The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_008686	Paracoccus denitrificans PD1222 chromosome 1, complete sequence	2852282	236883	252819	2852282		Paracoccus_phage(28.57%)	21	NA	NA
WP_128492969.1|236883_237018_-	DUF4031 domain-containing protein	NA	D4FUN1	Pseudomonas_phage	86.7	3.4e-07
WP_128492970.1|237017_237221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041529705.1|237229_237436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011746604.1|237428_237779_-	DUF4326 domain-containing protein	NA	A0A222ZLE2	Mycobacterium_phage	47.5	2.9e-21
WP_011746605.1|237775_238126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128492971.1|238257_238515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139171635.1|238788_239223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011746608.1|239189_239984_-	DNA adenine methylase	NA	A0A0K1LM14	Caulobacter_phage	62.0	9.6e-89
WP_011746609.1|239980_240562_-	hypothetical protein	NA	A0A2I2MUH3	uncultured_Caudovirales_phage	35.7	3.9e-39
WP_128493022.1|240558_240924_-	hypothetical protein	NA	A0A1B0V7P0	Salmonella_phage	36.5	2.9e-16
WP_011746611.1|242419_242716_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	38.0	6.7e-11
WP_011746612.1|242715_243093_+	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	44.4	2.5e-23
WP_041529709.1|243436_243670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011746614.1|243956_244910_-	DUF3380 domain-containing protein	NA	D2JTA3	Pseudomonas_phage	37.2	5.3e-17
WP_011746615.1|244979_245237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011746616.1|245263_245617_-	DUF2793 domain-containing protein	NA	A0A0B5A0F6	Paracoccus_phage	51.7	2.7e-27
WP_011746617.1|245624_249644_-	hypothetical protein	NA	A0A0B5A7K5	Paracoccus_phage	40.0	1.2e-243
WP_011746618.1|249648_250086_-	peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	42.2	1.8e-28
WP_011746619.1|250082_250967_-	DUF2163 domain-containing protein	NA	A0A0B5A5B8	Paracoccus_phage	46.0	2.7e-68
WP_011746620.1|250963_251590_-	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	58.3	4.6e-62
WP_157137420.1|251589_252819_-	hypothetical protein	NA	Q6UYJ3	Burkholderia_phage	35.9	6.2e-10
>prophage 2
NC_008686	Paracoccus denitrificans PD1222 chromosome 1, complete sequence	2852282	318370	349151	2852282	protease,tail,terminase,integrase,head,capsid,portal	Rhizobium_phage(21.05%)	42	317837:317858	350241:350262
317837:317858	attL	CATCCGCGCCGAGACCATCGCC	NA	NA	NA	NA
WP_011746682.1|318370_319441_-|integrase	site-specific integrase	integrase	A0A067XRF8	Caulobacter_phage	29.1	1.5e-15
WP_041529722.1|319639_319948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011746684.1|319991_320720_-	hypothetical protein	NA	A0A0U2BXK1	Paracoccus_phage	59.5	2.9e-76
WP_011746685.1|320716_321160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041529723.1|321149_321356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011746686.1|321355_322261_-	hypothetical protein	NA	R9TN97	Rhizobium_phage	78.6	1.9e-24
WP_011746687.1|322257_322677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011746688.1|322673_325319_-	DNA methylase N-4	NA	R9TRS8	Rhizobium_phage	60.6	0.0e+00
WP_011746689.1|325322_326441_-	DNA polymerase III subunit beta	NA	A0A0A8IL17	Aurantimonas_phage	32.2	5.2e-32
WP_011746690.1|326576_326789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041529724.1|326788_326989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139171663.1|326988_327180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074988200.1|327455_327941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128492974.1|328237_328573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011746693.1|328572_329100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041529728.1|329083_329332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011746695.1|329664_329997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128493023.1|330028_330304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011746697.1|330300_330513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011746698.1|330674_331004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011746699.1|331124_332267_+	hypothetical protein	NA	I3UM61	Rhodobacter_phage	54.4	2.5e-98
WP_011746700.1|332259_334101_+	P4 family phage/plasmid primase	NA	G8DGC0	Emiliania_huxleyi_virus	49.3	2.5e-148
WP_011746702.1|334559_335318_+	hypothetical protein	NA	I3ULZ3	Rhodobacter_phage	30.9	7.0e-12
WP_011746703.1|335487_335838_+	HNH endonuclease	NA	I3ULZ4	Rhodobacter_phage	56.7	1.0e-26
WP_011746704.1|335887_336148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011746705.1|336321_336825_+	resolvase	NA	I3ULZ5	Rhodobacter_phage	48.4	6.4e-30
WP_011746706.1|336814_338536_+|terminase	terminase large subunit	terminase	Q3HQS7	Burkholderia_phage	42.3	9.6e-118
