The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017591	Streptococcus pneumoniae INV104, complete genome	2142122	108716	155503	2142122	transposase,protease,bacteriocin,tRNA	Streptococcus_phage(25.0%)	45	NA	NA
WP_000424474.1|108716_109091_+|bacteriocin	SPH_0224 family bacteriocin-like peptide	bacteriocin	NA	NA	NA	NA
WP_000619779.1|109298_110201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424457.1|110256_110496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000072926.1|110492_111221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770313.1|112355_112595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000058766.1|112613_112859_+	hypothetical protein	NA	M1Q0Z8	Streptococcus_phage	57.6	1.7e-15
WP_001035356.1|113144_114983_+	pneumococcal surface protein A	NA	NA	NA	NA	NA
WP_001282984.1|115383_116505_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000193625.1|116645_117101_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000220964.1|117110_119024_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_000331983.1|119447_121127_-	ribonuclease J	NA	NA	NA	NA	NA
WP_000639577.1|121128_121362_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_000184676.1|121743_121965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000974043.1|122177_122330_-|bacteriocin	fratricide two-peptide bacteriocin subunit CibB	bacteriocin	NA	NA	NA	NA
WP_000180803.1|122331_122517_-|bacteriocin	fratricide two-peptide bacteriocin subunit CibA	bacteriocin	NA	NA	NA	NA
WP_000865727.1|122694_123378_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000569825.1|123374_123812_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000655053.1|123801_124812_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	NA	NA	NA	NA
WP_001818694.1|130920_131598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000432158.1|131793_132120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000777225.1|132139_132643_+	asparagine synthase	NA	NA	NA	NA	NA
WP_000399185.1|132623_133334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001283046.1|133345_134095_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_001017607.1|134107_135280_+	nucleotide sugar dehydrogenase	NA	M1IJ73	Paramecium_bursaria_Chlorella_virus	42.9	1.6e-79
WP_000570712.1|135674_136538_+	MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000933479.1|136823_137057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000738306.1|137078_137756_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000720787.1|137767_138433_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000862427.1|138504_139731_+	MFS transporter	NA	NA	NA	NA	NA
WP_001141658.1|140229_140886_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_000253914.1|140875_141199_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_000724961.1|141302_142133_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000724935.1|142354_143185_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000694501.1|143338_144193_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000231827.1|144292_145666_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_000085676.1|145658_146720_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	6.7e-29
WP_000444642.1|146721_147414_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000748394.1|147443_148013_-	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_000532354.1|148147_148762_+	YesL family protein	NA	NA	NA	NA	NA
WP_171800966.1|148763_150410_+	histidine kinase	NA	NA	NA	NA	NA
WP_000278866.1|150421_151708_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000729036.1|151768_152302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000692018.1|152379_152850_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_000075791.1|153142_154405_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_001155321.1|154549_155503_-|transposase	IS30-like element ISSpn8 family transposase	transposase	H7BWC8	unidentified_phage	35.2	1.6e-34
>prophage 2
NC_017591	Streptococcus pneumoniae INV104, complete genome	2142122	305939	375553	2142122	transposase,protease,holin	Streptococcus_phage(25.0%)	53	NA	NA
WP_001063453.1|305939_308045_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.6	3.4e-117
WP_001818716.1|308766_309786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000603792.1|309798_310902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000386786.1|310930_311839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001220022.1|311840_313739_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_001155321.1|314263_315217_-|transposase	IS30-like element ISSpn8 family transposase	transposase	H7BWC8	unidentified_phage	35.2	1.6e-34
