The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_016809	Haemophilus influenzae 10810, complete genome	1981535	353447	397603	1981535	protease,tRNA,terminase,tail,portal	Mannheimia_phage(50.0%)	59	NA	NA
WP_015701489.1|353447_353726_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_015701490.1|353725_354592_-	co-chaperone DjlA	NA	NA	NA	NA	NA
WP_015701491.1|354670_355312_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_015701492.1|355335_356052_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_041175099.1|356564_356801_-	hypothetical protein	NA	A0A0M3LSI9	Mannheimia_phage	69.4	4.5e-26
WP_015701493.1|356800_357142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701494.1|357151_357748_-	hypothetical protein	NA	A0A0M3LR33	Mannheimia_phage	44.9	5.6e-41
WP_041175034.1|357747_358167_-	hypothetical protein	NA	A0A0M3LS02	Mannheimia_phage	31.5	1.7e-07
WP_015701495.1|358163_363776_-	DUF1983 domain-containing protein	NA	A0A0M3LQ61	Mannheimia_phage	35.9	9.1e-234
WP_041175101.1|363790_364351_-|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	45.2	1.8e-25
WP_015701497.1|364380_365139_-	C40 family peptidase	NA	A0A0M3LP75	Mannheimia_phage	48.8	2.7e-64
WP_015701498.1|365141_365879_-|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	52.9	3.3e-67
WP_015701499.1|366179_367049_-	phage repressor protein/antirepressor Ant	NA	D0UIK6	Aggregatibacter_phage	81.3	3.3e-135
WP_005651234.1|367400_367559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701500.1|367761_368097_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_015701501.1|368105_371447_-	tape measure protein	NA	A0A0E3JPV7	Enterobacteria_phage	28.4	4.8e-73
WP_015701502.1|371525_371774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154017415.1|371837_371984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101494098.1|372147_372384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005651224.1|372399_372702_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_015701504.1|372685_373069_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_005651221.1|373137_373362_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_015701505.1|373406_373814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701506.1|373829_374084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701507.1|374092_374743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005651206.1|374745_375156_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_015701508.1|375164_375695_-|tail	phage tail protein	tail	M9NZH5	Enterobacteria_phage	42.4	2.9e-17
WP_015701509.1|375697_376009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701510.1|375989_376313_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_041175036.1|376391_378368_-|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	57.1	2.4e-197
WP_154017416.1|378370_378517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701512.1|378590_380105_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	58.6	1.3e-158
WP_015701513.1|380108_380330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701516.1|381008_383129_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	66.2	6.0e-271
WP_015701517.1|383131_383605_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	51.7	1.6e-38
WP_015701518.1|383874_384156_-	hypothetical protein	NA	Q776X1	Haemophilus_phage	71.1	1.4e-29
WP_015701519.1|384067_384403_-	DUF2570 family protein	NA	Q7Y5U9	Haemophilus_phage	67.7	2.6e-27
WP_015701520.1|384375_384918_-	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	51.4	1.5e-45
WP_005688862.1|384898_385150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701521.1|385255_385834_+	hypothetical protein	NA	A0A0M3LS77	Mannheimia_phage	63.0	5.2e-68
WP_015701522.1|386029_386920_-	hypothetical protein	NA	Q0H8C7	Salmonella_phage	42.4	1.1e-61
WP_015701523.1|387234_387756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005643898.1|387933_388302_-	hypothetical protein	NA	Q7Y5V5	Haemophilus_phage	63.4	1.8e-37
WP_015701525.1|388303_388858_-	recombination protein NinG	NA	D0UIK8	Aggregatibacter_phage	71.3	4.8e-63
WP_015701526.1|388860_389064_-	elongation factor Tu	NA	NA	NA	NA	NA
WP_005662137.1|389143_389560_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	82.4	9.3e-59
WP_015701527.1|389560_390484_-	N-6 DNA methylase	NA	A0A0M3LQ47	Mannheimia_phage	57.5	1.2e-95
WP_005633909.1|390480_390705_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	47.9	1.1e-10
WP_015701528.1|390701_392075_-	AAA family ATPase	NA	A0A0M3LQC0	Mannheimia_phage	52.5	1.1e-124
WP_015701529.1|392071_392899_-	hypothetical protein	NA	Q7Y5W1	Haemophilus_phage	56.8	1.8e-77
WP_015701530.1|392895_393054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701531.1|393055_393298_-	hypothetical protein	NA	A0A0M3LR73	Mannheimia_phage	44.2	7.9e-10
