The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017196	Bacillus subtilis subsp. natto BEST195, complete genome	4105380	672183	744680	4105380	coat,transposase,tRNA	Synechococcus_phage(15.79%)	60	NA	NA
WP_014479048.1|672183_673725_-|coat	outer spore coat copper-dependent laccase CotA	coat	NA	NA	NA	NA
WP_014479049.1|673873_675283_-	GABA permease	NA	NA	NA	NA	NA
WP_009966725.1|675320_675608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479050.1|675680_676553_+	manganese transporter MneS	NA	NA	NA	NA	NA
WP_014479051.1|676703_677666_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_014479052.1|677665_678862_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_014479053.1|678883_681097_+	DUF4129 domain-containing protein	NA	NA	NA	NA	NA
WP_003244399.1|681259_682801_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.5	5.7e-21
WP_014479055.1|683032_683812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479056.1|684439_685762_+	hypoxanthine/guanine permease PbuG	NA	A0A0R6PHV4	Moraxella_phage	31.2	5.2e-39
WP_014479057.1|685972_686776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479058.1|686934_687102_+	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_009966729.1|687315_687870_+	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_003219403.1|687869_688067_+	NETI motif-containing protein	NA	NA	NA	NA	NA
WP_003244134.1|688389_688878_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.9	8.7e-24
WP_014479059.1|688870_690013_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003233955.1|690009_691305_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.7	5.9e-19
WP_014479060.1|691378_692104_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	1.2e-45
WP_003219409.1|692096_692351_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003243954.1|692347_693031_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003233949.1|693014_695243_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.1	3.8e-159
WP_003233947.1|695218_696649_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
WP_014479061.1|696750_697791_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	1.7e-64
WP_014479062.1|697787_698375_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.0	2.4e-28
WP_014479063.1|698371_699910_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.6	3.0e-78
WP_014479064.1|699925_701194_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_014479065.1|701231_701654_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014479066.1|701797_703072_+	amino acid permease	NA	NA	NA	NA	NA
WP_014479068.1|703442_705185_+	adenine deaminase	NA	NA	NA	NA	NA
WP_014479069.1|705211_706207_+	DUF3048 domain-containing protein	NA	NA	NA	NA	NA
WP_014479070.1|706209_706524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031600238.1|706558_708136_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_014479073.1|708400_709087_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_014479074.1|709148_711368_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.9	3.2e-134
WP_014479075.1|711391_713398_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.3	3.1e-128
WP_014479076.1|713413_714604_+	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_087614160.1|714720_715870_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_072592588.1|716056_717067_+	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
WP_010886431.1|717104_717803_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.9	2.7e-18
WP_003242814.1|717908_719387_-	proline transporter OpuE	NA	NA	NA	NA	NA
WP_003219442.1|719800_720091_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_014479078.1|720106_721564_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003219444.1|721577_723008_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_014479079.1|723044_723893_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014479080.1|724024_727183_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.5	5.0e-64
WP_003233894.1|727333_728245_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	29.7	1.2e-21
WP_031600241.1|728554_729931_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	46.6	3.6e-115
WP_014479083.1|731252_731462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029317421.1|731695_734713_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_014479085.1|735141_735339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479086.1|735937_736411_-	TIGR01741 family protein	NA	NA	NA	NA	NA
WP_031600245.1|736415_738425_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	57.4	3.7e-145
WP_014479091.1|739801_740932_+	response regulator aspartate phosphatase RapH	NA	A0A1P8CWN8	Bacillus_phage	45.9	9.8e-87
WP_003242557.1|740921_741095_+	phosphatase RapH inhibitor PhrH	NA	NA	NA	NA	NA
WP_003233863.1|741254_741974_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_049832634.1|742107_742725_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014479093.1|742839_743424_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014479094.1|743600_743849_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_014479095.1|743832_744096_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_014479096.1|744110_744680_+|coat	spore coat protein CotJC	coat	NA	NA	NA	NA
>prophage 2
NC_017196	Bacillus subtilis subsp. natto BEST195, complete genome	4105380	1195096	1243882	4105380	transposase,coat,tRNA	Planktothrix_phage(22.22%)	57	NA	NA
WP_087614160.1|1195096_1196247_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_003245356.1|1196424_1196604_+	YjzC family protein	NA	NA	NA	NA	NA
WP_003245236.1|1196649_1196835_-	DUF2929 domain-containing protein	NA	NA	NA	NA	NA
WP_014479433.1|1197083_1197818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479435.1|1197899_1198457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479436.1|1198547_1199501_+	transcriptional regulator Med	NA	NA	NA	NA	NA
WP_003224559.1|1199515_1199707_+	ComG operon repressor	NA	NA	NA	NA	NA
WP_031600361.1|1199736_1199964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232971.1|1200128_1201067_+	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_014479438.1|1201089_1202331_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_014479439.1|1202406_1203192_+	DUF2268 domain-containing protein	NA	NA	NA	NA	NA
WP_003232965.1|1203383_1204370_+	oligopeptide ABC transporter ATP-binding protein AppD	NA	G9BWD6	Planktothrix_phage	32.9	5.7e-22
WP_003232964.1|1204366_1205356_+	oligopeptide ABC transporter ATP-binding protein AppF	NA	F2Y302	Organic_Lake_phycodnavirus	26.1	6.7e-07
WP_014479440.1|1205443_1207075_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003245828.1|1207150_1208101_+	oligopeptide ABC transporter permease AppB	NA	NA	NA	NA	NA
WP_014479441.1|1208117_1209029_+	oligopeptide ABC transporter permease AppC	NA	NA	NA	NA	NA
WP_003239298.1|1209234_1209987_+	YjbA family protein	NA	A0A0A0RP53	Bacillus_phage	43.9	5.4e-49
