The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_016810	Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344, complete genome	4878012	975147	983879	4878012	protease,transposase	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|975147_976266_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|976262_978209_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|978338_978560_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|978883_979204_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|979234_981511_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|981702_982161_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_085983316.1|982623_983879_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 2
NC_016810	Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344, complete genome	4878012	1033972	1132550	4878012	lysis,tRNA,protease,terminase,tail,portal,holin	Salmonella_phage(44.64%)	101	NA	NA
WP_001154025.1|1033972_1034776_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1034768_1036091_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1036071_1036776_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1036775_1041242_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925872.1|1041586_1043428_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1043687_1044236_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1044263_1044911_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1044972_1046163_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1046347_1047439_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1048045_1049446_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1049646_1050108_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1050424_1051639_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1051883_1053320_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1053397_1054600_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1054794_1056087_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1056131_1056380_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1056420_1056660_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1056702_1057860_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000017133.1|1057822_1060708_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001668146.1|1060834_1061134_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1061155_1061314_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_014344008.1|1061306_1061567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1061616_1062027_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1062146_1062386_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1062351_1062726_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1062810_1063794_+	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1063796_1064546_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1064556_1064904_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1064900_1065212_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|1065289_1065580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1065871_1066105_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1066216_1066438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1066520_1067123_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001096552.1|1067331_1067943_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1067939_1068086_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1068075_1068873_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|1068939_1069257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1069430_1069556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1069691_1070141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1070501_1071188_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|1071463_1071793_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1071776_1072229_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1072246_1072726_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1072933_1073467_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1073423_1075562_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1075558_1075765_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009208.1|1075761_1077309_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_010989008.1|1077232_1079314_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1079404_1079728_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1079720_1080020_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1080000_1080567_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1080563_1080965_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132758.1|1080976_1081726_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.2	1.8e-89
WP_000478859.1|1081771_1082170_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1082166_1082496_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|1082575_1085563_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|1085559_1085892_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1085990_1086488_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1086604_1087138_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1087227_1087923_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1087932_1088670_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1088567_1089272_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_001541993.1|1091818_1092694_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_000178849.1|1092732_1092975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144682.1|1093028_1095236_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	E5G6P0	Salmonella_phage	51.5	6.2e-77
WP_000143167.1|1095235_1095817_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001533476.1|1096292_1097261_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000334547.1|1097908_1098535_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1098603_1098903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1098887_1099574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1099844_1100036_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1100462_1103075_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1103282_1104293_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1104458_1105001_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1104997_1106107_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1106205_1108314_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1108326_1110234_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333148.1|1110248_1111502_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1111506_1113147_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1113143_1113707_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1113962_1114130_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1114229_1114748_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156453.1|1114816_1116577_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1116762_1117215_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1117286_1118339_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1118695_1119205_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1119421_1120027_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1120013_1122167_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1122185_1122632_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1122755_1124810_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1124845_1125304_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1125398_1126061_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1126234_1126648_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1126692_1127010_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1127067_1128279_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1128493_1129042_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1129067_1129847_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072884.1|1129895_1130177_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1130173_1130503_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1130589_1131249_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1131869_1132550_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 3
NC_016810	Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344, complete genome	4878012	1921043	1927852	4878012	tail,integrase	Salmonella_phage(33.33%)	11	1915906:1915928	1925621:1925643
1915906:1915928	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|1921043_1921925_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1922397_1922586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1922650_1922818_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1923074_1923608_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1923661_1923892_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1924081_1924576_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1924635_1925490_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|1925863_1926217_-	YebY family protein	NA	NA	NA	NA	NA
