The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017592	Streptococcus pneumoniae OXC141, complete genome	2036867	4370	58926	2036867	tRNA,integrase,holin,tail,terminase,capsid,portal,head,protease	Streptococcus_phage(92.0%)	59	23623:23643	57724:57744
WP_000163932.1|4370_4940_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000258091.1|4940_8450_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_001234978.1|8507_8774_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_000041909.1|8766_9135_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_001224760.1|9254_10523_+	serine hydrolase	NA	NA	NA	NA	NA
WP_001208986.1|10519_11797_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000892185.1|11800_12343_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	26.2	4.4e-08
WP_000744554.1|12358_14317_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	H8ZJI5	Ostreococcus_tauri_virus	45.8	3.2e-109
WP_000588866.1|14438_14918_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000939546.1|21774_22011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000205044.1|22241_23528_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	37.1	2.7e-72
23623:23643	attL	CTTTTTCATAATAATCTCCCT	NA	NA	NA	NA
WP_000876732.1|23769_24918_-|integrase	site-specific integrase	integrase	A0A1S5SEH2	Streptococcus_phage	100.0	1.6e-217
WP_000122591.1|25103_26027_-	3'-5' exoribonuclease	NA	A0A1S5SEW3	Streptococcus_phage	100.0	3.5e-175
WP_000136459.1|26039_26423_-	hypothetical protein	NA	A0A1S5SEU6	Streptococcus_phage	100.0	1.9e-66
WP_000492031.1|26435_26801_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SEP7	Streptococcus_phage	100.0	3.2e-63
WP_000041097.1|27177_27399_-	hypothetical protein	NA	A0A1S5SEP1	Streptococcus_phage	100.0	2.1e-30
WP_000389576.1|27517_27664_+	hypothetical protein	NA	A0A1S5SEU4	Streptococcus_phage	100.0	3.6e-18
WP_000032097.1|27675_27879_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SEI7	Streptococcus_phage	100.0	7.7e-27
WP_001057654.1|27895_28093_+	hypothetical protein	NA	A0A1S5SEL5	Streptococcus_phage	100.0	3.6e-29
WP_001002946.1|28103_28265_+	hypothetical protein	NA	A0A1S5SEJ3	Streptococcus_phage	100.0	1.3e-21
WP_000386249.1|28259_28685_-	hypothetical protein	NA	A0A1S5SEI2	Streptococcus_phage	100.0	4.4e-40
WP_001002359.1|28738_29449_+	ORF6C domain-containing protein	NA	A0A1S5SEX2	Streptococcus_phage	100.0	1.1e-133
WP_000370959.1|29462_29720_+	hypothetical protein	NA	A0A1S5SEV6	Streptococcus_phage	100.0	1.2e-43
WP_000462824.1|29805_30126_+	hypothetical protein	NA	A0A1S5SEQ7	Streptococcus_phage	100.0	4.3e-48
WP_000391805.1|30141_30438_+	hypothetical protein	NA	A0A1S5SEL7	Streptococcus_phage	100.0	5.2e-48
WP_001289771.1|30430_31237_+	phage replisome organizer N-terminal domain-containing protein	NA	A0A1S5SEQ1	Streptococcus_phage	100.0	6.5e-125
WP_000228219.1|31376_32147_+	ATP-binding protein	NA	A0A1S5SEJ8	Streptococcus_phage	100.0	6.8e-140
WP_000470307.1|32161_32356_+	hypothetical protein	NA	A0A1S5SEM5	Streptococcus_phage	100.0	1.8e-28
WP_000891962.1|32355_32574_+	hypothetical protein	NA	A0A1S5SEK3	Streptococcus_phage	100.0	1.6e-38
WP_000233203.1|33067_33235_+	hypothetical protein	NA	A0A1S5SEY3	Streptococcus_phage	100.0	5.0e-24
WP_000872740.1|33221_33431_+	hypothetical protein	NA	A0A1S5SEW2	Streptococcus_phage	100.0	3.2e-28
WP_000969665.1|33402_33720_+	hypothetical protein	NA	A0A1S5SER7	Streptococcus_phage	100.0	3.5e-58
WP_000736390.1|33972_34374_+	transcriptional activator	NA	A0A1S5SER4	Streptococcus_phage	100.0	4.7e-68
WP_000397549.1|34561_35104_+|integrase	site-specific integrase	integrase	A0A1S5SEW4	Streptococcus_phage	100.0	1.4e-99
WP_000282427.1|35480_35801_+	HNH endonuclease	NA	A0A141E0N9	Streptococcus_phage	100.0	2.7e-58
WP_001118283.1|35937_36330_+|terminase	P27 family phage terminase small subunit	terminase	A0A1S5SEN5	Streptococcus_phage	100.0	1.6e-65
WP_000527299.1|36322_38053_+|terminase	terminase large subunit	terminase	A0A1S5SEL3	Streptococcus_phage	100.0	0.0e+00
WP_001002923.1|38060_38279_+	hypothetical protein	NA	A0A1S5SEK2	Streptococcus_phage	100.0	1.3e-32
WP_000510803.1|38296_39499_+|portal	phage portal protein	portal	A0A1S5SF08	Streptococcus_phage	100.0	5.2e-227
WP_001172115.1|39482_40058_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1S5SEX0	Streptococcus_phage	100.0	2.2e-103
WP_001030357.1|40054_41221_+|capsid	phage major capsid protein	capsid	A0A1S5SES9	Streptococcus_phage	100.0	6.0e-188