WP_000378912.1|315586_315886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000417117.1|315887_316658_+	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_001818718.1|316677_316842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000032550.1|320661_321144_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_000743578.1|321238_322723_-	DUF1846 domain-containing protein	NA	NA	NA	NA	NA
WP_001156799.1|322875_324483_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_001022232.1|324640_324814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000091069.1|327380_328826_+	LCP family protein	NA	A0A1X9I5X1	Streptococcus_phage	59.9	3.1e-133
WP_000565348.1|328827_329559_+	tyrosine-protein phosphatase CpsB	NA	NA	NA	NA	NA
WP_000664173.1|329567_330260_+	capsular polysaccharide biosynthesis protein CpsC	NA	A0A1X9I5E1	Streptococcus_phage	56.8	2.7e-63
WP_001142515.1|330269_330935_+	polysaccharide biosynthesis tyrosine autokinase CpsD	NA	A0A1X9I5D6	Streptococcus_phage	60.7	1.1e-72
WP_001053205.1|331075_332212_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001079795.1|332204_332756_+	acyltransferase	NA	NA	NA	NA	NA
WP_000862350.1|332752_333907_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000672721.1|334023_335328_+	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
WP_001818726.1|335513_336683_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_001214397.1|336750_337821_+	UDP-glucuronate 4-epimerase Gla	NA	A0A291LAD7	Escherichia_phage	27.6	7.3e-23
WP_000685088.1|337849_339082_+	nucleotide sugar dehydrogenase	NA	M1I6D5	Acanthocystis_turfacea_Chlorella_virus	49.9	6.3e-103
WP_000268343.1|339297_339480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000676139.1|341287_342145_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	61.1	7.4e-95
WP_000131462.1|342145_342742_+	dTDP-4-dehydrorhamnose 3,5-epimerase family protein	NA	H9NC63	Sphingomonas_phage	33.1	5.1e-10
WP_000141505.1|342751_343801_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	45.1	8.3e-72
WP_001869275.1|344793_345228_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000842605.1|346145_348128_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001032518.1|348428_353732_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_001040002.1|353898_356058_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_000611597.1|356054_356651_-	Holliday junction resolvase RecU	NA	A0A1L2JY30	Aeribacillus_phage	33.3	2.5e-17
WP_000179549.1|356716_357244_+	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_000146522.1|357313_357643_+	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_000711408.1|358128_359286_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_000039278.1|359298_360693_+	mid-cell-anchored protein MapZ	NA	NA	NA	NA	NA
WP_000158793.1|360768_362193_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	29.6	2.1e-41
WP_000518008.1|362204_362894_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000771100.1|362991_363948_+|holin	choline-binding protein CbpC	holin	NA	NA	NA	NA
WP_000765667.1|364065_365298_-	MFS transporter	NA	NA	NA	NA	NA
WP_001818729.1|365340_365928_-	lanthionine synthetase	NA	NA	NA	NA	NA
WP_000196971.1|366825_367155_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000163315.1|367276_368155_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_000373452.1|368136_369090_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_000562440.1|369076_370084_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_000210618.1|370067_371078_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_001224637.1|371155_371854_+	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_000743659.1|371850_372846_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000698434.1|372859_373492_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_075218746.1|373659_373971_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_000754501.1|374411_374651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100139.1|374731_375553_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
>prophage 3
NC_017591	Streptococcus pneumoniae INV104, complete genome	2142122	441964	507500	2142122	transposase,bacteriocin,tRNA	Klosneuvirus(22.22%)	60	NA	NA
WP_001818744.1|441964_442135_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000628994.1|442433_443657_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_001059630.1|443824_445147_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000236916.1|445148_447035_+	DUF4838 domain-containing protein	NA	NA	NA	NA	NA
WP_000836780.1|447202_447547_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000429415.1|447556_448969_+	6-phospho-beta-galactosidase	NA	NA	NA	NA	NA
WP_000359743.1|449038_450718_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001844177.1|450843_452283_-	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_000691685.1|452286_453636_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_001063601.1|453823_454672_+	S-adenosyl-l-methionine hydroxide adenosyltransferase family protein	NA	NA	NA	NA	NA