1925621:1925643	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1926233_1927109_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1927109_1927484_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1927621_1927852_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 4
NC_016810	Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344, complete genome	4878012	2003302	2082646	4878012	head,lysis,protease,terminase,capsid,holin,tail,integrase,transposase,portal,plate	Salmonella_phage(86.36%)	102	2009840:2009855	2084269:2084284
WP_000502119.1|2003302_2003761_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|2003941_2005147_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079805.1|2005225_2006713_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000146802.1|2006969_2008373_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2008387_2008795_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2008794_2009163_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|2009234_2010719_+	alpha-amylase	NA	NA	NA	NA	NA
2009840:2009855	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2010758_2011184_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2011369_2012575_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2012571_2012805_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2013069_2013456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2013575_2013890_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2014106_2015789_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2015781_2016777_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2016769_2017477_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2017476_2018847_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2018868_2019312_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2019308_2020526_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2020630_2021098_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2021102_2022107_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2022103_2022517_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2022516_2022894_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2022893_2023631_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2023640_2023910_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2023918_2024713_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103975.1|2024994_2025618_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000867218.1|2025656_2025851_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2025979_2026207_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2026516_2027332_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2027310_2029023_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_000232161.1|2029187_2029373_-	YodC family protein	NA	NA	NA	NA	NA
WP_085983315.1|2029449_2030367_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2030536_2031457_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2031445_2031916_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2031896_2033327_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2033400_2034096_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2034187_2034487_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2035136_2036333_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2036593_2036782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2036792_2037005_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2037459_2038728_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2038730_2039150_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2039276_2039438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526483.1|2040068_2040290_-	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000492926.1|2040502_2041510_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_015701331.1|2041794_2042394_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_000554736.1|2042363_2043926_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	99.8	7.5e-287
WP_001207832.1|2043912_2044500_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_001738350.1|2044502_2045024_-|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	99.4	1.5e-93
WP_014343856.1|2045058_2045604_-|plate	baseplate J/gp47 family protein	plate	Q8HAB7	Salmonella_phage	100.0	9.2e-99
WP_000605050.1|2045575_2045989_-	phage GP46 family protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001273649.1|2045993_2046527_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066636.1|2046526_2047585_-	hypothetical protein	NA	Q8HAC0	Salmonella_phage	100.0	1.3e-202
WP_000863818.1|2047581_2048922_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_000785385.1|2048955_2050884_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000588852.1|2050968_2051295_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2051291_2051648_-|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007991.1|2051647_2053144_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000497739.1|2053133_2053298_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779218.1|2053301_2053862_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_001135697.1|2053858_2054371_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000702408.1|2054342_2054747_-|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_000927378.1|2054743_2055067_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601353.1|2055069_2055270_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000257528.1|2055320_2056526_-|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_001193639.1|2056540_2057191_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000466254.1|2057168_2058410_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_000605609.1|2058409_2058592_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088182.1|2058603_2060337_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
WP_000929191.1|2060333_2060828_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135225.1|2060953_2061304_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_001292890.1|2061364_2061667_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_000877027.1|2061886_2062306_-	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001050825.1|2062518_2063004_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_001005901.1|2063000_2063615_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001527046.1|2063617_2063962_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_014343859.1|2064123_2064558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001527054.1|2064487_2064745_-	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_000188927.1|2064877_2065501_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_001202277.1|2065511_2066501_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	4.9e-191
WP_001061457.1|2066508_2067369_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
WP_001241579.1|2067385_2067775_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2067771_2068665_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2068664_2069147_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|2069148_2069967_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|2069963_2070188_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2070184_2071342_-	Rha family phage regulatory protein	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2071338_2071893_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2071921_2072146_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|2072243_2072939_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_000997190.1|2073753_2074125_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000080415.1|2074182_2075010_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
WP_000008351.1|2075146_2075686_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000764235.1|2075756_2075987_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000071070.1|2075983_2076499_+	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000065095.1|2076495_2077113_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000208068.1|2077109_2077943_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_001061334.1|2077946_2078516_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_001527041.1|2078555_2078783_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_000532847.1|2078784_2079774_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2080065_2080863_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001219015.1|2082172_2082646_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2084269:2084284	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 5