WP_000262606.1|41232_41502_+	hypothetical protein	NA	A0A1S5SEN8	Streptococcus_phage	100.0	2.7e-43
WP_000370976.1|41504_41786_+	hypothetical protein	NA	A0A1S5SES4	Streptococcus_phage	100.0	2.5e-44
WP_000267055.1|41772_42072_+|head	phage head closure protein	head	A0A1S5SEX5	Streptococcus_phage	100.0	3.7e-49
WP_000063886.1|42068_42416_+	HK97 gp10 family phage protein	NA	A0A1S5SEL8	Streptococcus_phage	100.0	8.8e-47
WP_000777003.1|42412_42736_+	hypothetical protein	NA	A0A1S5SEP5	Streptococcus_phage	100.0	3.5e-53
WP_000191279.1|42747_43326_+	hypothetical protein	NA	A0A1S5SEM2	Streptococcus_phage	100.0	2.6e-107
WP_001227146.1|43337_43757_+	hypothetical protein	NA	A0A1S5SEL1	Streptococcus_phage	100.0	1.1e-72
WP_000918318.1|44034_47130_+	hypothetical protein	NA	A0A1S5SF15	Streptococcus_phage	100.0	0.0e+00
WP_000589856.1|47126_47849_+	hypothetical protein	NA	A0A1S5SEY1	Streptococcus_phage	100.0	1.1e-134
WP_000966215.1|47849_54482_+|tail	tail fiber domain-containing protein	tail	A0A1S5SEN7	Streptococcus_phage	100.0	0.0e+00
WP_001091113.1|54575_54779_+	hypothetical protein	NA	A0A1S5SET3	Streptococcus_phage	100.0	5.0e-26
WP_000852241.1|54781_55132_+	hypothetical protein	NA	A0A1S5SEY6	Streptococcus_phage	100.0	2.8e-64
WP_001165344.1|55140_55557_+|holin	phage holin family protein	holin	A0A1S5SCE8	Streptococcus_phage	100.0	1.9e-67
WP_001186219.1|55560_55893_+|holin	phage holin	holin	A0A1S5SEQ5	Streptococcus_phage	100.0	7.7e-40
WP_000350505.1|55896_56853_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1S5SEN2	Streptococcus_phage	100.0	6.7e-145
WP_000109850.1|57073_57262_-	hypothetical protein	NA	A0A0A0YQQ9	Streptococcus_phage	83.9	8.2e-23
WP_000291870.1|57829_58297_+	nucleoside deaminase	NA	NA	NA	NA	NA
57724:57744	attR	CTTTTTCATAATAATCTCCCT	NA	NA	NA	NA
WP_000701992.1|58482_58926_+	dUTP diphosphatase	NA	Q2WG49	Clostridium_botulinum_D_phage	47.3	2.1e-29
>prophage 2
NC_017592	Streptococcus pneumoniae OXC141, complete genome	2036867	74411	85867	2036867		Cyanophage(33.33%)	7	NA	NA
WP_000668304.1|74411_76565_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.8	4.0e-44
WP_000801618.1|76577_77927_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000043304.1|78096_78804_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SE76	Cyanophage	40.1	2.7e-42
WP_000361178.1|79005_82731_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	25.7	1.6e-37
WP_000220633.1|82823_84266_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	5.7e-55
WP_000182558.1|84302_85325_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.9	7.3e-65
WP_000717506.1|85321_85867_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.0	7.4e-24
>prophage 3
NC_017592	Streptococcus pneumoniae OXC141, complete genome	2036867	138338	170046	2036867	tRNA,bacteriocin	Streptococcus_phage(40.0%)	29	NA	NA
WP_001230165.1|138338_138626_+|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000724266.1|138677_140786_+|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_000571038.1|140782_141424_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	1.1e-23
WP_001038476.1|141630_142437_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_096001214.1|142402_142873_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_001189277.1|144652_144973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000424422.1|145731_146112_+|bacteriocin	SP_0115 family bacteriocin-like peptide	bacteriocin	NA	NA	NA	NA
WP_001268150.1|146513_147377_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001838391.1|147842_150062_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	25.5	2.3e-39
WP_001096141.1|150054_150522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000781024.1|150518_151871_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000424429.1|152015_152387_+|bacteriocin	SPH_0218 family bacteriocin-like peptide	bacteriocin	NA	NA	NA	NA
WP_000909532.1|152394_152607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000201420.1|152980_153208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001808813.1|153364_154423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001838392.1|154738_155716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424406.1|156092_156467_+|bacteriocin	SPH_0224 family bacteriocin-like peptide	bacteriocin	NA	NA	NA	NA
WP_000619811.1|156674_157577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424445.1|157632_157986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000072927.1|157982_158711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770314.1|159454_159694_+	hypothetical protein	NA	M1Q0Z8	Streptococcus_phage	54.1	7.2e-16