WP_003245134.1|1210021_1211014_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014479443.1|1211757_1213395_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_014479444.1|1213502_1214438_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_003232954.1|1214441_1215359_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_072173823.1|1215363_1216440_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	30.8	2.1e-17
WP_003245567.1|1216441_1217359_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.2e-05
WP_072592593.1|1217466_1218684_+	MFS transporter	NA	NA	NA	NA	NA
WP_003224597.1|1218847_1219426_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014476435.1|1219606_1220002_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_014479447.1|1220044_1220701_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	38.0	1.1e-29
WP_119122854.1|1220870_1221011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479448.1|1220977_1221634_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_003245684.1|1221628_1221751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479449.1|1221794_1222946_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_173401378.1|1223175_1225005_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003244944.1|1225042_1225210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245184.1|1225524_1226424_-	adaptor protein SpxH	NA	NA	NA	NA	NA
WP_003232928.1|1226420_1226819_-	group 2 truncated hemoglobin YjbI	NA	NA	NA	NA	NA
WP_072592594.1|1227073_1227619_-	bifunctional muramidase/murein lytic transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	73.7	5.1e-41
WP_014479452.1|1227822_1228395_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_014479453.1|1228519_1228888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245294.1|1228916_1229552_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003232918.1|1229570_1230371_+	NAD kinase	NA	NA	NA	NA	NA
WP_014479454.1|1230385_1231285_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003232912.1|1231297_1232032_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A8E2N0	Enterococcus_phage	24.8	7.2e-06
WP_014479455.1|1232266_1234111_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_014479456.1|1234359_1235070_+	thiaminase II	NA	NA	NA	NA	NA
WP_014479457.1|1235044_1235662_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_014479458.1|1235645_1236755_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_072592596.1|1236754_1236955_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_072592522.1|1236951_1237722_+	thiazole synthase	NA	NA	NA	NA	NA
WP_014479461.1|1237718_1238729_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_014479462.1|1238747_1239563_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003232896.1|1239698_1240475_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_031600370.1|1240575_1241259_+|coat	spore coat protein CotO	coat	NA	NA	NA	NA
WP_014479464.1|1241351_1241801_-|coat	spore coat protein CotZ	coat	NA	NA	NA	NA
WP_014479465.1|1241928_1242417_-|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_014479466.1|1242568_1243051_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014479467.1|1243135_1243456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479468.1|1243495_1243882_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 3
NC_017196	Bacillus subtilis subsp. natto BEST195, complete genome	4105380	1326821	1361701	4105380	transposase,plate,tail,holin,terminase,portal	uncultured_Caudovirales_phage(32.35%)	45	NA	NA
WP_087614160.1|1326821_1327972_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_015252291.1|1328384_1329521_+	response regulator aspartate phosphatase RapA	NA	A0A1P8CWN8	Bacillus_phage	47.4	4.9e-94
WP_003245487.1|1329510_1329645_+	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
WP_014479545.1|1330042_1330996_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	73.8	1.6e-66
WP_014479546.1|1331035_1331413_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	7.9e-17
WP_014479547.1|1331517_1332120_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	48.7	1.4e-44
WP_003245071.1|1332196_1333033_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_003232721.1|1333076_1333673_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
WP_003232719.1|1333835_1334177_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
WP_003232712.1|1334355_1334535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232710.1|1334521_1335358_+	hypothetical protein	NA	S6BFM4	Thermus_phage	27.8	6.7e-24
WP_072592528.1|1335257_1336058_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	1.1e-60
WP_003245588.1|1336057_1336225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479549.1|1336309_1336660_+	phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
WP_014476537.1|1336656_1336863_+	phage-like element PBSX protein XtrA	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	2.1e-11
WP_014479550.1|1336978_1337488_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	39.2	6.5e-22
WP_003244697.1|1337603_1338401_+|terminase	terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	50.2	8.0e-59
WP_003232697.1|1338397_1339699_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.0	9.1e-153
WP_003232695.1|1339702_1341190_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.7	1.7e-139
WP_014479551.1|1341209_1342037_+	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	59.2	1.6e-54
WP_003232690.1|1342062_1342998_+	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
WP_014479552.1|1343019_1343403_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.5	1.4e-13
WP_009967053.1|1343399_1343756_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_003245226.1|1343752_1344238_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.0	2.1e-38
WP_014479553.1|1344250_1344691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232679.1|1344694_1344913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479554.1|1344909_1346310_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7S087	Clostridium_phage	39.3	3.0e-77
WP_014479555.1|1346311_1346755_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	44.5	1.9e-25
WP_014479556.1|1346846_1347293_+	hypothetical protein	NA	A0A0A7RTY8	Clostridium_phage	36.8	1.0e-10
WP_014479557.1|1347334_1347475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031600410.1|1347475_1352479_+	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	44.8	6.4e-37
WP_014479559.1|1352471_1353131_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A8WJR4	Clostridium_phage	33.2	1.1e-24
WP_003245730.1|1353146_1354124_+	phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.6	1.0e-39
WP_003244812.1|1354123_1354390_+	DUF2577 family protein	NA	S6C459	Thermus_phage	36.4	1.7e-05
WP_014479560.1|1354447_1354873_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.0	3.0e-12
WP_003232669.1|1354865_1355912_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	1.3e-72
WP_014476551.1|1355895_1356474_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	34.2	3.9e-15
WP_003232665.1|1356470_1356743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479561.1|1356745_1358809_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	34.5	2.6e-29
WP_014479562.1|1358820_1359150_+	hypothetical protein	NA	A0A2H4JCI0	uncultured_Caudovirales_phage	40.7	1.3e-15