NC_016810	Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344, complete genome	4878012	2168640	2179146	4878012		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2168640_2169954_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2169980_2171060_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2171064_2171838_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2171834_2172827_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2172832_2173384_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2173384_2174263_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2174310_2175210_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2175209_2176295_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2176671_2177565_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2177742_2179146_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 6
NC_016810	Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344, complete genome	4878012	2247454	2256625	4878012	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2247454_2249488_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2249728_2250187_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2250358_2250889_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2250945_2251413_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2251459_2252179_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2252175_2253861_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2254083_2254815_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2254874_2254982_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2254962_2255694_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2255677_2256625_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 7
NC_016810	Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344, complete genome	4878012	2276032	2342427	4878012	tail,lysis,holin	Salmonella_phage(28.57%)	60	NA	NA
WP_000989296.1|2276032_2276728_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2276881_2277766_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2277942_2278662_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2278658_2278904_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2279108_2280350_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|2280343_2281579_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2281653_2282664_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535905.1|2282679_2284200_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2284333_2285332_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2285830_2286853_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2287002_2288145_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2288159_2288828_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2289157_2290015_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2290003_2290393_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2290397_2291765_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2291981_2292869_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2292901_2294224_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2294267_2296259_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535005.1|2296603_2298073_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2298262_2299126_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2299246_2300296_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2300374_2301232_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2301296_2302985_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2303001_2303940_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2303939_2305070_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2305438_2306620_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2306684_2307350_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2307351_2307474_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2307861_2308116_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2308439_2309012_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2309224_2310211_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2310240_2310960_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2311373_2311946_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2312271_2313828_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2313934_2315740_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2315749_2316844_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2316843_2317869_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2317870_2319460_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2319463_2319808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2320198_2321389_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2321416_2322112_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2322263_2324024_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2324148_2324433_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2324541_2325162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2325189_2326197_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2326376_2326604_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2326635_2328396_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2328676_2329180_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2329207_2329498_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2329845_2331675_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2331728_2332172_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2332549_2333077_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2333079_2334321_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2334913_2335243_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2335539_2336871_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2336899_2337268_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2337282_2338272_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2338600_2340967_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2341135_2341339_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2341635_2342427_-|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 8
NC_016810	Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344, complete genome	4878012	2681301	2788863	4878012	head,tRNA,lysis,terminase,capsid,protease,holin,tail,integrase,transposase,portal	Salmonella_phage(30.3%)	112	2705846:2705862	2796767:2796783
WP_000940032.1|2681301_2682033_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2682151_2682955_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2683099_2683978_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2684159_2685203_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2685206_2686025_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2686035_2687049_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2687049_2688036_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2688026_2688665_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2688790_2690068_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2690062_2691202_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2691397_2692651_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2692975_2694166_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2694347_2695892_+	lysine decarboxylation/transport transcriptional activator CadC	NA	NA	NA	NA	NA
WP_000100008.1|2696252_2697584_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2697666_2699811_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2699866_2701327_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2701375_2701714_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2701790_2703128_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2703124_2703889_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2703890_2705321_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
2705846:2705862	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970045.1|2705970_2709858_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|2709879_2710113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2710113_2711658_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2711708_2712260_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2712284_2712920_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2712923_2714285_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2714295_2715189_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2715304_2716153_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2716191_2717109_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276370.1|2717130_2718327_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2718442_2719369_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2719406_2719667_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2719778_2720159_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2720158_2720890_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2720901_2721630_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2721641_2722547_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2722543_2723224_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2723497_2724472_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2724488_2726288_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2726692_2728186_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2728658_2728796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2729508_2729673_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001738443.1|2730380_2730593_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2730699_2730927_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2731023_2731602_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2731591_2732416_-	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_014344380.1|2732412_2734785_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	65.3	1.1e-90