WP_000403169.1|454686_455235_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000693288.1|455241_455544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000656538.1|455645_457328_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.4	4.5e-19
WP_001148102.1|457312_458143_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000181374.1|458335_458839_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_000185833.1|459291_459855_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_000678692.1|459868_460495_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000525617.1|460606_461479_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_153232345.1|461608_461746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000781144.1|462169_463084_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_000170500.1|463076_464090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867291.1|466943_467285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000418402.1|467696_468284_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_000105242.1|468673_470281_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	47.0	8.9e-142
WP_000026639.1|470839_472471_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_000795176.1|472763_477743_+	bacterial Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_001096743.1|477832_479029_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000119907.1|479164_479692_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_000659544.1|479768_480125_+	transcriptional repressor GlnR	NA	NA	NA	NA	NA
WP_001122900.1|480161_481508_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_001808898.1|481603_481723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000410533.1|481687_481837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067590.1|481980_482118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001220744.1|482288_483566_+	restriction endonuclease subunit S	NA	A0A1V0SKS6	Klosneuvirus	29.8	5.3e-12
WP_000229456.1|483513_484797_-	restriction endonuclease subunit S	NA	A0A1V0SLK8	Klosneuvirus	25.6	8.2e-13
WP_001088689.1|487433_487943_+	DUF2812 domain-containing protein	NA	NA	NA	NA	NA
WP_000255782.1|488106_489141_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_000046031.1|489167_489692_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_000034662.1|490171_491995_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	47.2	1.3e-133
WP_000115729.1|492007_492361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066295.1|492565_493702_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	31.3	2.4e-24
WP_001813906.1|494051_494291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777753.1|494452_494740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001278304.1|494749_495160_-	HIT family protein	NA	B5LJ12	Mycobacterium_phage	31.6	4.4e-05
WP_000889923.1|495227_495959_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	9.0e-25
WP_000653751.1|495955_497005_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000132572.1|497172_497502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000682133.1|497778_498117_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001219141.1|498121_498859_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001099891.1|498872_500213_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000358815.1|500283_500412_-	quorum-sensing system pheromone BlpC	NA	NA	NA	NA	NA
WP_001069076.1|500468_501830_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_000205170.1|501840_503994_-	peptide cleavage/export ABC transporter BlpA	NA	W8CYL7	Bacillus_phage	27.9	6.3e-42
WP_001093259.1|504275_504473_+|bacteriocin	bacteriocin-like peptide BlpI	bacteriocin	NA	NA	NA	NA
WP_001093248.1|504939_505209_+|bacteriocin	bacteriocin-like peptide BlpJ	bacteriocin	NA	NA	NA	NA
WP_000379964.1|505277_505508_+|bacteriocin	bacteriocin-like peptide BlpU	bacteriocin	NA	NA	NA	NA
WP_001844187.1|505510_505630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000727118.1|505928_506093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000846570.1|506089_506494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128887636.1|506696_507500_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_017591	Streptococcus pneumoniae INV104, complete genome	2142122	822912	899154	2142122	bacteriocin,transposase,protease,holin,integrase	Streptococcus_phage(56.25%)	66	821477:821536	823882:824260
821477:821536	attL	CAAATCCCGATTTAACGAGATGTTTGGGGAAAATAAAATATTTGAAAGCATTGATAACTT	NA	NA	NA	NA
WP_000444456.1|822912_823878_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	29.6	1.8e-33