WP_001808816.1|159678_159957_+	hypothetical protein	NA	M1Q0Z8	Streptococcus_phage	52.7	6.0e-22
WP_001035317.1|160252_162799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001282967.1|163199_164321_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000193606.1|164461_164917_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000220964.1|164926_166840_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_000331961.1|167173_168853_-	ribonuclease J	NA	S0A5H7	Cellulophaga_phage	30.6	8.8e-07
WP_000639580.1|168854_169088_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_000977347.1|169893_170046_-|bacteriocin	fratricide two-peptide bacteriocin subunit CibB	bacteriocin	NA	NA	NA	NA
>prophage 4
NC_017592	Streptococcus pneumoniae OXC141, complete genome	2036867	338489	385503	2036867	protease,transposase,integrase,holin	Streptococcus_phage(27.27%)	37	383361:383374	386942:386955
WP_001063431.1|338489_340595_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.4	1.7e-116
WP_000032550.1|340890_341373_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_000743630.1|341467_342952_-	DUF1846 domain-containing protein	NA	NA	NA	NA	NA
WP_001156820.1|343103_344711_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_001022221.1|344869_345043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000664175.1|347689_348382_+	capsular polysaccharide biosynthesis protein CpsC	NA	A0A1X9I5E1	Streptococcus_phage	56.8	3.2e-64
WP_000684066.1|349950_351135_+	nucleotide sugar dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	52.2	2.1e-103
WP_000287927.1|351150_352404_+	glycosyltransferase	NA	Q84419	Paramecium_bursaria_Chlorella_virus	25.6	6.1e-13
WP_000756065.1|352701_353622_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.2	5.9e-74
WP_001808869.1|353618_354836_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	86.2	1.5e-194
WP_024266168.1|354762_355320_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	45.4	2.4e-38
WP_001032501.1|356708_362012_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_001040010.1|362177_364337_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_000248781.1|364333_364930_-	Holliday junction resolvase RecU	NA	R9TMF8	Paenibacillus_phage	37.2	9.6e-25
WP_000179549.1|364995_365523_+	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_000146522.1|365592_365922_+	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_000711393.1|366407_367565_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_000039274.1|367577_368972_+	mid-cell-anchored protein MapZ	NA	NA	NA	NA	NA
WP_000158781.1|369047_370472_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	29.6	1.6e-41
WP_000518011.1|370483_371173_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	26.1	2.2e-12
WP_000771085.1|371271_372294_+|holin	choline-binding protein CbpC	holin	NA	NA	NA	NA
WP_000771140.1|372312_373434_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	NA	NA	NA	NA
WP_000765691.1|373551_374784_-	MFS transporter	NA	NA	NA	NA	NA
WP_074017684.1|374826_375789_-	lanthionine synthetase	NA	NA	NA	NA	NA
WP_000197317.1|376312_376642_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000163328.1|376763_377642_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_000373456.1|377623_378577_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_000562427.1|378563_379571_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_000210616.1|379554_380565_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_001224635.1|380642_381341_+	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_000743662.1|381337_382333_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000698438.1|382346_382979_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001808881.1|382979_383222_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_075588398.1|383146_383458_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
383361:383374	attL	AAATAATCTTAATA	NA	NA	NA	NA
WP_000754501.1|383898_384138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074186952.1|384182_384812_+|protease	serine protease	protease	NA	NA	NA	NA
WP_000378125.1|385110_385503_+|integrase	tyrosine-type recombinase/integrase	integrase	C9E2L6	Enterococcus_phage	41.4	3.6e-20
386942:386955	attR	AAATAATCTTAATA	NA	NA	NA	NA
>prophage 6