WP_000178853.1|2734838_2735081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2735119_2738482_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2738543_2739191_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_015701343.1|2739088_2739826_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	3.0e-129
WP_001152689.1|2739832_2740531_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2740540_2740870_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372065.1|2740872_2743968_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_010989052.1|2743939_2744278_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2744274_2744670_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2744720_2745467_-	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2745474_2745876_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2745984_2747115_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2747163_2747742_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2747769_2748153_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2748163_2748523_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522566.1|2748580_2749609_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2749663_2750011_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2750023_2751520_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|2751509_2753090_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2753086_2753290_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2753273_2755205_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2755176_2755722_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2756008_2756410_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001533543.1|2756645_2757098_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_015701345.1|2757115_2757568_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001574216.1|2757551_2757881_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|2758156_2758843_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|2759057_2759246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2759752_2760316_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|2760588_2761266_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2761262_2761403_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096546.1|2761399_2762011_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	2.7e-91
WP_000929790.1|2762219_2762822_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_014343878.1|2762856_2763105_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2763221_2763455_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000002116.1|2764016_2764298_-	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	95.7	3.2e-47
WP_000208067.1|2764290_2764944_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	52.0	6.3e-62
WP_000852188.1|2764946_2765417_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.1e-68
WP_000065092.1|2765418_2766084_-	ead/Ea22-like family protein	NA	A0A1V0E5L5	Salmonella_phage	44.9	2.8e-25
WP_000788827.1|2766098_2766791_-	Replication protein 14	NA	G8C7U6	Escherichia_phage	60.2	1.8e-78
WP_000024048.1|2766787_2767693_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	96.3	4.4e-170
WP_072143007.1|2767784_2768159_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	97.6	2.8e-62
WP_000145711.1|2768124_2768352_-	helix-turn-helix domain-containing protein	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
WP_000169863.1|2768365_2768833_+	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	86.9	3.2e-68
WP_000368620.1|2768984_2770070_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	38.0	1.5e-60
WP_000373340.1|2770177_2770384_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	7.4e-17
WP_000551857.1|2770783_2770954_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	49.0	9.7e-07
WP_000394219.1|2771094_2774295_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	74.1	0.0e+00
WP_014344386.1|2774257_2775415_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|2775457_2775697_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2775737_2776022_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|2775999_2777229_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|2777726_2778206_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2778202_2779159_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|2779158_2779809_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2779840_2780416_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2780412_2780577_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989177.1|2780840_2782463_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2782447_2783185_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2783315_2784650_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|2784667_2785567_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2785669_2786257_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2786318_2786702_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2787020_2787710_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2787825_2788863_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
2796767:2796783	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 9
NC_016810	Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344, complete genome	4878012	2811887	2891269	4878012	head,tRNA,lysis,terminase,capsid,tail,integrase,portal,plate	Salmonella_phage(69.49%)	83	2878932:2878953	2894256:2894277
WP_001168062.1|2811887_2812958_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|2813397_2813916_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|2813908_2815129_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000218691.1|2815381_2816431_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	90.3	5.4e-188
WP_000823622.1|2816455_2816794_-	DUF2511 domain-containing protein	NA	A0A0M3ULF8	Salmonella_phage	72.1	1.4e-41
WP_001096998.1|2816802_2817648_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	73.7	4.9e-115
WP_001278192.1|2817761_2818115_+	hypothetical protein	NA	Q6K1F9	Salmonella_virus	100.0	2.3e-58
WP_000883911.1|2818165_2818675_+	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	98.8	3.6e-89
WP_000920166.1|2818682_2818883_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	92.4	9.6e-30
WP_000963466.1|2818846_2819185_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	92.9	2.3e-52
WP_001246236.1|2819252_2819480_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	98.7	2.6e-31
WP_000752587.1|2819479_2819704_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	98.6	1.1e-34
WP_157868817.1|2819725_2820319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000978866.1|2823087_2823573_+|tail	phage tail protein	tail	O80317	Escherichia_phage	91.9	1.1e-79
WP_000988226.1|2823569_2824736_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	95.8	3.2e-205
WP_000416621.1|2824930_2825620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972009.1|2825696_2825915_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	97.2	6.1e-38
WP_000065257.1|2826060_2826408_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|2826448_2827216_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2827260_2827809_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2827827_2828076_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2828389_2829751_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2829916_2830708_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|2830727_2832014_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287923.1|2832134_2832740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2832774_2833365_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|2833487_2834366_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2834451_2836113_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2836261_2836600_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2836765_2837056_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2837045_2837522_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2837671_2838154_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237670.1|2838767_2850242_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533859.1|2850306_2851716_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196159.1|2851712_2853893_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_010989057.1|2853900_2855064_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000980498.1|2855615_2855834_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_001010544.1|2855902_2857003_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	97.8	1.3e-192