WP_014479563.1|1359146_1359311_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	1.9e-15
WP_014479564.1|1359357_1360197_+	phage-like element PBSX protein XepA	NA	NA	NA	NA	NA
WP_014479565.1|1360249_1360519_+	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	1.4e-23
WP_014479566.1|1360531_1360795_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	64.4	6.1e-24
WP_014479567.1|1360807_1361701_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	69.2	5.2e-83
>prophage 4
NC_017196	Bacillus subtilis subsp. natto BEST195, complete genome	4105380	1798086	1897721	4105380	transposase,head,plate,protease,capsid,tail,holin,coat,terminase,portal,tRNA,integrase	Bacillus_phage(56.36%)	111	1800050:1800109	1864828:1864993
WP_017697674.1|1798086_1798620_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	82.5	1.0e-70
WP_031600532.1|1798619_1798787_+	hypothetical protein	NA	D6R3Y4	Bacillus_phage	87.5	4.4e-12
WP_031600391.1|1798907_1800119_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	26.8	2.2e-23
1800050:1800109	attL	ACTGTTCGATAATCTTGTTAGCTAATTCTACGGAGTTCGGATCTCTTTTCAATTTCCCCA	NA	NA	NA	NA
WP_072592534.1|1801165_1801621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479830.1|1801775_1802333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479831.1|1802453_1803068_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003231786.1|1803206_1803563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072592535.1|1803641_1804466_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_033881122.1|1804576_1805905_-|protease	serine protease AprX	protease	A0A1B0T6A2	Bacillus_phage	33.6	1.2e-27
WP_014476869.1|1806129_1806363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479835.1|1806642_1807350_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	56.9	3.2e-51
WP_014479836.1|1807419_1807872_+	OsmC family protein	NA	NA	NA	NA	NA
WP_014479837.1|1807885_1808239_-	multidrug efflux SMR transporter subunit EbrB	NA	NA	NA	NA	NA
WP_009967307.1|1808252_1808570_-	multidrug efflux SMR transporter subunit EbrA	NA	NA	NA	NA	NA
WP_014479838.1|1808704_1808983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072592536.1|1809071_1809485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479840.1|1809584_1810529_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003221097.1|1810568_1810790_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_014479841.1|1810984_1811257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245262.1|1811338_1811569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003231758.1|1811811_1812204_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
WP_014479842.1|1812163_1814266_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
WP_003231754.1|1814283_1815273_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
WP_003245105.1|1815322_1815943_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	1.6e-46
WP_014479843.1|1816006_1816774_-	sporulation-specific N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	49.5	1.2e-51
WP_003231746.1|1817414_1818383_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
WP_015483254.1|1818515_1819778_+	GTPase HflX	NA	NA	NA	NA	NA
WP_014479845.1|1819795_1821061_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003238341.1|1821170_1821578_+	transcriptional repressor GlnR	NA	NA	NA	NA	NA
WP_031600540.1|1821636_1822971_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_033881119.1|1823083_1824238_-|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	38.9	8.3e-65
WP_105778744.1|1824256_1825312_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0F6N3H6	Staphylococcus_phage	24.2	1.7e-08
WP_014479849.1|1825295_1825682_-	helix-turn-helix transcriptional regulator	NA	R9W020	Paenibacillus_phage	31.4	9.0e-08
WP_033881118.1|1825806_1826025_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CZL1	Paenibacillus_phage	63.2	2.1e-17
WP_014479850.1|1826139_1826904_+	phage antirepressor KilAC domain-containing protein	NA	A8ATN0	Listeria_phage	49.1	1.0e-47
WP_014479851.1|1826919_1827231_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_105778750.1|1827291_1827483_+	hypothetical protein	NA	Q9ZXD0	Bacillus_phage	53.1	7.1e-06
WP_014479853.1|1827479_1827755_+	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	47.1	1.2e-19
WP_014479855.1|1827950_1828505_+	host-nuclease inhibitor Gam family protein	NA	Q9ZXC8	Bacillus_phage	96.2	3.1e-94
WP_014479856.1|1828508_1829444_+	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	96.5	2.0e-170
WP_014479857.1|1829433_1829748_+	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	99.0	1.5e-53
WP_014479858.1|1829768_1830206_+	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	97.2	1.3e-79
WP_014479859.1|1830266_1832684_+	hypothetical protein	NA	D6R422	Bacillus_phage	88.7	0.0e+00
WP_014479860.1|1832883_1833321_+	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	91.7	4.8e-74
WP_014479861.1|1833317_1833857_+	ERCC4 domain-containing protein	NA	Q9ZXC2	Bacillus_phage	96.1	1.8e-94
WP_014479862.1|1833891_1834407_+	hypothetical protein	NA	D6R425	Bacillus_phage	93.0	8.7e-91
WP_046159992.1|1834660_1835074_+	ArpU family transcriptional regulator	NA	D6R428	Bacillus_phage	97.0	2.1e-63
WP_033881110.1|1835445_1835829_+	hypothetical protein	NA	A0A075M5R4	Enterococcus_phage	43.3	1.2e-17
WP_033881107.1|1835831_1836038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479865.1|1836276_1836762_+|terminase	phage terminase small subunit P27 family	terminase	A0A1Q1PVW3	Staphylococcus_phage	36.0	4.2e-18
WP_014479866.1|1836751_1838485_+|terminase	terminase large subunit	terminase	A0A2H4JCI4	uncultured_Caudovirales_phage	48.9	2.1e-144
WP_014479867.1|1838501_1838708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479868.1|1838712_1839939_+|portal	phage portal protein	portal	A0A1J0MFU3	Staphylococcus_phage	39.4	2.4e-70
WP_014479869.1|1839931_1840528_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0MFL1	Staphylococcus_phage	53.8	3.3e-49
WP_014479870.1|1840575_1841784_+|capsid	phage major capsid protein	capsid	A0A2H4J824	uncultured_Caudovirales_phage	49.8	4.9e-76
WP_014479871.1|1841811_1842195_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	56.8	1.4e-05
WP_014479872.1|1842249_1842543_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	33.0	2.6e-07
WP_014479873.1|1842532_1842859_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_031600548.1|1842858_1843251_+	HK97 gp10 family phage protein	NA	A0A0M5M1E5	Enterococcus_phage	37.9	3.0e-11
WP_014479875.1|1843247_1843655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479876.1|1843660_1844245_+	hypothetical protein	NA	U5U3Z7	Lactobacillus_phage	36.5	9.1e-28
WP_014479877.1|1844304_1844667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479878.1|1844678_1844861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479879.1|1844923_1848664_+|tail	phage tail tape measure protein	tail	A0A0S2SXL7	Bacillus_phage	60.4	9.1e-105
WP_014479880.1|1848676_1849510_+|tail	phage tail family protein	tail	M4ZS20	Bacillus_phage	34.1	3.5e-33
WP_033881098.1|1849523_1851398_+|tail	phage tail protein	tail	D6R400	Bacillus_phage	27.8	5.5e-50