WP_011746707.1|338535_339873_+|portal	phage portal protein	portal	M4QP41	Tetraselmis_viridis_virus	40.2	5.2e-79
WP_011746708.1|339859_340702_+|protease	Clp protease ClpP	protease	A0A0U4B0F3	Pseudomonas_phage	54.0	7.9e-73
WP_011746709.1|340713_342063_+|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	47.4	1.3e-74
WP_011746710.1|342120_342429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074810761.1|342353_342965_+	hypothetical protein	NA	M4QNT5	Tetraselmis_viridis_virus	58.1	1.4e-26
WP_041529730.1|342924_343482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011746713.1|343475_343835_+|head,tail	head-tail adaptor protein	head,tail	B4UTP9	Rhizobium_phage	35.8	1.1e-07
WP_041529731.1|343831_344218_+	DUF3168 domain-containing protein	NA	A0A141GEW7	Brucella_phage	43.0	7.6e-15
WP_128492975.1|344214_344571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074810758.1|344595_345042_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_041529733.1|345034_345232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011746717.1|345233_345695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011746718.1|345694_346084_+	hypothetical protein	NA	B4UTQ4	Rhizobium_phage	45.5	5.7e-18
WP_157137422.1|346092_346245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011746719.1|346244_349151_+	hypothetical protein	NA	A0A1V1FCQ8	Vibrio_phage	56.9	9.8e-14
350241:350262	attR	CATCCGCGCCGAGACCATCGCC	NA	NA	NA	NA
>prophage 3
NC_008686	Paracoccus denitrificans PD1222 chromosome 1, complete sequence	2852282	940531	984568	2852282	protease,terminase,integrase,tRNA,portal,capsid,transposase	Rhodobacter_phage(34.78%)	54	943367:943384	965781:965798
WP_011747294.1|940531_942478_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.5	1.7e-118
WP_011747295.1|942648_943398_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
943367:943384	attL	CGCTGGACGAGGTGCTGG	NA	NA	NA	NA
WP_011747296.1|943440_944784_-	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_081465055.1|945353_947219_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_011747298.1|947332_947806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011747299.1|947954_948542_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_128493029.1|948708_949782_-|integrase	tyrosine-type recombinase/integrase	integrase	I3UM24	Rhodobacter_phage	46.6	7.4e-76
WP_041529790.1|949784_950015_-	helix-turn-helix domain-containing protein	NA	I3UM25	Rhodobacter_phage	64.9	3.2e-21
WP_011747302.1|950014_950743_-	hypothetical protein	NA	A0A0U2BXK1	Paracoccus_phage	60.8	7.0e-78
WP_011747303.1|950739_951180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011747304.1|951169_951442_-	hypothetical protein	NA	A0A0K1Y6J3	Rhodobacter_phage	65.5	8.6e-05
WP_011747305.1|951441_952170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011747306.1|952166_952967_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	57.1	2.6e-25
WP_011747307.1|952963_953392_-	hypothetical protein	NA	A0A097PBD6	Delftia_phage	60.3	1.6e-37
WP_011747308.1|953391_956043_-	DNA methylase N-4	NA	R9TRS8	Rhizobium_phage	60.9	0.0e+00
WP_011747309.1|956046_957165_-	DNA polymerase III subunit beta	NA	A0A0A8IL17	Aurantimonas_phage	32.4	3.1e-32
WP_011747310.1|957301_957514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011747311.1|957513_957774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041529791.1|957770_957962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074810797.1|958087_958315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011747313.1|958304_958832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011747314.1|959003_959615_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_041529793.1|959726_959993_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041529794.1|960024_960303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041529795.1|960622_960904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128492985.1|961050_961365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011747319.1|961361_961556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011747320.1|961552_962695_+	hypothetical protein	NA	I3UM61	Rhodobacter_phage	54.4	9.9e-103
WP_011747321.1|962687_962936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011747322.1|962932_964771_+	P4 family phage/plasmid primase	NA	H6WBR7	Rhodobacter_phage	49.9	1.9e-143
WP_011747323.1|965146_965905_+	hypothetical protein	NA	I3ULZ3	Rhodobacter_phage	32.3	7.0e-12
965781:965798	attR	CGCTGGACGAGGTGCTGG	NA	NA	NA	NA
WP_011746703.1|966074_966425_+	HNH endonuclease	NA	I3ULZ4	Rhodobacter_phage	56.7	1.0e-26
WP_128492986.1|966417_966735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011746705.1|966909_967413_+	resolvase	NA	I3ULZ5	Rhodobacter_phage	48.4	6.4e-30