WP_000980418.1|2856999_2857485_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	98.5	2.4e-66
WP_001282764.1|2857481_2860289_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	99.5	0.0e+00
WP_000763316.1|2860281_2860401_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001280960.1|2860415_2860718_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	5.5e-45
WP_001207652.1|2860772_2861288_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	98.8	7.9e-92
WP_000046099.1|2861297_2862470_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.2	2.9e-222
WP_000161707.1|2863003_2863726_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_001287102.1|2863922_2864330_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	85.0	1.1e-59
WP_001274643.1|2864336_2865956_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	90.9	2.1e-154
WP_001086808.1|2865952_2866558_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.5	1.4e-116
WP_000268332.1|2866550_2867459_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_000177406.1|2867445_2867805_-	GPW/gp25 family protein	NA	E5G6N7	Salmonella_phage	95.8	6.8e-58
WP_000993750.1|2867801_2868380_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.0	1.5e-107
WP_000343940.1|2868448_2868895_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	87.0	1.3e-63
WP_001039965.1|2868887_2869319_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	96.5	6.2e-74
WP_001648763.1|2869414_2869843_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	95.0	2.6e-64
WP_000871618.1|2869839_2870214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069920.1|2870218_2870728_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.8	6.4e-94
WP_000171565.1|2870708_2870924_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868182.1|2870927_2871131_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	98.5	5.5e-33
WP_000673534.1|2871130_2871595_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	1.9e-84
WP_000059178.1|2871688_2872342_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	98.6	4.6e-113
WP_000730752.1|2872345_2873428_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	96.9	6.5e-189
WP_000216273.1|2873444_2874278_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.7	2.7e-126
WP_001098460.1|2874420_2876187_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_001292072.1|2876186_2877218_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	95.0	1.3e-191
WP_014344392.1|2877244_2878222_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	32.7	1.2e-24
WP_014344393.1|2878211_2878694_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
2878932:2878953	attL	TCCCCGCCACGCCTGCCCGCTT	NA	NA	NA	NA
WP_000698372.1|2879069_2879447_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	50.0	1.5e-28
WP_014344394.1|2879424_2880534_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	38.9	2.9e-67
WP_001217569.1|2880639_2880873_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	3.7e-33
WP_001154443.1|2880884_2881073_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	6.1e-26
WP_000301157.1|2881396_2883640_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	96.9	0.0e+00
WP_000104129.1|2883630_2884488_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	93.3	4.6e-153
WP_000785514.1|2884484_2884712_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	66.7	5.4e-21
WP_001178763.1|2884711_2884939_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	64.0	8.1e-17
WP_000963476.1|2885006_2885348_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	84.1	6.0e-48
WP_001528723.1|2885311_2885506_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	84.1	5.3e-25
WP_000794278.1|2885590_2885866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460863.1|2885952_2886462_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.9	1.3e-83
WP_000102529.1|2886494_2886743_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	67.9	6.4e-23
WP_000616881.1|2886862_2887495_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	89.5	3.5e-102
WP_000155500.1|2887496_2888522_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.3	3.5e-192
WP_000834152.1|2888518_2889730_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	47.5	6.3e-108
WP_000124715.1|2890072_2891269_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.9	1.4e-107
2894256:2894277	attR	TCCCCGCCACGCCTGCCCGCTT	NA	NA	NA	NA
>prophage 10
NC_016810	Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344, complete genome	4878012	2894441	2900242	4878012		Enterobacteria_phage(100.0%)	8	NA	NA
WP_000210082.1|2894441_2895008_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.2	4.1e-57
WP_000984209.1|2895024_2895267_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	77.8	5.2e-30
WP_000149860.1|2895263_2896001_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.4	9.0e-81
WP_000556594.1|2896538_2896805_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	69.3	3.7e-29
WP_015701354.1|2896801_2897353_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
WP_001216603.1|2897349_2897577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000795388.1|2897573_2897894_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783717.1|2897908_2900242_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.7	0.0e+00
>prophage 11
NC_016810	Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344, complete genome	4878012	4439206	4459626	4878012	tail,plate	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4439206_4439935_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4440131_4440422_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4440670_4441126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4441122_4441728_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4441732_4443478_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4443480_4444113_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4444105_4445221_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4445211_4445571_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4445734_4447282_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4447281_4448211_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4448207_4448570_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4448897_4449620_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4449629_4450673_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4450660_4450870_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4450869_4451823_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262500.1|4451822_4454177_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_001185654.1|4454273_4454402_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4454361_4454679_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4454730_4455255_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4455254_4456682_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4456671_4456869_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4456865_4457321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4457480_4457795_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4457807_4458413_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4458415_4458703_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4459278_4459626_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NC_017720	Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 plasmid pSLT_SL1344, complete sequence	93842	43673	52969	93842	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_000088645.1|43673_44354_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
WP_000369839.1|44735_45092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490265.1|45084_45555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000925627.1|46065_46488_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000457541.1|46487_47762_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_000064272.1|47843_48818_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	3.9e-84
WP_000427676.1|48817_50023_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728917.1|50437_51379_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_001541562.1|51410_51977_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|52033_52369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|52552_52969_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