WP_031600552.1|1853022_1854144_+|plate	BppU family phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	92.5	9.8e-196
WP_031600553.1|1854159_1854459_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	2.0e-39
WP_031600554.1|1854455_1854626_+	XkdX family protein	NA	NA	NA	NA	NA
WP_031600555.1|1854677_1854890_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	59.4	1.9e-15
WP_031600556.1|1854904_1855168_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	66.7	2.7e-24
WP_031600557.1|1855223_1856201_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	71.4	2.0e-64
WP_031600558.1|1856246_1856711_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_033881288.1|1856729_1858493_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	52.3	3.3e-121
WP_080283100.1|1858662_1858734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479884.1|1858749_1859835_-	DUF4917 family protein	NA	NA	NA	NA	NA
WP_033881290.1|1860668_1860959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479885.1|1861197_1861689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479887.1|1863019_1863271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072592598.1|1863454_1863889_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014479891.1|1864931_1865690_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
1864828:1864993	attR	TGGGGAAATTGAAAAGAGATCCGAACTCCGTAGAATTAGCTAACAAGATTATCGAACAGTTGTAGACGTCAAGTCAAAATTTACATTTTTTGCTTATTTGCTTTTTACACTTCTGCTGAAAATACACTTTTTCGATGTTTCATTCGATAGCTATCTCCATCCATAT	NA	NA	NA	NA
WP_014480339.1|1865686_1867234_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_014479132.1|1867396_1868551_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.4e-24
WP_033881852.1|1868547_1869447_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_029726895.1|1869524_1869905_+	UPF0715 family protein	NA	NA	NA	NA	NA
WP_014479898.1|1870446_1870677_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	75.0	2.1e-20
WP_014479901.1|1872188_1872353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479902.1|1872492_1872963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479903.1|1873759_1875151_+	MFS transporter	NA	NA	NA	NA	NA
WP_014479904.1|1875223_1875541_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033880480.1|1875537_1876452_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
WP_014479906.1|1876590_1878192_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_014479907.1|1878329_1879484_-	ROK family protein	NA	NA	NA	NA	NA
WP_014479908.1|1879721_1881059_+	xylose isomerase	NA	NA	NA	NA	NA
WP_014479909.1|1881209_1882709_+	xylulokinase	NA	NA	NA	NA	NA
WP_031600262.1|1883193_1884441_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_014479910.1|1884570_1885206_-	endonuclease YncB	NA	A0A1P8CWK6	Bacillus_phage	68.5	7.7e-73
WP_033881939.1|1885618_1887034_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_031600564.1|1887135_1888320_-	alanine racemase	NA	NA	NA	NA	NA
WP_014479913.1|1888730_1889156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479915.1|1890074_1890509_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	92.3	5.8e-72
WP_033881937.1|1891109_1891373_-|coat	spore coat protein CotU	coat	NA	NA	NA	NA
WP_003231643.1|1891779_1891944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479918.1|1892218_1893058_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	98.2	5.6e-164
WP_121509411.1|1893180_1893468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479919.1|1893510_1894230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479920.1|1894389_1894746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479921.1|1894991_1895192_-|coat	spore coat protein CotC	coat	NA	NA	NA	NA
WP_003231634.1|1895366_1895555_-	twin-arginine translocase TatAC	NA	NA	NA	NA	NA
WP_009967329.1|1895808_1896207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014478984.1|1896368_1897721_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
>prophage 5
NC_017196	Bacillus subtilis subsp. natto BEST195, complete genome	4105380	1990777	2001467	4105380	transposase,holin	Bacillus_phage(75.0%)	10	NA	NA
WP_031600262.1|1990777_1992025_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_033881859.1|1994231_1994591_-	hypothetical protein	NA	A0A1P8CWJ9	Bacillus_phage	98.3	2.2e-61
WP_072592542.1|1994850_1994934_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_014479996.1|1995222_1995756_-	GNAT family N-acetyltransferase	NA	O64026	Bacillus_phage	97.2	2.9e-97
WP_014479997.1|1995815_1996370_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	91.3	4.3e-96
WP_014479998.1|1996425_1996884_-	SMI1/KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	85.5	2.8e-72
WP_003231326.1|1996976_1997435_-	type II toxin-antitoxin system antitoxin YobK	NA	NA	NA	NA	NA
WP_014479999.1|1997444_1999247_-	type II toxin-antitoxin system toxin ribonuclease YobL	NA	A0A1P8CWI7	Bacillus_phage	87.0	1.3e-218
WP_029318053.1|1999345_1999903_-	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	95.7	7.0e-102
WP_121509415.1|2000030_2001467_+	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	30.6	2.6e-07
>prophage 6
NC_017196	Bacillus subtilis subsp. natto BEST195, complete genome	4105380	2213908	2220003	4105380		Staphylococcus_phage(66.67%)	8	NA	NA
WP_014480158.1|2213908_2214502_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.6e-14
WP_014477220.1|2214491_2215247_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.2	5.5e-09
WP_014480159.1|2215526_2216051_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003223910.1|2216064_2216439_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003223915.1|2216551_2217016_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
WP_014480160.1|2217048_2218245_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	4.1e-115
WP_014480161.1|2218259_2218907_-	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	8.5e-43
WP_014480162.1|2218917_2220003_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	6.6e-56
>prophage 7
NC_017196	Bacillus subtilis subsp. natto BEST195, complete genome	4105380	2591430	2644899	4105380	coat,protease,tRNA	uncultured_Mediterranean_phage(12.5%)	56	NA	NA
WP_003229725.1|2591430_2592576_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.0	3.4e-87
WP_003229723.1|2592602_2593631_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003222669.1|2593660_2593861_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003229718.1|2593853_2594858_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	1.1e-07
WP_003229717.1|2594868_2595474_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_014480438.1|2595612_2596125_-	sporulation cell-cell signaling protein BofC	NA	NA	NA	NA	NA
WP_014480439.1|2596172_2597480_-	MFS transporter	NA	NA	NA	NA	NA
WP_014480440.1|2597550_2598576_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_014480441.1|2598813_2599461_+	hypothetical protein	NA	A0A2R3ZQF2	Marseillevirus	26.3	9.2e-05