NC_017592	Streptococcus pneumoniae OXC141, complete genome	2036867	798517	858499	2036867	tRNA,bacteriocin,integrase,holin,protease,transposase	Streptococcus_phage(42.86%)	54	802865:802909	854119:854163
WP_001200080.1|798517_799732_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_001076714.1|799868_800693_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000546755.1|800714_801410_+	esterase family protein	NA	NA	NA	NA	NA
WP_001809081.1|801467_801875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074017630.1|801892_802612_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
802865:802909	attL	ATACTCAATGAAAATCAAAGAGCAAACTAGGAAGCTAGCCGCAGG	NA	NA	NA	NA
WP_000627748.1|803119_804613_+	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	31.7	4.0e-35
WP_000756149.1|804625_805027_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000260605.1|805086_805323_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_000158366.1|805319_805733_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A0N9SKD8	Staphylococcus_phage	38.5	3.1e-14
WP_000444455.1|805850_806816_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	29.6	1.4e-33
WP_000756121.1|806849_807956_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000693053.1|811607_811808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001042995.1|811901_812372_-	arginine repressor	NA	NA	NA	NA	NA
WP_001212037.1|812388_814662_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_000561512.1|815008_818110_+	DNA polymerase III subunit alpha	NA	A0A291AWR1	Streptomyces_phage	32.4	2.9e-112
WP_000820852.1|818192_819200_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001042809.1|819258_820764_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_001167984.1|821027_821276_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S8R9	Streptococcus_phage	52.1	1.7e-12
WP_000749599.1|822515_823388_+	DUF4300 family protein	NA	NA	NA	NA	NA
WP_000759775.1|824336_825053_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000617843.1|825182_825998_-	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_000123607.1|825994_826900_-	permease	NA	NA	NA	NA	NA
WP_000359141.1|827491_829621_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_000778589.1|829607_830057_+	SprT family protein	NA	NA	NA	NA	NA
WP_001085044.1|830115_830388_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_000680760.1|830746_830938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000173358.1|831367_832126_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	7.7e-27
WP_000489400.1|832127_834116_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_164848155.1|834157_834802_-	VIT1/CCC1 transporter family protein	NA	NA	NA	NA	NA
WP_001153887.1|834773_835823_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	36.0	6.6e-37
WP_000661000.1|836529_838005_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_074189415.1|837970_838561_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001270407.1|838771_838909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000366707.1|838939_839800_+	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	30.6	6.0e-12
WP_000088774.1|839796_841056_+	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000764379.1|841055_842183_+	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
WP_000969449.1|842179_843265_+	agmatine deiminase	NA	M1HES8	Acanthocystis_turfacea_Chlorella_virus	47.5	2.0e-89
WP_001246755.1|843274_844150_+	N-carbamoylputrescine amidase	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	50.0	1.1e-77
WP_000593608.1|844330_845140_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000602451.1|845411_845633_+|bacteriocin	SP_0924 family bacteriocin-like peptide	bacteriocin	NA	NA	NA	NA
WP_000745371.1|845686_846358_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001025710.1|846599_847508_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.7	3.1e-06
WP_000745389.1|847504_847966_+	signal peptidase II	NA	NA	NA	NA	NA
WP_000403195.1|847955_848843_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.0	1.3e-09
WP_000728261.1|848845_850741_+|holin	phosphorylcholine esterase CbpE	holin	I2E8W4	Clostridium_phage	24.8	1.6e-12
WP_074186894.1|850820_851951_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	58.4	1.5e-114
WP_000254695.1|851960_853223_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	64.5	3.8e-140
WP_000689706.1|853226_854024_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	50.2	8.0e-59
WP_000033362.1|854243_854882_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	68.1	9.8e-76