WP_078463703.1|823843_824317_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
823882:824260	attR	CAAATCCCGATTTAACGAGATGTTTGGGGAAAATAAAATATTTGAAAGCATTGATAACTTATTTGATATTATAGATGGTGATAGGGGCAAAAATTATCCTAAATCAGATGAGTTGTTTAGTGAGGAGTACTGTTTATTTTTAAATACAAAGAATGTTACTAAAAACGGATTTTCATTCGATACAAAGCAATTTATCACTAAAACAAAGGATAAATTACTTCGAAAAGGCAAGCTTGAGCGTTATGATATAGTCTTGACAACAAGAGGTACTGTTGGAAATGTAGCGTACTACGATGAATTAATAAAATATAAACATTTACGTATAAATTCAGGTATGGTAATATTACGTCCCAAGACACCAAATCTAAATCAGAAATTT	NA	NA	NA	NA
WP_000436615.1|827076_828333_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	96.2	2.5e-232
WP_078157373.1|828418_829120_+	restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_000095642.1|830927_831122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693053.1|831099_831300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000840765.1|831832_831976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000821300.1|832068_832656_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000926541.1|833054_833864_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000078473.1|833868_834570_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000654135.1|834594_835512_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000537365.1|835539_837081_+	sodium:solute symporter	NA	NA	NA	NA	NA
WP_000587138.1|837099_837558_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000739354.1|837559_839782_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_000248712.1|839821_840931_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000691263.1|841087_841978_+	ROK family protein	NA	NA	NA	NA	NA
WP_000185367.1|842002_842326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018348.1|842315_844307_+	V-type ATP synthase subunit I	NA	NA	NA	NA	NA
WP_000400484.1|844322_844799_+	V-type ATP synthase subunit K	NA	NA	NA	NA	NA
WP_000067169.1|844832_845414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000380539.1|845478_846486_+	V-type ATPase subunit	NA	NA	NA	NA	NA
WP_000387941.1|846475_846796_+	V-type ATP synthase subunit F	NA	NA	NA	NA	NA
WP_000191784.1|846858_848634_+	V-type ATP synthase subunit A	NA	NA	NA	NA	NA
WP_000111249.1|848634_850020_+	V-type ATP synthase subunit B	NA	NA	NA	NA	NA
WP_000251933.1|850042_850654_+	V-type ATP synthase subunit D	NA	NA	NA	NA	NA
WP_000012987.1|852356_852617_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_001043002.1|852720_853191_-	arginine repressor	NA	NA	NA	NA	NA
WP_001212044.1|853207_855481_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_000561543.1|855827_858929_+	DNA polymerase III subunit alpha	NA	A0A291AWR1	Streptomyces_phage	32.6	2.0e-113
WP_000820852.1|859010_860018_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001042809.1|860074_861580_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000749599.1|863384_864257_+	DUF4300 family protein	NA	NA	NA	NA	NA
WP_014632364.1|864889_865180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000759775.1|865203_865920_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000617845.1|866048_866864_-	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_000123626.1|866860_867766_-	permease	NA	NA	NA	NA	NA
WP_000359103.1|868163_870293_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_000778576.1|870279_870729_+	SprT family protein	NA	NA	NA	NA	NA
WP_001085044.1|870787_871060_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_000680766.1|871413_871605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000173358.1|872032_872791_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	7.7e-27
WP_000489409.1|872792_874781_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_049770734.1|874822_875467_-	VIT family protein	NA	NA	NA	NA	NA
WP_000661010.1|877194_878670_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000366713.1|879606_880467_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_000088781.1|880463_881723_+	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000764364.1|881722_882850_+	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
WP_000969454.1|882846_883932_+	agmatine deiminase	NA	M1HES8	Acanthocystis_turfacea_Chlorella_virus	47.2	5.9e-89
WP_001246751.1|883941_884817_+	N-carbamoylputrescine amidase	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	50.0	1.9e-77
WP_000593576.1|884997_885807_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000602452.1|886078_886300_+|bacteriocin	SP_0924 family bacteriocin-like peptide	bacteriocin	NA	NA	NA	NA
WP_000745372.1|886353_887025_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001809535.1|887076_887274_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001025704.1|887266_888175_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.7	3.1e-06
WP_000745386.1|888171_888633_+	signal peptidase II	NA	NA	NA	NA	NA