WP_003229707.1|2599506_2599629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031600754.1|2599734_2600160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004398683.1|2600166_2600307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480443.1|2600470_2601925_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_033881612.1|2601965_2602688_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014480445.1|2602790_2603387_-	spore germination protein SgpA	NA	NA	NA	NA	NA
WP_014480446.1|2603534_2604698_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
WP_014480447.1|2604814_2605921_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_014480448.1|2605907_2606777_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_014480449.1|2606730_2608326_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_033881608.1|2608428_2609616_+	cysteine desulfurase NifS	NA	A0A141ZJV0	Faustovirus	27.4	1.7e-33
WP_004398582.1|2609575_2610118_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_004398512.1|2610142_2611000_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003222630.1|2611016_2611460_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_003246161.1|2611520_2612807_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_014480451.1|2612840_2613419_-	sporulation initiation phosphotransferase Sop0B	NA	NA	NA	NA	NA
WP_003229671.1|2613496_2613619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003222623.1|2613739_2614024_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003229669.1|2614036_2614375_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003229668.1|2614377_2614686_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_014480452.1|2614832_2615699_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_014480453.1|2615691_2616486_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_014480454.1|2616635_2617442_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_004398901.1|2617443_2618124_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_004398811.1|2618176_2618695_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003222609.1|2618691_2619564_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003229650.1|2619594_2620608_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_014480455.1|2620699_2621395_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_014480456.1|2621431_2622001_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_014480457.1|2622153_2623152_-	stage II sporulation protein SpoIIB	NA	NA	NA	NA	NA
WP_072592551.1|2623285_2624032_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_014480460.1|2624171_2625464_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_014480461.1|2625523_2628166_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	3.7e-161
WP_003222590.1|2628613_2628805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480462.1|2628823_2629849_-|coat	spore coat protein CotN	coat	NA	NA	NA	NA
WP_014480463.1|2629881_2631603_-|coat	spore coat morphogenetic protein SpoVID	coat	NA	NA	NA	NA
WP_014480464.1|2631733_2633026_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_014480465.1|2633055_2634030_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_014480466.1|2634026_2634815_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_014480467.1|2634804_2635749_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003222575.1|2635781_2636612_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_004399038.1|2636619_2637987_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_014477563.1|2638216_2638714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229621.1|2638735_2639323_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_014480468.1|2639319_2641644_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	2.6e-182
WP_004398923.1|2641824_2643483_-|protease	ATP-dependent protease LonB	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
WP_003229613.1|2643636_2644899_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
>prophage 8
NC_017196	Bacillus subtilis subsp. natto BEST195, complete genome	4105380	3242897	3298719	4105380	head,plate,protease,capsid,tail,portal,terminase,holin	Bacillus_phage(67.44%)	72	NA	NA
WP_014480874.1|3242897_3244481_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	59.7	4.2e-75
WP_014480875.1|3244495_3244885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105778748.1|3245227_3245830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480877.1|3245869_3246811_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	77.1	3.0e-97
WP_014480878.1|3246852_3247275_-|holin	holin family protein	holin	D6R405	Bacillus_phage	85.7	3.0e-57
WP_014480879.1|3247328_3247499_-	XkdX family protein	NA	NA	NA	NA	NA
WP_031600923.1|3247495_3247795_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	1.5e-39
WP_031600924.1|3247810_3249034_-|plate	BppU family phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	79.9	6.5e-177
WP_072592555.1|3249070_3250645_-	hypothetical protein	NA	M4ZSB3	Bacillus_phage	88.7	1.1e-264
WP_031600926.1|3250681_3252388_-|tail	phage tail protein	tail	D6R400	Bacillus_phage	81.8	9.4e-267
WP_031600927.1|3252399_3253239_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	83.2	8.5e-136
WP_033882059.1|3253238_3257117_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	81.0	0.0e+00
WP_017696308.1|3257129_3257309_-	hypothetical protein	NA	D6R3Z7	Bacillus_phage	68.5	1.6e-12
WP_003220222.1|3257311_3257650_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	70.5	3.0e-39
WP_017696306.1|3257704_3258316_-|tail	major tail protein	tail	Q9ZXE9	Bacillus_phage	89.7	7.9e-99
WP_031600930.1|3258316_3258697_-	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	66.1	2.6e-39
WP_033882058.1|3258693_3259077_-	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	86.6	2.9e-59
WP_033882056.1|3259069_3259441_-|head	phage head closure protein	head	Q9ZXF2	Bacillus_phage	68.3	3.5e-41
WP_031600933.1|3259373_3259721_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	87.0	2.0e-51
WP_031600934.1|3259736_3260228_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	69.1	1.3e-27
WP_031600935.1|3260256_3260571_-	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	68.8	6.8e-30
WP_033882054.1|3260586_3261789_-|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	71.5	3.3e-157
WP_003220242.1|3261825_3262452_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	92.8	1.8e-106
WP_033882052.1|3262441_3263689_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	86.5	1.3e-217
WP_033882051.1|3263694_3263910_-	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	80.6	1.3e-24
WP_031600939.1|3263922_3265632_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	92.3	0.0e+00
WP_017697674.1|3265631_3266165_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	82.5	1.0e-70
WP_046160532.1|3266544_3266919_-	HNH endonuclease	NA	Q38456	Bacillus_phage	82.3	7.5e-60
WP_033881251.1|3266968_3267715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031600943.1|3268105_3268879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123772464.1|3269029_3269395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031600945.1|3270603_3271056_-	hypothetical protein	NA	S6AVV9	Thermus_phage	56.6	3.4e-38