WP_015701532.1|393366_393810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701533.1|393864_394047_-	Cro/Cl family transcriptional regulator	NA	A5VW97	Enterobacteria_phage	61.7	8.2e-12
WP_013527627.1|394151_394811_+	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	43.0	1.3e-38
WP_015701534.1|394856_395294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015701535.1|395283_395805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015701536.1|396791_397109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015701537.1|397108_397603_+	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	36.9	1.6e-17
>prophage 2
NC_016809	Haemophilus influenzae 10810, complete genome	1981535	519877	577028	1981535	integrase,tRNA,terminase,protease,tail,head,capsid,portal	uncultured_Caudovirales_phage(43.75%)	60	561971:561992	577394:577415
WP_015701625.1|519877_521170_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_005659843.1|521169_522036_-	pyridoxal kinase	NA	NA	NA	NA	NA
WP_015701626.1|522108_523056_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_015701627.1|523144_523930_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_005656411.1|523929_524736_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.8	4.6e-14
WP_077643694.1|524907_526332_+	murein DD-endopeptidase MepM	NA	A0A2K9VGT1	Pontimonas_phage	48.7	3.8e-19
WP_005693758.1|526446_527403_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_005693756.1|527499_527775_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_015701629.1|527865_528834_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_041175041.1|529255_532063_+	ribonuclease E	NA	NA	NA	NA	NA
WP_015701631.1|532216_532453_+	opa protein	NA	NA	NA	NA	NA
WP_015701632.1|532782_533574_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_005649264.1|533566_534376_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_015701633.1|534386_535067_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_015701634.1|535050_536355_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_015701635.1|536523_537903_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	77.2	1.9e-164
WP_015701636.1|537936_539256_-	ATP-dependent RNA helicase SrmB	NA	A0A1V0SIR5	Klosneuvirus	30.5	6.2e-48
WP_041175042.1|539325_540024_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_015701638.1|540055_541111_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_015701639.1|541257_542625_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005652140.1|542668_543394_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_015701640.1|543518_545063_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_015701641.1|545072_545606_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_015701642.1|545660_547493_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	44.0	1.9e-132
WP_005630954.1|547605_547878_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	61.1	5.9e-22
WP_015701643.1|548017_548608_-	YjaG family protein	NA	NA	NA	NA	NA
WP_015701644.1|548643_549438_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_005649300.1|549504_550101_-	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
WP_015701645.1|550176_550863_-	ComF family protein	NA	NA	NA	NA	NA
WP_015701646.1|550875_552213_-	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_015701647.1|552222_552636_-	competence protein	NA	NA	NA	NA	NA
WP_015701648.1|552632_553154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011272049.1|553150_553657_-	competence protein ComB	NA	NA	NA	NA	NA
WP_005693722.1|553657_554455_-	competence protein A	NA	NA	NA	NA	NA
WP_015701649.1|554553_557148_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_015701650.1|557224_558070_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_005629464.1|558222_558552_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_005626527.1|558684_559287_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_015701651.1|559302_561258_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.2	2.4e-40
WP_005649335.1|561366_561708_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
561971:561992	attL	TTAGTAACCAAAATAGTAACCA	NA	NA	NA	NA
WP_015701652.1|562035_563262_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	36.4	1.2e-61
WP_015701653.1|563433_565203_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	37.5	5.5e-76