WP_000403198.1|888622_889510_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_000728271.1|889512_891393_+|holin	phosphorylcholine esterase CbpE	holin	Q332B9	Clostridium_botulinum_C_phage	22.9	1.2e-09
WP_001844069.1|891475_892606_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	58.4	4.2e-114
WP_000254690.1|892615_893878_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	65.0	1.0e-140
WP_000689717.1|893881_894679_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	50.2	3.2e-60
WP_000033388.1|894898_895537_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	67.6	2.9e-75
WP_000806714.1|895533_896424_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	51.7	4.9e-73
WP_000358228.1|896463_896781_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	60.0	2.9e-28
WP_001166883.1|896783_897653_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	75.7	4.5e-116
WP_001261452.1|897879_898398_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_000345254.1|898506_899154_+	replication initiator protein A	NA	A0A2P0VK56	Streptococcus_phage	33.7	7.0e-13
>prophage 5
NC_017591	Streptococcus pneumoniae INV104, complete genome	2142122	1027385	1095747	2142122	transposase,protease,integrase	Streptococcus_phage(52.94%)	58	1028466:1028482	1084793:1084809
WP_128887640.1|1027385_1028189_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_000992876.1|1028381_1030673_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.1	9.5e-129
1028466:1028482	attL	GCTGGTTCTGGAAAGAC	NA	NA	NA	NA
WP_000286922.1|1030715_1031396_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000743319.1|1031392_1032082_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_000653403.1|1032099_1032741_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_000462488.1|1032823_1033039_-	DUF4649 family protein	NA	NA	NA	NA	NA
WP_000863510.1|1033046_1033394_-	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_000639662.1|1033398_1034514_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	36.8	1.0e-27
WP_001283813.1|1034523_1035483_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	32.8	9.3e-38
WP_000681286.1|1035595_1036165_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_000171676.1|1036292_1036964_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_000799053.1|1036947_1037766_+	NAD kinase	NA	NA	NA	NA	NA
WP_001210004.1|1037762_1038659_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_000451584.1|1038702_1039677_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_000981526.1|1041288_1041588_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001818850.1|1042057_1042657_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_001155325.1|1042688_1043642_-|transposase	IS30-like element ISSpn8 family transposase	transposase	H7BWC8	unidentified_phage	34.9	8.1e-34
WP_000109138.1|1044119_1044434_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_000613691.1|1044449_1044794_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_000916509.1|1044810_1045104_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_000587444.1|1046056_1046974_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_000592059.1|1047066_1047915_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	46.5	1.4e-64
WP_000161389.1|1048056_1048896_+	DegV family protein	NA	NA	NA	NA	NA
WP_001284639.1|1049001_1049277_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	66.3	9.2e-23
WP_000584881.1|1049704_1051606_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	1.2e-49
WP_000400562.1|1051608_1052472_+	MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001083036.1|1052551_1053556_+	MFS transporter	NA	NA	NA	NA	NA
WP_001042594.1|1054695_1056654_+	NAD-dependent DNA ligase LigA	NA	A0A1W6DX16	Sphingobium_phage	35.9	6.0e-100
WP_000283068.1|1056765_1059045_+	type I pullulanase	NA	NA	NA	NA	NA
WP_000199377.1|1059588_1061013_+	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000370269.1|1061494_1063423_+	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_000787276.1|1063412_1064555_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_000687065.1|1064544_1065684_+	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_000697295.1|1065680_1067114_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_001818852.1|1067172_1067535_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_001818853.1|1067488_1067818_+	HAD hydrolase family protein	NA	NA	NA	NA	NA
WP_000706414.1|1067826_1068942_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	50.5	4.7e-73
WP_000131076.1|1068938_1069385_-	YueI family protein	NA	NA	NA	NA	NA
WP_000022813.1|1069548_1070853_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	94.5	4.7e-234
WP_001021177.1|1071006_1072170_-|integrase	site-specific integrase	integrase	A0A1X9I6A9	Streptococcus_phage	91.2	6.3e-206