WP_014480881.1|3271309_3271510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480882.1|3271506_3271926_-	hypothetical protein	NA	A0A2I6UHP7	Bacillus_phage	61.2	1.6e-42
WP_014480883.1|3271922_3272255_-	hypothetical protein	NA	F8WQ59	Bacillus_phage	53.3	8.3e-18
WP_014480884.1|3272254_3272911_-	dUTP diphosphatase	NA	R9TQ23	Paenibacillus_phage	46.0	9.9e-39
WP_014480885.1|3273028_3273286_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	41.7	6.6e-07
WP_014480886.1|3273282_3273690_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	45.8	1.3e-25
WP_014480887.1|3273686_3274004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480888.1|3274000_3274363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003220282.1|3274405_3274603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480890.1|3274681_3274837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003237439.1|3274849_3274990_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_014480892.1|3275097_3275646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003220291.1|3275642_3275801_-	hypothetical protein	NA	A8ATM6	Listeria_phage	57.8	2.2e-05
WP_014480893.1|3275797_3275947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480894.1|3275960_3276788_-	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	35.9	3.7e-35
WP_014480895.1|3276771_3277653_-	phage replisome organizer N-terminal domain-containing protein	NA	V9QKF6	Oenococcus_phage	33.1	6.8e-27
WP_033881245.1|3277645_3277864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881244.1|3277888_3278080_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	59.0	1.0e-12
WP_014480896.1|3278131_3278335_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014480897.1|3278569_3278968_+	helix-turn-helix transcriptional regulator	NA	S5M5X8	Brevibacillus_phage	33.7	4.3e-05
WP_014480900.1|3279400_3280501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003220025.1|3282425_3282896_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.4	3.2e-47
WP_003228386.1|3283040_3285380_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	42.9	2.4e-87
WP_003242610.1|3285398_3286139_-	carboxylesterase	NA	NA	NA	NA	NA
WP_003220028.1|3286270_3286501_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_014480904.1|3286649_3287423_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003220031.1|3287456_3287690_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003220034.1|3287841_3288249_+	transcriptional repressor RghR	NA	S6C481	Thermus_phage	64.8	1.9e-16
WP_014480905.1|3288278_3288698_+	helix-turn-helix domain-containing protein	NA	S6C481	Thermus_phage	62.7	5.4e-14
WP_003242888.1|3288789_3289116_+	catDE operon transcriptional regulator CatR	NA	NA	NA	NA	NA
WP_014480906.1|3289243_3290944_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	8.0e-24
WP_014480907.1|3290984_3291665_-|holin	choline ABC transporter permease OpuBD	holin	NA	NA	NA	NA
WP_014480908.1|3291681_3292602_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003228370.1|3292613_3293267_-|holin	choline ABC transporter permease OpuBB	holin	NA	NA	NA	NA
WP_014480909.1|3293283_3294429_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y2R6	Organic_Lake_phycodnavirus	32.7	6.0e-15
WP_014480910.1|3294712_3295246_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014478003.1|3295277_3295952_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD	holin	NA	NA	NA	NA
WP_031600963.1|3295969_3296881_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003228349.1|3296900_3297554_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB	holin	NA	NA	NA	NA
WP_014480912.1|3297576_3298719_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y1V5	Organic_Lake_phycodnavirus	29.6	2.8e-12
>prophage 9
NC_017196	Bacillus subtilis subsp. natto BEST195, complete genome	4105380	3373051	3396723	4105380	plate,tail,terminase,portal,integrase	Bacillus_phage(30.43%)	30	3380140:3380155	3398482:3398497
WP_033881229.1|3373051_3373285_-	helix-turn-helix domain-containing protein	NA	B3RH35	Bacillus_virus	62.0	4.3e-21
WP_014480971.1|3373563_3373842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480972.1|3373854_3375039_+	DNA translocase FtsK	NA	Q0H250	Geobacillus_phage	53.4	1.3e-108
WP_014480973.1|3375025_3375658_+	replication-relaxation family protein	NA	Q0H249	Geobacillus_phage	57.1	7.2e-63
WP_014480974.1|3375699_3376002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480975.1|3376123_3376381_-	hypothetical protein	NA	A0A0U4JE55	Bacillus_phage	57.6	5.6e-22
WP_033881228.1|3376400_3377348_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	62.7	2.5e-91
WP_033881227.1|3377420_3377624_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	46.5	1.9e-09
WP_014480977.1|3377648_3377819_-	XkdX family protein	NA	M4ZS22	Bacillus_phage	68.1	1.1e-10
WP_014480978.1|3377819_3378113_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	80.2	1.6e-41
WP_031600995.1|3378128_3379352_-|plate	BppU family phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	74.9	4.1e-163
WP_031600996.1|3379388_3380966_-	hypothetical protein	NA	M4ZSB3	Bacillus_phage	86.8	3.3e-258
3380140:3380155	attL	GCTTGATTTACGGTTA	NA	NA	NA	NA
WP_031600997.1|3380978_3382373_-|tail	phage tail protein	tail	A6M966	Geobacillus_virus	30.3	3.0e-37
WP_033880944.1|3382387_3383806_-|tail	phage tail family protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	42.4	1.3e-56
WP_080283095.1|3383809_3386632_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	36.4	6.7e-68
WP_033880947.1|3386636_3386858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033880428.1|3386953_3387310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033880949.1|3387396_3387966_-	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	63.0	1.0e-52
WP_033880952.1|3388006_3388381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033880954.1|3388385_3388793_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	55.5	2.1e-31
WP_033880956.1|3388789_3389128_-	hypothetical protein	NA	A0A0N9RTI3	Paenibacillus_phage	47.3	8.1e-21
WP_031601003.1|3389128_3389521_-	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	39.5	7.5e-18
WP_033880957.1|3389538_3389730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031601004.1|3389786_3390695_-	hypothetical protein	NA	A0A0N9S7T7	Paenibacillus_phage	52.5	1.4e-80
WP_031601005.1|3390726_3391287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017695234.1|3391392_3392205_-	type IV secretion protein Rhs	NA	A0A0N9SJR1	Paenibacillus_phage	52.7	8.1e-75
WP_031601006.1|3392204_3393875_-|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	55.3	1.5e-155
WP_031601007.1|3393879_3394314_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	49.3	1.5e-27
WP_033880959.1|3394330_3396091_-|terminase	phage terminase large subunit	terminase	A0A142F1L6	Bacillus_phage	44.8	8.3e-133
WP_033880961.1|3396174_3396723_+|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	51.6	7.0e-38
3398482:3398497	attR	GCTTGATTTACGGTTA	NA	NA	NA	NA
>prophage 10
NC_017196	Bacillus subtilis subsp. natto BEST195, complete genome	4105380	3705349	3780688	4105380	bacteriocin,protease,coat,tRNA	Bacillus_phage(26.67%)	74	NA	NA