WP_015701655.1|565574_566213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701656.1|566199_566406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701657.1|566395_566596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701658.1|566585_566957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701659.1|566949_567879_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_015701660.1|568045_568357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701661.1|568368_568578_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_050792024.1|568750_569713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701663.1|569809_570196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701664.1|570436_570721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701665.1|570717_572385_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	71.6	3.6e-247
WP_015701666.1|572391_572760_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	67.0	8.0e-38
WP_015701667.1|572956_573343_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	53.6	2.4e-29
WP_015701668.1|573357_573672_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	48.5	1.6e-18
WP_041175043.1|573658_574003_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_041175044.1|573986_575219_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	62.5	6.2e-143
WP_015701671.1|575220_575787_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.4	6.3e-50
WP_015701672.1|575840_577028_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	63.3	9.5e-133
577394:577415	attR	TTAGTAACCAAAATAGTAACCA	NA	NA	NA	NA
>prophage 3
NC_016809	Haemophilus influenzae 10810, complete genome	1981535	1378414	1386928	1981535		Bacillus_virus(33.33%)	8	NA	NA
WP_005663823.1|1378414_1379398_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.3	3.2e-17
WP_015702106.1|1379400_1380393_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.0e-14
WP_015702107.1|1380402_1381290_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005694256.1|1381304_1382306_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_041175117.1|1382395_1384576_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.6	1.1e-115
WP_080006075.1|1385190_1385826_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A218M2Y8	Acidovorax_phage	35.2	4.9e-11
WP_005647466.1|1385826_1386252_-	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	42.7	7.8e-21
WP_015702110.1|1386244_1386928_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	50.2	3.9e-54
>prophage 4
NC_016809	Haemophilus influenzae 10810, complete genome	1981535	1645017	1677064	1981535	capsid,holin,tail,terminase	Haemophilus_phage(46.34%)	46	NA	NA
WP_050792026.1|1645017_1645251_-	hypothetical protein	NA	Q7Y5S1	Haemophilus_phage	63.5	2.4e-16
WP_015702270.1|1645250_1646471_-|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	41.3	4.5e-45
WP_015702271.1|1646502_1647078_-	DUF2612 domain-containing protein	NA	D0UIH4	Aggregatibacter_phage	79.1	2.0e-88
WP_015702274.1|1648316_1648670_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	88.5	2.4e-55
WP_015702275.1|1648666_1649311_-	hypothetical protein	NA	D0UIH7	Aggregatibacter_phage	79.4	3.6e-94
WP_015702276.1|1649307_1650180_-	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	86.6	4.5e-140
WP_041175080.1|1650194_1650374_-	hypothetical protein	NA	D0UIH9	Aggregatibacter_phage	94.9	1.9e-21
WP_013525922.1|1650456_1650765_-	hypothetical protein	NA	D0UII0	Aggregatibacter_phage	80.4	1.9e-45
WP_015702277.1|1650770_1651547_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	68.9	1.3e-85
WP_015702278.1|1651552_1653643_-	hypothetical protein	NA	Q7Y5T2	Haemophilus_phage	70.6	1.4e-219
WP_015702279.1|1653793_1654204_-	hypothetical protein	NA	Q776V6	Haemophilus_phage	72.9	3.5e-50
WP_015702281.1|1654654_1656163_-	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	87.1	3.3e-247
WP_041175128.1|1656167_1656530_-	hypothetical protein	NA	Q7Y5T6	Haemophilus_phage	72.3	2.5e-44
WP_015702283.1|1656594_1656966_-	hypothetical protein	NA	Q776V7	Haemophilus_phage	70.7	5.2e-45
WP_015702284.1|1656962_1657409_-	hypothetical protein	NA	Q7Y5T8	Haemophilus_phage	70.9	1.5e-54
WP_015702285.1|1657409_1657772_-	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	67.2	1.8e-34
WP_015702286.1|1657781_1658696_-	DUF2184 domain-containing protein	NA	Q7Y5U0	Haemophilus_phage	90.5	2.1e-151
WP_015702287.1|1658705_1659146_-	hypothetical protein	NA	D0UIJ1	Aggregatibacter_phage	71.1	1.3e-47
WP_015702289.1|1660348_1661782_-|capsid	minor capsid protein	capsid	Q7Y5U5	Haemophilus_phage	76.7	6.6e-88
WP_015702290.1|1661810_1663142_-	DUF1073 domain-containing protein	NA	Q7Y5U6	Haemophilus_phage	84.7	3.0e-212
WP_015702291.1|1663143_1664487_-|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	53.2	1.2e-123
WP_011272619.1|1664473_1664986_-|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	39.2	1.0e-19
WP_015702292.1|1665062_1665314_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	51.8	6.4e-15
WP_015702293.1|1665297_1665645_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	56.1	3.4e-22
WP_041175081.1|1665646_1665928_-	hypothetical protein	NA	Q776X1	Haemophilus_phage	71.1	6.1e-30
WP_041175082.1|1665839_1666163_-	DUF2570 family protein	NA	Q7Y5U9	Haemophilus_phage	55.6	1.7e-20
