|2163937_2164315_-|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	67.5	2.3e-16
WP_011101732.1|2164301_2164598_-	hypothetical protein	NA	A0A2K9VCD4	Lactobacillus_phage	71.4	2.1e-36
WP_164920204.1|2164598_2165711_-	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	35.6	1.1e-34
WP_011101735.1|2165895_2166135_-	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	71.2	3.8e-17
WP_011101736.1|2166131_2167274_-	collagen-like protein	NA	A0A2P0ZLF6	Lactobacillus_phage	84.2	1.7e-57
WP_011101737.1|2167328_2169524_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_011101738.1|2169513_2169771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164920180.1|2169767_2170946_-|tail	phage tail protein	tail	Q9T1A5	Listeria_phage	24.1	8.3e-20
WP_011101740.1|2170945_2171842_-|tail	phage tail family protein	tail	A8ATA8	Listeria_phage	28.2	7.7e-18
WP_011101741.1|2171851_2175925_-	tape measure protein	NA	E9LUR1	Lactobacillus_phage	47.7	3.1e-82
WP_076657353.1|2175924_2176161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101743.1|2176253_2176742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101744.1|2176775_2177342_-|tail	tail protein	tail	NA	NA	NA	NA
WP_011101745.1|2177353_2177740_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_011101746.1|2177741_2178296_-|tail	tail protein	tail	NA	NA	NA	NA
WP_011101747.1|2178285_2178609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101748.1|2178613_2178979_-|head,tail	phage head-tail connector protein	head,tail	A0A1W6JNH7	Staphylococcus_phage	38.5	5.2e-05
WP_011101749.1|2178993_2180052_-|capsid	phage capsid protein	capsid	A0A0S0N2Q7	Pseudomonas_phage	31.4	1.8e-34
WP_011101750.1|2180068_2180716_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_011101751.1|2180822_2181767_-|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_011101752.1|2181769_2183422_-|portal	phage portal protein	portal	D2IZF6	Enterococcus_phage	32.2	6.3e-66
WP_011101755.1|2184915_2185425_-|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	63.2	1.0e-46
WP_011101756.1|2185622_2185886_-	hypothetical protein	NA	A0A1S5SBT9	Streptococcus_phage	57.5	1.3e-21
WP_011101758.1|2187248_2187710_-	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	56.3	1.2e-38
WP_011101759.1|2187788_2187989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164920182.1|2188019_2188313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101762.1|2188528_2188840_-	hypothetical protein	NA	A0A2K9VC43	Lactobacillus_phage	43.1	1.3e-17
WP_164920206.1|2188912_2189320_-	hypothetical protein	NA	Q5ULS7	Lactobacillus_virus	46.8	2.5e-24
WP_011101764.1|2189537_2189705_-	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	89.8	5.6e-15
WP_011101765.1|2189697_2190078_-	endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_011101766.1|2190074_2190593_-	hypothetical protein	NA	O03915	Lactobacillus_phage	51.3	6.8e-35
WP_011101096.1|2190589_2191120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101767.1|2191116_2191404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164920183.1|2191400_2192309_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_011101769.1|2192475_2193141_-	DUF669 domain-containing protein	NA	O03912	Lactobacillus_phage	60.4	9.6e-66
WP_011101770.1|2193143_2193806_-	AAA family ATPase	NA	O03911	Lactobacillus_phage	85.5	2.9e-107
WP_011101771.1|2193812_2194322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023376660.1|2194764_2194941_+	YegP family protein	NA	NA	NA	NA	NA
WP_011101774.1|2195189_2195702_-	transcriptional regulator	NA	D6PST4	Lactobacillus_phage	42.9	4.0e-27
WP_011101775.1|2195769_2196075_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_011101776.1|2196116_2196257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164920184.1|2196253_2196475_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011101778.1|2196609_2196972_+	helix-turn-helix domain-containing protein	NA	A0A2R2ZGJ3	Clostridioides_phage	48.4	1.7e-08
WP_011101779.1|2196983_2197397_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	31.3	1.5e-05
WP_011101780.1|2197423_2197759_+	hypothetical protein	NA	A0A1B0Y4P2	Lactobacillus_phage	53.0	6.4e-26
WP_011101781.1|2197884_2198946_+	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	45.4	9.2e-87
WP_011101782.1|2199109_2199286_+	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	51.7	1.0e-06
WP_011101783.1|2199893_2201642_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011101784.1|2201695_2202610_+	DNA adenine methylase	NA	NA	NA	NA	NA
WP_011101785.1|2202696_2203818_+|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	32.7	1.7e-46
WP_003642774.1|2204168_2204375_-	hypothetical protein	NA	NA	NA	NA	NA
2204682:2204703	attL	AGTCAGCCAAAAGGACAGCCAA	NA	NA	NA	NA
WP_011101786.1|2204794_2205100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164920185.1|2205182_2205554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101788.1|2205704_2205974_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_011101790.1|2207592_2208693_-|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	34.3	1.8e-48
WP_076657360.1|2208693_2208894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101791.1|2208847_2210551_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.3	5.4e-121
WP_011101792.1|2210547_2211021_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_011101793.1|2211803_2212193_-	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	44.3	5.1e-19
WP_011101794.1|2212185_2212524_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	35.6	3.0e-07
WP_011101795.1|2212510_2212702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101796.1|2212723_2213197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101797.1|2213342_2214737_-	virulence protein	NA	Q4ZD27	Staphylococcus_phage	35.8	2.3e-69
WP_011101798.1|2214736_2215537_-	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_011101799.1|2215533_2215788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033613426.1|2216227_2216431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101802.1|2216563_2217130_+	helix-turn-helix domain-containing protein	NA	A0A139ZPI6	Marinitoga_camini_virus	47.5	1.9e-06
WP_011101803.1|2217182_2218340_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	34.5	3.0e-54
2218518:2218539	attR	AGTCAGCCAAAAGGACAGCCAA	NA	NA	NA	NA
>prophage 6
NC_004567	Lactobacillus plantarum WCFS1, complete genome	3308273	2421448	2429959	3308273		Synechococcus_phage(33.33%)	9	NA	NA
WP_011101893.1|2421448_2422027_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	2.1e-21
WP_011101894.1|2422019_2423045_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.0	3.2e-60
WP_003642591.1|2423041_2424496_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
WP_003645864.1|2424480_2426700_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.3	4.5e-144
WP_011101895.1|2426692_2427373_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003642588.1|2427372_2427627_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003642587.1|2427628_2428360_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_011101896.1|2428362_2429493_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003645861.1|2429476_2429959_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