WP_003227570.1|3705349_3707020_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014481216.1|3707016_3707445_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003222002.1|3707757_3707889_+|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_010886632.1|3707845_3707998_+|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
WP_014481217.1|3708022_3709369_+	subtilosin maturase AlbA	NA	NA	NA	NA	NA
WP_003222006.1|3709381_3709543_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
WP_014481218.1|3709539_3710259_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	1.6e-18
WP_033881822.1|3710251_3711562_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
WP_072592616.1|3711551_3712712_+	insulinase family protein	NA	NA	NA	NA	NA
WP_014481221.1|3712716_3713997_+	insulinase family protein	NA	NA	NA	NA	NA
WP_014481222.1|3713993_3714695_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
WP_014481223.1|3714700_3716077_-	YncE family protein	NA	NA	NA	NA	NA
WP_014481224.1|3716115_3717471_-	YncE family protein	NA	NA	NA	NA	NA
WP_014481226.1|3717700_3718846_+	response regulator aspartate phosphatase RapF	NA	A0A1P8CWN8	Bacillus_phage	43.5	1.7e-78
WP_009968329.1|3718829_3718949_+	phosphatase RapF inhibitor PhrF	NA	NA	NA	NA	NA
WP_105778741.1|3719046_3719604_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_003227545.1|3719538_3720411_-	agmatinase	NA	NA	NA	NA	NA
WP_003227543.1|3720471_3721302_-	spermidine synthase	NA	NA	NA	NA	NA
WP_014481227.1|3721503_3723579_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_014478299.1|3723606_3724041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003244446.1|3724179_3724698_-	YwhD family protein	NA	NA	NA	NA	NA
WP_003243167.1|3724711_3725371_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003222038.1|3725479_3725668_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_003227535.1|3725710_3726130_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014481228.1|3726249_3728166_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	43.4	1.9e-143
WP_003243441.1|3729010_3730411_-	MFS transporter	NA	NA	NA	NA	NA
WP_003243988.1|3730410_3730881_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003227524.1|3730992_3731493_-	YwgA family protein	NA	NA	NA	NA	NA
WP_003243873.1|3731528_3732830_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	4.2e-25
WP_003222050.1|3732991_3733216_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_003227516.1|3733430_3734207_+	prespore-specific transcription regulator RsfA	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
WP_033881831.1|3734350_3735241_-	DMT family transporter	NA	NA	NA	NA	NA
WP_014481232.1|3735409_3736255_-	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
WP_014481233.1|3736303_3737203_-	cysJI operon transcriptional regulator CysL	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
WP_003235941.1|3737348_3738320_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003227507.1|3738589_3739354_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_014481234.1|3739486_3740266_+	NADPH-dependent reductase BacG	NA	NA	NA	NA	NA
WP_031601099.1|3740281_3741496_-	transaminase BacF	NA	NA	NA	NA	NA
WP_014481236.1|3741496_3742681_-	bacilysin exporter BacE	NA	NA	NA	NA	NA
WP_003242921.1|3742677_3744096_-	alanine--anticapsin ligase	NA	NA	NA	NA	NA
WP_003243359.1|3744114_3744876_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	2.8e-21
WP_003244300.1|3744878_3745586_-	3-((4R)-4-hydroxycyclohexa-1, 5-dien-1-yl)-2-oxopropanoate isomerase	NA	NA	NA	NA	NA
WP_009968341.1|3745575_3746190_-	prephenate decarboxylase	NA	NA	NA	NA	NA
WP_014481237.1|3746341_3747580_-	MFS transporter	NA	NA	NA	NA	NA
WP_015250969.1|3747789_3749202_-	amino acid permease	NA	NA	NA	NA	NA
WP_014481239.1|3749201_3750902_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_014478322.1|3750975_3752523_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003227482.1|3752749_3754024_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_014481241.1|3754201_3754666_-	biofilm-surface layer protein BslB	NA	NA	NA	NA	NA
WP_014481242.1|3754989_3755445_-	dTDP-4-dehydrorhamnose 3,5-epimerase family protein	NA	NA	NA	NA	NA
WP_014481243.1|3755437_3756289_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.9	1.3e-38
WP_003244201.1|3756302_3757250_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	4.4e-72
WP_014478328.1|3757249_3757990_-	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	41.9	4.5e-48
WP_014481244.1|3758014_3759034_-|coat	spore coat polysaccharide biosynthesis protein SpsG	coat	NA	NA	NA	NA
WP_014481245.1|3759036_3759759_-|coat	spore coat polysaccharide biosynthesis protein SpsF	coat	NA	NA	NA	NA
WP_031601100.1|3759751_3760873_-|coat	spore coat biosynthesis protein SpsE	coat	NA	NA	NA	NA
WP_014481248.1|3760872_3761742_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014481249.1|3761742_3762912_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A1D8KU11	Synechococcus_phage	28.1	1.2e-15
WP_014481250.1|3762932_3764357_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_014481251.1|3764361_3765132_-|coat	spore coat dTDP-glycosyltransferase SpsA	coat	A0A0F7L2F7	uncultured_marine_virus	28.6	4.4e-06
WP_014481253.1|3765451_3765997_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_003227446.1|3766040_3766412_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_014481254.1|3766473_3767796_-	purine/pyrimidine permease	NA	NA	NA	NA	NA
WP_014481255.1|3767815_3768133_-	YwdI family protein	NA	NA	NA	NA	NA
WP_014481256.1|3768300_3769671_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003242965.1|3769695_3770373_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	46.1	8.3e-49
WP_014481257.1|3770386_3771193_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_014481258.1|3771384_3772200_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003243437.1|3772290_3772539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481259.1|3772632_3774072_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.8	3.7e-22
WP_014481260.1|3774068_3775454_-	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_014481261.1|3775755_3776526_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_015250947.1|3777435_3777738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481265.1|3778267_3780688_+|protease	serine protease Vpr	protease	A0A217EQY2	Bacillus_phage	38.2	5.3e-21
>prophage 11
NC_017196	Bacillus subtilis subsp. natto BEST195, complete genome	4105380	3947632	4045375	4105380	coat,protease,holin,transposase	Bacillus_phage(23.81%)	89	NA	NA
WP_003227093.1|3947632_3947998_+|coat	inner spore coat protein CotNE	coat	NA	NA	NA	NA
WP_003242469.1|3948245_3948599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014481403.1|3948642_3949041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481404.1|3949218_3950184_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003227084.1|3950224_3950572_-	YxeA family protein	NA	NA	NA	NA	NA
WP_014481410.1|3953321_3954299_-	two-component system sensor histidine kinase YxdJ	NA	NA	NA	NA	NA
WP_003243527.1|3954295_3954985_-	two-component system response regulator YxdJ	NA	NA	NA	NA	NA