854119:854163	attR	CCTGCGGCTAGCTTCCTAGTTTGCTCTTTGATTTTCATTGAGTAT	NA	NA	NA	NA
WP_000806714.1|854878_855769_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	51.7	4.9e-73
WP_000358228.1|855808_856126_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	60.0	2.9e-28
WP_001166894.1|856128_856998_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	75.4	2.5e-114
WP_001261453.1|857224_857743_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_000345254.1|857851_858499_+	replication initiator protein A	NA	A0A2P0VK56	Streptococcus_phage	33.7	7.0e-13
>prophage 7
NC_017592	Streptococcus pneumoniae OXC141, complete genome	2036867	1114330	1127227	2036867		Bacillus_phage(22.22%)	12	NA	NA
WP_001152997.1|1114330_1116799_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.5	1.2e-105
WP_000204733.1|1116992_1117979_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000731127.1|1118327_1119023_-	potassium channel family protein	NA	A0A1B0Y2S3	Lactobacillus_phage	47.7	4.7e-23
WP_001812387.1|1119069_1119324_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5S8E8	Streptococcus_phage	51.2	7.0e-17
WP_000208080.1|1119325_1119568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001289493.1|1119658_1120468_-	MBL fold metallo-hydrolase	NA	A0A0C5AFC1	Paenibacillus_phage	39.0	1.8e-34
WP_000886210.1|1120469_1121819_-	cell wall metabolism sensor histidine kinase VicK	NA	W8CYF6	Bacillus_phage	34.6	1.8e-34
WP_000722076.1|1121811_1122516_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.8	2.8e-39
WP_000886147.1|1122570_1123746_-	A/G-specific adenine glycosylase	NA	G3CB03	Aeropyrum_pernix_spindle-shaped_virus	29.8	8.8e-22
WP_000845287.1|1124074_1125745_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_000699489.1|1125974_1126664_+	phosphopantothenate--cysteine ligase	NA	Q9HH70	Methanothermobacter_phage	31.6	2.9e-17
WP_001284130.1|1126675_1127227_+	phosphopantothenoylcysteine decarboxylase	NA	A0A1V0S7W6	Shearwaterpox_virus	36.1	5.2e-25
>prophage 8
NC_017592	Streptococcus pneumoniae OXC141, complete genome	2036867	1162958	1222635	2036867	protease,holin	Bacillus_phage(21.43%)	60	NA	NA
WP_000411215.1|1162958_1163828_-|holin	choline kinase LicA	holin	NA	NA	NA	NA
WP_000609890.1|1163844_1164867_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_000638502.1|1164871_1165579_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000835915.1|1165914_1167402_+	type IV teichoic acid flippase TacF	NA	NA	NA	NA	NA
WP_000811874.1|1167411_1168215_+|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	27.1	5.3e-10
WP_001199652.1|1168216_1169026_+|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	30.3	9.1e-10
WP_001126438.1|1169300_1172477_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_000166701.1|1172789_1173869_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.9	6.3e-59
WP_001293820.1|1173918_1174842_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	31.7	6.7e-25
WP_000850024.1|1174860_1175382_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_000603771.1|1175592_1176222_-	endonuclease III	NA	NA	NA	NA	NA
WP_000773233.1|1176221_1176764_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_000389608.1|1176933_1177251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558894.1|1177489_1179049_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	25.5	7.1e-27
WP_000895724.1|1179197_1180097_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_000219827.1|1180098_1180659_-	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	32.5	8.8e-12
WP_000801941.1|1180752_1181466_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_001809228.1|1181719_1183003_+	uracil transporter	NA	Q9KX94	Enterobacteria_phage	35.3	1.8e-60
WP_000863637.1|1183197_1184769_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000402059.1|1184780_1185113_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_000702356.1|1185202_1185580_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_001003495.1|1185651_1186956_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	35.1	7.5e-30
WP_000023531.1|1186968_1187775_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_001068669.1|1187942_1188290_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000237416.1|1188408_1188738_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	37.8	6.3e-10
WP_000712092.1|1188731_1189106_-	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000362440.1|1189102_1189369_-	chorismate mutase	NA	NA	NA	NA	NA