WP_001844103.1|1072243_1072747_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I723	Streptococcus_phage	37.9	1.5e-15
WP_000909239.1|1072808_1072991_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000404761.1|1073201_1073468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000706986.1|1073478_1073631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000171238.1|1074267_1074468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001003752.1|1074469_1074685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140556.1|1074759_1075569_+	DnaD domain protein	NA	A0A2I6QQV2	Streptococcus_phage	54.4	1.5e-60
WP_000838906.1|1075580_1076477_+	ATP-binding protein	NA	A0A1X9I6C4	Streptococcus_phage	46.8	8.4e-65
WP_000138312.1|1077075_1077249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000144752.1|1077338_1077944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000918209.1|1077987_1078416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233892.1|1078357_1078735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001124848.1|1078752_1079163_+	hypothetical protein	NA	K4JTJ9	Streptococcus_phage	51.6	1.5e-29
WP_078157378.1|1079654_1080083_-|integrase	tyrosine-type recombinase/integrase	integrase	W6LMU7	Streptococcus_phage	48.2	3.5e-21
WP_000772351.1|1081376_1084652_+	ATP-dependent nuclease subunit B	NA	NA	NA	NA	NA
WP_000767233.1|1084648_1088299_+	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	25.3	1.5e-19
1084793:1084809	attR	GCTGGTTCTGGAAAGAC	NA	NA	NA	NA
WP_000174788.1|1088468_1089647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000417174.1|1089855_1095747_+|protease	immunoglobulin A1 protease	protease	NA	NA	NA	NA
>prophage 6
NC_017591	Streptococcus pneumoniae INV104, complete genome	2142122	1200345	1257963	2142122	transposase,protease,holin	Bacillus_phage(27.27%)	52	NA	NA
WP_000411210.1|1200345_1201215_-|holin	choline kinase LicA	holin	NA	NA	NA	NA
WP_000609887.1|1201231_1202254_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_000638507.1|1202258_1202966_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000835913.1|1203301_1204789_+	type IV teichoic acid flippase TacF	NA	NA	NA	NA	NA
WP_000812001.1|1204798_1205602_+|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	27.1	9.0e-10
WP_001199647.1|1205603_1206413_+|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	29.5	3.5e-09
WP_001126426.1|1206687_1209864_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_000166701.1|1210175_1211255_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.9	6.3e-59
WP_001293836.1|1211304_1212228_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	31.7	3.0e-25
WP_000850024.1|1212246_1212768_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_000244451.1|1212978_1213608_-	endonuclease III	NA	NA	NA	NA	NA
WP_000773234.1|1213607_1214150_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_001818871.1|1214328_1214646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001818872.1|1214884_1216444_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	27.5	9.3e-11
WP_000895734.1|1216487_1217387_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_000219824.1|1217388_1217949_-	LemA family protein	NA	NA	NA	NA	NA
WP_000802934.1|1218042_1218756_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_001813450.1|1219107_1220391_+	uracil transporter	NA	Q9KX94	Enterobacteria_phage	35.3	3.1e-60
WP_000863628.1|1220585_1222157_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000402066.1|1222168_1222501_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_000702355.1|1222591_1222969_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_001003509.1|1223040_1224345_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.8	2.3e-26
WP_000023522.1|1224357_1225164_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_001009000.1|1225206_1226205_+	SAP domain-containing protein	NA	NA	NA	NA	NA
WP_001068669.1|1226485_1226833_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000237416.1|1226951_1227281_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	37.8	6.3e-10
WP_000712094.1|1227274_1227649_-	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000362441.1|1227645_1227912_-	chorismate mutase	NA	NA	NA	NA	NA
WP_001162128.1|1228027_1228471_-	flavodoxin	NA	NA	NA	NA	NA