WP_011747325.1|967402_969124_+|terminase	terminase large subunit	terminase	Q3HQS7	Burkholderia_phage	42.5	6.7e-119
WP_011747326.1|969123_970461_+|portal	phage portal protein	portal	M4QP41	Tetraselmis_viridis_virus	40.2	6.8e-79
WP_011746708.1|970447_971290_+|protease	Clp protease ClpP	protease	A0A0U4B0F3	Pseudomonas_phage	54.0	7.9e-73
WP_011746709.1|971301_972651_+|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	47.4	1.3e-74
WP_011746710.1|972708_973017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074810761.1|972941_973553_+	hypothetical protein	NA	M4QNT5	Tetraselmis_viridis_virus	58.1	1.4e-26
WP_041529730.1|973512_974070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011747327.1|974063_974414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011747328.1|974410_974818_+	DUF3168 domain-containing protein	NA	A0A141GEW7	Brucella_phage	31.6	2.9e-12
WP_041529799.1|974980_975460_+	HK97 gp10 family phage protein	NA	B4UTQ0	Rhizobium_phage	36.2	2.8e-14
WP_049792299.1|975565_975982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011747331.1|975981_976437_+	gene transfer agent family protein	NA	A0A141GEX0	Brucella_phage	42.9	1.4e-15
WP_157137426.1|976433_976586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011747332.1|976762_979738_+	tape measure protein	NA	A0A2D0W9N5	Bordetella_phage	41.0	9.6e-49
WP_011747333.1|979737_980418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011747334.1|980414_980981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011747335.1|980965_981337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011747336.1|981336_983379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011747337.1|983442_983823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086000139.1|983810_984568_-|transposase	IS5-like element IS1248A family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_008686	Paracoccus denitrificans PD1222 chromosome 1, complete sequence	2852282	2067434	2073746	2852282	terminase	Aeropyrum_pernix_spindle-shaped_virus(12.5%)	10	NA	NA
WP_041529933.1|2067434_2069102_-	DNA cytosine methyltransferase	NA	G3CB01	Aeropyrum_pernix_spindle-shaped_virus	28.1	7.6e-19
WP_011748349.1|2069037_2069502_+	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	49.7	1.5e-36
WP_011748350.1|2069677_2070169_-|terminase	phage terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	48.7	3.7e-30
WP_011748351.1|2070152_2070623_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B0RXI5	Streptococcus_phage	33.6	8.4e-16
WP_011748352.1|2070829_2071036_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	56.9	1.2e-11
WP_049792365.1|2071145_2071421_+	DUF982 domain-containing protein	NA	NA	NA	NA	NA
WP_157137435.1|2071519_2071678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011748354.1|2071690_2071915_-	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	66.7	1.2e-17
WP_049792366.1|2071911_2073273_-	site-specific DNA-methyltransferase	NA	A0A0A8ILE7	Aurantimonas_phage	41.3	1.2e-78
WP_018000081.1|2073401_2073746_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	65.8	2.1e-24
>prophage 5
NC_008686	Paracoccus denitrificans PD1222 chromosome 1, complete sequence	2852282	2138070	2144900	2852282		Acinetobacter_phage(50.0%)	8	NA	NA
WP_011748423.1|2138070_2138661_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	54.5	8.0e-56
WP_011748424.1|2138657_2139695_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	41.0	1.0e-58
WP_011748425.1|2139687_2140356_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	49.2	4.2e-37
WP_011748426.1|2140365_2141157_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.1	3.2e-60
WP_011748427.1|2141153_2141627_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_011748428.1|2141637_2142810_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011748429.1|2142919_2143618_+	transcriptional repressor LexA	NA	E5DV74	Deep-sea_thermophilic_phage	35.6	6.8e-14
WP_011748430.1|2143742_2144900_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	33.0	2.3e-46
>prophage 1
NC_008687	Paracoccus denitrificans PD1222 chromosome 2, complete sequence	1730097	49989	64313	1730097	protease,portal,head,capsid,tail	Paracoccus_phage(27.27%)	17	NA	NA
WP_011749160.1|49989_50712_-	DUF2793 domain-containing protein	NA	A0A1V0DY81	Dinoroseobacter_phage	33.1	6.8e-25
WP_011749161.1|50704_54595_-	phage host specificity protein	NA	A0A0K1LL82	Rhodobacter_phage	38.0	1.2e-211
WP_011749162.1|54613_55039_-	peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	53.7	7.3e-35
WP_011749163.1|55035_55854_-	DUF2163 domain-containing protein	NA	A0A0B5A5B8	Paracoccus_phage	40.6	8.8e-45
WP_041530318.1|55850_56483_-	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	47.4	4.0e-53