WP_014481411.1|3955092_3955965_-	6-phospho-5-dehydro-2-deoxy-D-gluconate aldolase	NA	NA	NA	NA	NA
WP_014481412.1|3955985_3956822_-	2-keto-myo-inositol isomerase	NA	NA	NA	NA	NA
WP_014481413.1|3956907_3957777_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_014481414.1|3957796_3958831_-	bifunctional inositol 2-dehydrogenase/D-chiro-inositol 1-dehydrogenase	NA	NA	NA	NA	NA
WP_014481415.1|3958853_3960170_-	myo-inositol transporter IolF	NA	NA	NA	NA	NA
WP_014481416.1|3960184_3961078_-	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_014481417.1|3961094_3963008_-	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_014478485.1|3963040_3964018_-	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_014481418.1|3964041_3964857_-	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_014481419.1|3964931_3966395_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_031601042.1|3966808_3967933_-|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
WP_003227050.1|3968226_3968982_+	myo-inositol utilization transcriptional regulator IolR	NA	NA	NA	NA	NA
WP_014481420.1|3969035_3969968_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_014481421.1|3970197_3970512_+	hypothetical protein	NA	L7TIP7	Escherichia_phage	47.0	1.6e-10
WP_014481422.1|3970615_3971086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481425.1|3971842_3972355_+	HPP family protein	NA	NA	NA	NA	NA
WP_014481428.1|3973900_3975781_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	33.4	1.1e-93
WP_014481429.1|3975948_3976200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881094.1|3977391_3977592_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014481433.1|3978214_3978433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481434.1|3978477_3978699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014478926.1|3979020_3980145_+|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
WP_014481435.1|3980422_3980677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014481436.1|3980840_3983024_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	30.8	1.7e-50
WP_014481437.1|3983024_3984494_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014481439.1|3984902_3985937_-	quercetin 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_014481440.1|3986030_3986606_-	transcriptional regulator YxaF	NA	NA	NA	NA	NA
WP_014481441.1|3986736_3987807_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003243994.1|3987865_3988297_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009968420.1|3988523_3988928_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_003227015.1|3988897_3989590_+	LrgB family protein	NA	NA	NA	NA	NA
WP_014481442.1|3989629_3990661_-	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_014481443.1|3990753_3991902_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.3	1.4e-48
WP_003243132.1|3992097_3992829_+	gluconate operon transcriptional repressor GntR	NA	NA	NA	NA	NA
WP_014481444.1|3992821_3994363_+	gluconokinase	NA	NA	NA	NA	NA
WP_003243139.1|3994391_3995738_+	gluconate permease GntP	NA	NA	NA	NA	NA
WP_014478511.1|3995760_3997167_+	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	30.6	1.7e-32
WP_003243686.1|3997632_3998196_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_003243077.1|3998209_3999739_+	alkyl hydroperoxide reductase subunit F	NA	A0A1V0SIN1	Klosneuvirus	29.3	1.0e-33
WP_014481445.1|3999849_4001289_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_014481447.1|4001855_4002566_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014478516.1|4002656_4003379_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
WP_014481448.1|4003399_4004029_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_014481449.1|4004509_4006435_+	fructose-bisphosphatase class III	NA	NA	NA	NA	NA
WP_080283096.1|4006885_4007236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481451.1|4007716_4008157_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	34.4	3.4e-11
WP_014479891.1|4008576_4009335_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
WP_014480339.1|4009331_4010879_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_033881507.1|4011008_4011395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031601173.1|4011806_4013270_+	Abi family protein	NA	A0A0S2MYH0	Enterococcus_phage	36.0	1.0e-11
WP_121591334.1|4013504_4015391_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	21.8	6.6e-19
WP_031601176.1|4015368_4017402_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_014479904.1|4018459_4018777_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033881055.1|4018773_4019688_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	4.0e-06
WP_080283097.1|4019768_4020215_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	97.5	3.2e-57
WP_017696296.1|4020199_4020478_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	100.0	7.3e-44
WP_033881129.1|4021176_4021440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881055.1|4021823_4022738_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	4.0e-06
WP_014479904.1|4022734_4023052_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014481454.1|4023316_4026430_-	DEAD/DEAH box helicase	NA	A7WKM3	Acidianus_filamentous_virus	26.4	6.6e-08
WP_014481455.1|4026395_4027304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003226975.1|4027591_4028071_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_014481456.1|4028151_4028322_-	CxxH/CxxC protein	NA	NA	NA	NA	NA
WP_014481457.1|4028506_4028920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014481458.1|4028953_4030180_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	29.3	1.1e-11
WP_014481459.1|4030242_4030413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481460.1|4030517_4030766_-	DUF2651 family protein	NA	NA	NA	NA	NA
WP_014481461.1|4030781_4031939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481462.1|4031949_4032687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481463.1|4032828_4033299_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014481464.1|4033409_4034507_+	response regulator aspartate phosphatase RapG	NA	D6R410	Bacillus_phage	39.3	6.0e-73
WP_003226961.1|4034507_4034624_+	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_003226959.1|4034860_4035751_-	arginase	NA	A0A1V0SJM8	Klosneuvirus	29.1	2.0e-26
WP_014481465.1|4035823_4037227_-	amino acid permease	NA	NA	NA	NA	NA
WP_033882007.1|4037449_4038655_-	ornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.5	2.0e-29
WP_015715048.1|4038986_4039589_-	sporulation delaying protein family toxin	NA	NA	NA	NA	NA
WP_014481469.1|4039650_4040604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015715050.1|4040588_4041143_-	SdpA family antimicrobial peptide system protein	NA	NA	NA	NA	NA
WP_014481470.1|4041326_4041962_-	SdpI family protein	NA	NA	NA	NA	NA
WP_015715052.1|4041961_4042246_-	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	41.3	2.8e-06
WP_003244510.1|4042472_4043858_+	arginine utilization regulatory protein RocR	NA	NA	NA	NA	NA
WP_014481472.1|4044172_4045375_-|protease	serine protease HtrC	protease	W5SAB9	Pithovirus	40.4	5.9e-13