WP_000401798.1|1228574_1229510_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_001808393.1|1229563_1229848_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001818873.1|1229904_1230123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000199560.1|1231194_1232541_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000711939.1|1233046_1233217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000424223.1|1235569_1236019_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_001000318.1|1236523_1236979_-	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_000272434.1|1237000_1238461_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001180441.1|1240165_1241605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000577773.1|1241618_1242548_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_001071049.1|1242558_1243491_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_000448319.1|1243491_1244178_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_078101602.1|1244896_1245655_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001165928.1|1245832_1246441_+	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_167544898.1|1246675_1247916_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.9	5.4e-62
WP_000807141.1|1248323_1248461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000945301.1|1248594_1249914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356590.1|1249916_1250657_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.8	7.0e-09
WP_001108416.1|1250671_1252279_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.0	6.6e-12
WP_001076600.1|1252275_1254216_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_000386148.1|1254248_1256858_-	lanthionine synthetase	NA	NA	NA	NA	NA
WP_000807141.1|1257036_1257174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000821287.1|1257375_1257963_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 7
NC_017591	Streptococcus pneumoniae INV104, complete genome	2142122	1319458	1376257	2142122	transposase,holin,tRNA	Bacillus_virus(17.39%)	57	NA	NA
WP_001090163.1|1319458_1320487_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_000240822.1|1321157_1321547_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	NA	NA	NA	NA
WP_127820884.1|1321600_1322308_-	G5 domain-containing protein	NA	NA	NA	NA	NA
WP_000835652.1|1323007_1323559_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000058033.1|1323956_1324781_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	57.5	1.8e-74
WP_000283118.1|1324777_1326238_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	43.3	1.1e-103
WP_000797188.1|1326353_1326842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107505.1|1326831_1327041_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	49.1	4.1e-07
WP_171800964.1|1328164_1328971_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.6	4.9e-24
WP_001811050.1|1330340_1330652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000169109.1|1330666_1331953_-	U32 family peptidase	NA	Q6DW11	Phage_TP	31.1	1.6e-40
WP_001262531.1|1332576_1332759_+	ApaLI family restriction endonuclease	NA	NA	NA	NA	NA
WP_078102641.1|1332768_1333134_+	ApaLI family restriction endonuclease	NA	NA	NA	NA	NA
WP_000217312.1|1333130_1334321_+	site-specific DNA-methyltransferase	NA	S0A0D5	Cellulophaga_phage	38.4	5.4e-43
WP_000122904.1|1334835_1335828_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000708392.1|1335987_1337742_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.2	1.2e-22
WP_000657824.1|1337725_1339447_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	8.4e-29
WP_000368970.1|1339457_1340087_+	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_029645262.1|1339987_1340545_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000229362.1|1340532_1341897_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.1	3.2e-15
WP_171800965.1|1343205_1343607_-|transposase	transposase	transposase	A0A218MNE7	uncultured_virus	25.6	6.7e-06
WP_000484480.1|1343614_1343920_-|transposase	IS66 family transposase zinc-finger binding domain-containing protein	transposase	NA	NA	NA	NA
WP_000691852.1|1343906_1344101_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001136122.1|1344497_1344683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065723.1|1344986_1346549_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.8	1.4e-19
WP_000936188.1|1346690_1347389_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000071668.1|1347431_1348328_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000872215.1|1348336_1349272_-	serine hydrolase	NA	NA	NA	NA	NA
WP_001102240.1|1349268_1349994_-	proteinase	NA	NA	NA	NA	NA
WP_000290649.1|1350077_1350713_-|holin	1-alkyl-2-acetylglycerophosphocholine esterase	holin	A0A2K9L661	Tupanvirus	28.2	4.3e-07
WP_000972923.1|1350714_1351542_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_001843873.1|1351900_1352617_-	CapA family protein	NA	A0A0N9SJ77	Staphylococcus_phage	32.0	3.2e-27
WP_001272942.1|1353139_1353751_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.4	3.8e-16
WP_000855749.1|1353795_1354524_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000272302.1|1354562_1355474_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	51.8	4.5e-90
WP_000926600.1|1355539_1355764_-	DUF4059 family protein	NA	NA	NA	NA	NA