WP_011749165.1|56484_57156_-|tail	phage tail tape measure protein	tail	C0LP53	Escherichia_virus	41.5	9.8e-10
WP_011749166.1|57180_57393_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_011749167.1|57389_57707_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_011749168.1|57708_58122_-|tail	phage major tail protein, TP901-1 family	tail	I3UM07	Rhodobacter_phage	36.6	1.3e-15
WP_011749169.1|58134_58554_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_011749170.1|58550_58901_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_011749171.1|58897_59515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011749172.1|59643_60810_-|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	36.7	2.8e-60
WP_011749173.1|60833_61391_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	50.9	1.1e-33
WP_011749174.1|61371_61605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011749175.1|61606_62809_-|portal	phage portal protein	portal	A0A0K1LLE7	Bacillus_phage	37.4	7.5e-61
WP_086000162.1|62957_64313_-	DNA-packaging protein	NA	A0A0K1LMR9	Caulobacter_phage	40.2	1.8e-71
>prophage 2
NC_008687	Paracoccus denitrificans PD1222 chromosome 2, complete sequence	1730097	797815	805977	1730097		uncultured_virus(33.33%)	9	NA	NA
WP_011749885.1|797815_799594_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	39.7	1.1e-39
WP_011749886.1|799653_799950_-	DUF2218 domain-containing protein	NA	NA	NA	NA	NA
WP_011749887.1|800144_800831_-	aquaporin Z	NA	A0A1B1ISL4	uncultured_Mediterranean_phage	55.2	4.0e-06
WP_011749888.1|800978_802793_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.3	2.9e-32
WP_041530380.1|802983_803190_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	51.6	1.6e-11
WP_041530381.1|803246_803456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157137453.1|803617_803767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011749890.1|804011_805649_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	61.0	1.2e-173
WP_019353022.1|805689_805977_-	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	53.3	2.2e-19
>prophage 3
NC_008687	Paracoccus denitrificans PD1222 chromosome 2, complete sequence	1730097	885406	892533	1730097	terminase	Azospirillum_phage(14.29%)	14	NA	NA
WP_041530394.1|885406_885793_-	helix-turn-helix transcriptional regulator	NA	B0VK04	Azospirillum_phage	35.8	6.7e-11
WP_041530395.1|885878_886097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011749983.1|886093_886435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011749984.1|886552_886882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011749985.1|886881_887592_+	hypothetical protein	NA	A0A291AUT5	Sinorhizobium_phage	58.1	7.1e-67
WP_041530397.1|887588_887801_+	hypothetical protein	NA	A0A1X9HWB0	Ruegeria_phage	50.0	7.1e-07
WP_041530398.1|887802_888087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128493056.1|888155_888629_+	hypothetical protein	NA	A0A218MLE3	uncultured_virus	37.6	7.4e-20
WP_128493057.1|888637_888994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074988172.1|888993_889752_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	38.5	4.8e-13
WP_041530399.1|889729_890374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011749989.1|890379_890703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011749990.1|890705_891107_+	hypothetical protein	NA	Q716H4	Shigella_phage	38.5	1.7e-17
WP_011749991.1|891207_892533_+|terminase	PBSX family phage terminase large subunit	terminase	K4NWT7	Pseudomonas_phage	36.1	1.7e-34
>prophage 4
NC_008687	Paracoccus denitrificans PD1222 chromosome 2, complete sequence	1730097	896329	907511	1730097	head,tail	Salmonella_phage(28.57%)	12	NA	NA
WP_011749994.1|896329_898006_+|head,tail	head-tail connector protein	head,tail	T1S9Z7	Salmonella_phage	36.8	9.1e-97
WP_011749995.1|898002_898332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011749996.1|898324_898981_+	hypothetical protein	NA	W6MWW5	Pseudomonas_phage	41.4	6.9e-16
WP_011749997.1|898984_900016_+	hypothetical protein	NA	Q775C7	Bordetella_phage	42.7	3.7e-72
WP_011749998.1|900073_900502_+	hypothetical protein	NA	T1SA71	Salmonella_phage	50.0	6.0e-21
WP_041530401.1|900509_900818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011750000.1|900875_901178_+	hypothetical protein	NA	W8VYP4	Pseudomonas_phage	67.0	5.0e-30
WP_011750001.1|901228_901837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011750002.1|901836_903876_+	hypothetical protein	NA	Q775D1	Bordetella_phage	38.3	1.9e-128
WP_011750003.1|903877_904345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011750004.1|904344_904896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011750005.1|904895_907511_+	lytic transglycosylase domain-containing protein	NA	A0A0K2QJE7	Achromobacter_phage	32.6	1.4e-19