WP_015702296.1|1666155_1666758_-	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	53.9	9.6e-57
WP_005650535.1|1666726_1667083_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_015702297.1|1667206_1667344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015702298.1|1667418_1668096_-	hypothetical protein	NA	D0UIK6	Aggregatibacter_phage	48.6	1.9e-61
WP_005662099.1|1668463_1668763_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	44.2	1.0e-19
WP_015702300.1|1668759_1669053_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	45.5	3.2e-13
WP_015702301.1|1669084_1669453_-	antitermination protein	NA	Q7Y5V5	Haemophilus_phage	62.6	3.0e-37
WP_015702302.1|1669454_1670009_-	recombination protein NinG	NA	D0UIK8	Aggregatibacter_phage	71.8	1.1e-62
WP_015701526.1|1670011_1670215_-	elongation factor Tu	NA	NA	NA	NA	NA
WP_005662137.1|1670294_1670711_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	82.4	9.3e-59
WP_015702303.1|1670747_1670972_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	47.9	1.1e-10
WP_015702304.1|1670968_1671595_-	replication P	NA	A0A0M3LS65	Mannheimia_phage	37.5	8.8e-29
WP_015702305.1|1671591_1672272_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	62.0	1.7e-62
WP_041175131.1|1672268_1672937_-	phage antirepressor KilAC domain-containing protein	NA	D0UIL6	Aggregatibacter_phage	52.1	1.3e-54
WP_015702309.1|1673450_1673747_-	hypothetical protein	NA	Q7Y5W3	Haemophilus_phage	70.4	1.5e-31
WP_050792027.1|1673773_1674013_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	49.2	7.0e-11
WP_015702310.1|1674113_1674779_+	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	50.9	2.9e-38
WP_041175134.1|1674848_1675586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015702312.1|1675582_1676398_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_015702313.1|1676890_1677064_-	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	62.5	6.8e-08
>prophage 5
NC_016809	Haemophilus influenzae 10810, complete genome	1981535	1765691	1777298	1981535	integrase,transposase,plate	Haemophilus_phage(55.56%)	10	NA	NA
WP_015702380.1|1765691_1766192_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	63.5	3.1e-53
WP_015702381.1|1766188_1766791_-	hypothetical protein	NA	Q94MX9	Haemophilus_virus	88.5	1.2e-91
WP_103746088.1|1768903_1769500_-	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	63.5	6.0e-67
WP_015702385.1|1769496_1770561_-|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	63.7	1.4e-122
WP_015702386.1|1770575_1770926_-	phage GP46 family protein	NA	A0A0M3LQK5	Mannheimia_phage	74.1	4.1e-44
WP_015702387.1|1770995_1771631_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	58.7	1.2e-62
WP_015702388.1|1771640_1772765_-	hypothetical protein	NA	F6MIL3	Haemophilus_phage	71.5	4.3e-143
WP_015702389.1|1772754_1774092_-	DNA circularization N-terminal domain-containing protein	NA	F6MIL2	Haemophilus_phage	44.5	5.0e-106
WP_103746089.1|1775902_1776859_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_015702393.1|1776947_1777298_-	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	52.6	1.0e-13
>prophage 6
NC_016809	Haemophilus influenzae 10810, complete genome	1981535	1780977	1789944	1981535		Mannheimia_phage(40.0%)	16	NA	NA
WP_015702313.1|1780977_1781151_-	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	62.5	6.8e-08
WP_005692473.1|1781164_1781374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015702395.1|1781984_1782164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015702396.1|1782413_1783043_+	hypothetical protein	NA	A0A1J0MFR6	Staphylococcus_phage	44.4	4.3e-23
WP_015702397.1|1783137_1783482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015702398.1|1783481_1783976_+	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	37.5	5.5e-18
WP_015701538.1|1783959_1784253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015702399.1|1784264_1785185_+	recombinase RecT	NA	A0A0M3LNU3	Mannheimia_phage	71.2	1.4e-115
WP_015702400.1|1785159_1785810_+	hypothetical protein	NA	A0A0M3LP90	Mannheimia_phage	72.0	1.4e-85
WP_015702401.1|1785809_1786244_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	34.4	1.3e-18
WP_005652248.1|1786307_1786487_-	hypothetical protein	NA	Q19US2	Mannheimia_phage	62.1	1.8e-11
WP_015702402.1|1786807_1787044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015702403.1|1787040_1787400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015702404.1|1787515_1788277_+	serine/threonine protein kinase	NA	I6PD73	Cronobacter_phage	43.8	1.7e-50
WP_015702405.1|1788280_1788985_+	serine/threonine-protein phosphatase	NA	I6PCV8	Cronobacter_phage	44.0	2.7e-50
WP_015702406.1|1789290_1789944_+	KilA-N domain-containing protein	NA	D0UIK6	Aggregatibacter_phage	81.9	5.4e-45