WP_001162128.1|1189484_1189928_-	flavodoxin	NA	A7KUZ7	Bacillus_phage	37.4	1.6e-08
WP_000401770.1|1190031_1190967_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_001808393.1|1191020_1191305_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000028151.1|1191361_1191580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000199536.1|1192688_1194035_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000711943.1|1194530_1194701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000941987.1|1197652_1197949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000093669.1|1197961_1198105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000869751.1|1198106_1198394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807141.1|1199187_1199325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000945309.1|1199457_1200777_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_000356590.1|1200779_1201520_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	1.0e-23
WP_000656069.1|1201534_1202155_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	2.0e-12
WP_001058017.1|1202338_1203742_-	phosphotransferase	NA	NA	NA	NA	NA
WP_000821274.1|1204370_1204958_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000840776.1|1204960_1205194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000566553.1|1205206_1205587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001814249.1|1205579_1205903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001168347.1|1206164_1206335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001196960.1|1206521_1206890_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_001287278.1|1206965_1207466_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_000862484.1|1207715_1208975_-	TRZ/ATZ family protein	NA	NA	NA	NA	NA
WP_000828831.1|1209231_1210980_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.3	3.7e-48
WP_000681689.1|1210981_1212706_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.0	3.0e-42
WP_000818203.1|1212763_1213702_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000692438.1|1213951_1214821_-	homoserine kinase	NA	NA	NA	NA	NA
WP_000216376.1|1214822_1216109_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_000782676.1|1216259_1216997_-	adaptor protein MecA	NA	NA	NA	NA	NA
WP_000461498.1|1217196_1218231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000565097.1|1218259_1219693_-	O-antigen polysaccharide polymerase Wzy family protein	NA	NA	NA	NA	NA
WP_000446977.1|1219708_1220695_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_000225903.1|1220696_1221800_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_001061988.1|1221789_1222635_-|holin	phosphorylcholine transferase LicD	holin	NA	NA	NA	NA
>prophage 9
NC_017592	Streptococcus pneumoniae OXC141, complete genome	2036867	1266355	1320736	2036867	tRNA,transposase,holin	Bacillus_virus(16.67%)	57	NA	NA
WP_001090165.1|1266355_1267384_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_074017658.1|1268044_1269172_-	G5 domain-containing protein	NA	NA	NA	NA	NA
WP_000835659.1|1269886_1270438_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000058033.1|1270787_1271612_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	57.5	1.8e-74
WP_000283157.1|1271608_1273069_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	43.5	3.0e-104
WP_000797184.1|1273184_1273673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107505.1|1273662_1273872_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000640911.1|1274256_1274709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000773444.1|1274772_1274985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001809119.1|1276849_1277161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000169080.1|1277175_1278462_-	U32 family peptidase	NA	Q6DW11	Phage_TP	31.3	1.6e-40
WP_001262531.1|1279085_1279268_+	ApaLI family restriction endonuclease	NA	NA	NA	NA	NA
WP_078131890.1|1279277_1279631_+	ApaLI family restriction endonuclease	NA	NA	NA	NA	NA
WP_000217307.1|1279638_1280829_+	site-specific DNA-methyltransferase	NA	A0A0H3UZ66	Geobacillus_virus	37.4	7.0e-43
WP_000122904.1|1281343_1282336_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000708373.1|1282495_1284250_+	ABC transporter ATP-binding protein	NA	F2Y352	Organic_Lake_phycodnavirus	32.6	1.3e-24
WP_000657836.1|1284233_1285955_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	6.4e-29