WP_000590987.1|1355841_1356585_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.0	1.6e-29
WP_001103449.1|1356584_1357385_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000889093.1|1357542_1357899_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	57.3	1.2e-33
WP_001170346.1|1357911_1358424_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	55.6	1.3e-46
WP_000405832.1|1358423_1358918_-	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	52.1	1.9e-42
WP_000858730.1|1359052_1359499_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_001097986.1|1359495_1360143_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_000689945.1|1360163_1360745_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_000138517.1|1360745_1361621_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_000036769.1|1361772_1363152_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000175413.1|1363446_1364370_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_000915944.1|1364429_1365035_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	54.2	5.9e-54
WP_000673678.1|1365052_1366297_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	52.7	3.8e-55
WP_000371287.1|1367286_1367544_-	DUF896 family protein	NA	NA	NA	NA	NA
WP_000164759.1|1367585_1369622_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000038738.1|1369881_1370799_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_000369578.1|1371168_1371930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001099681.1|1372202_1373045_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.2	1.7e-51
WP_001844203.1|1373158_1374550_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001813436.1|1374784_1375162_-|transposase	PD-(D/E)XK nuclease family transposase	transposase	NA	NA	NA	NA
WP_001155321.1|1375303_1376257_-|transposase	IS30-like element ISSpn8 family transposase	transposase	H7BWC8	unidentified_phage	35.2	1.6e-34
>prophage 8
NC_017591	Streptococcus pneumoniae INV104, complete genome	2142122	1459752	1466506	2142122	protease	Streptococcus_phage(50.0%)	8	NA	NA
WP_000081006.1|1459752_1460721_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	100.0	2.8e-66
WP_000011276.1|1460754_1461666_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	100.0	2.3e-155
WP_001231086.1|1461662_1462640_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	100.0	1.2e-184
WP_000163033.1|1462636_1463527_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	3.9e-06
WP_001140412.1|1463578_1463959_-	RidA family protein	NA	NA	NA	NA	NA
WP_000422599.1|1463969_1464557_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_000106346.1|1464565_1465798_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.0	4.2e-131
WP_000162489.1|1465999_1466506_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	42.5	8.7e-27
>prophage 9
NC_017591	Streptococcus pneumoniae INV104, complete genome	2142122	1756836	1764168	2142122		uncultured_Mediterranean_phage(33.33%)	9	NA	NA
WP_000167830.1|1756836_1757538_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	36.5	1.2e-34
WP_000777242.1|1757960_1758920_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	40.8	1.2e-56
WP_001193676.1|1758909_1759866_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_000764306.1|1759862_1760615_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.9	5.6e-14
WP_000858258.1|1760710_1761676_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000821640.1|1761900_1762143_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	59.4	1.3e-17
WP_001222228.1|1762142_1762865_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000105314.1|1762851_1763421_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	34.9	6.6e-15
WP_000351907.1|1763439_1764168_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	22.3	5.3e-09
>prophage 10
NC_017591	Streptococcus pneumoniae INV104, complete genome	2142122	2118545	2127299	2142122		Streptococcus_phage(33.33%)	9	NA	NA
WP_000510412.1|2118545_2119385_-	energy-coupling factor transporter ATPase	NA	W8CYL7	Bacillus_phage	32.6	1.1e-15
WP_000835715.1|2119369_2120197_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	32.9	2.8e-22
WP_000712129.1|2120193_2120739_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001227958.1|2120749_2121571_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000170229.1|2121612_2122896_-	insulinase family protein	NA	A0A1E1EST3	Acanthamoeba_castellanii_mimivirus	30.0	8.4e-18
WP_000424260.1|2122892_2124143_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	42.1	1.7e-92
WP_000455898.1|2124301_2124670_+	RNA-binding S4 domain-containing protein	NA	A0A1X9I5V8	Streptococcus_phage	56.0	4.5e-17
WP_000266660.1|2124672_2125770_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000073428.1|2125820_2127299_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	2.2e-94