WP_000368971.1|1285965_1286550_+	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_001141942.1|1286549_1287245_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000229369.1|1287232_1288597_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	35.5	3.3e-20
WP_001809122.1|1289051_1289210_-|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_001809123.1|1289802_1290015_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000484475.1|1290023_1290329_-|transposase	IS66 family transposase zinc-finger binding domain-containing protein	transposase	NA	NA	NA	NA
WP_000691853.1|1290315_1290510_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014632422.1|1290706_1291030_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_001136125.1|1290935_1291196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065723.1|1291499_1293062_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.8	1.4e-19
WP_000936189.1|1293203_1293902_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000071669.1|1293944_1294841_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000872215.1|1294849_1295785_-	serine hydrolase	NA	NA	NA	NA	NA
WP_001102214.1|1295781_1296507_-	proteinase	NA	NA	NA	NA	NA
WP_000290648.1|1296590_1297226_-|holin	1-alkyl-2-acetylglycerophosphocholine esterase	holin	A0A2K9L661	Tupanvirus	28.2	4.3e-07
WP_000972925.1|1297227_1298055_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_001272961.1|1299654_1300266_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.4	4.9e-16
WP_000855734.1|1300310_1301039_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000272311.1|1301076_1301988_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	51.5	2.9e-89
WP_000926599.1|1302053_1302278_-	DUF4059 family protein	NA	NA	NA	NA	NA
WP_000590985.1|1302355_1303099_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.0	1.6e-29
WP_001103449.1|1303098_1303899_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000889093.1|1304056_1304413_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	57.3	1.2e-33
WP_001170344.1|1304406_1304937_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.3	1.4e-46
WP_000405832.1|1304936_1305431_-	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	52.1	1.9e-42
WP_000858730.1|1305565_1306012_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_001097984.1|1306008_1306656_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_000689948.1|1306676_1307258_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_000138517.1|1307258_1308134_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_000036789.1|1308285_1309665_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000175416.1|1309958_1310882_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_000915924.1|1310941_1311547_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	54.2	7.7e-54
WP_000673687.1|1311565_1312810_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	52.1	2.2e-55
WP_000371287.1|1313032_1313290_-	DUF896 family protein	NA	NA	NA	NA	NA
WP_000164753.1|1313331_1315368_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000038744.1|1315627_1316545_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_000429564.1|1316739_1317501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001099678.1|1317773_1318616_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.2	1.3e-51
WP_042672207.1|1318729_1320121_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001809132.1|1320355_1320736_-|transposase	PD-(D/E)XK nuclease family transposase	transposase	NA	NA	NA	NA
>prophage 10
NC_017592	Streptococcus pneumoniae OXC141, complete genome	2036867	2014710	2023464	2036867		Streptococcus_phage(33.33%)	9	NA	NA
WP_000510408.1|2014710_2015550_-	energy-coupling factor transporter ATPase	NA	A0A2K9L3Z8	Tupanvirus	29.8	3.0e-16
WP_000835715.1|2015534_2016362_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	32.9	2.8e-22
WP_000712141.1|2016358_2016904_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001227958.1|2016914_2017736_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000170216.1|2017777_2019061_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	30.5	1.2e-16
WP_000424281.1|2019057_2020308_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	42.5	9.2e-94
WP_000455903.1|2020466_2020835_+	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	57.3	7.0e-18
WP_000266660.1|2020837_2021935_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000073423.1|2021985_2023464_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	2.2e-94
