The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017641	Escherichia coli UMNK88, complete sequence	5186416	199372	272224	5186416	transposase,tRNA,plate,protease	Emiliania_huxleyi_virus(12.5%)	55	NA	NA
WP_001295561.1|199372_200725_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|200754_203187_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|203308_203794_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|203797_204823_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|204927_205383_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|205386_206175_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139654.1|206174_207323_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|207319_207916_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|207952_211435_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|211447_212407_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|212505_214647_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901099.1|214703_215093_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176549.1|215157_216456_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|216504_216765_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|216751_216952_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|217117_217663_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635537.1|217659_218082_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239163.1|218095_218806_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001469748.1|219005_219830_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260707.1|219882_221601_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|221711_222419_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|222415_222820_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|222937_223753_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294594.1|223792_224446_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000594006.1|224438_225470_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001140187.1|225657_226233_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|231994_232798_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648598.1|232794_233709_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|233949_234750_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000644685.1|235424_236783_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|236854_237610_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001326702.1|237643_238366_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|238362_238830_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001340895.1|238894_239626_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_001086141.1|240162_240948_+	lipoprotein	NA	NA	NA	NA	NA
WP_001236645.1|241084_241564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908052.1|241573_242488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|242531_243014_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087741.1|243037_244390_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001240525.1|247939_249352_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088852.1|249356_250100_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614329.1|250096_252862_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.9	3.6e-82
WP_000343289.1|252870_253632_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246443.1|253636_254968_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|254970_255495_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113713.1|255491_256772_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348792.1|256796_257879_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393852.1|257842_259693_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|259696_260110_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056989.1|260116_261592_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|261642_261867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037397.1|261901_262402_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|263096_263615_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001101839.1|270264_270657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420822.1|271087_272224_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_017641	Escherichia coli UMNK88, complete sequence	5186416	280482	370316	5186416	integrase,tail,protease,transposase,head,terminase,portal,holin,plate,capsid	Shigella_phage(53.85%)	96	294899:294954	333562:333617
WP_000006255.1|280482_280980_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001325255.1|281203_282943_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207587.1|282887_283673_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|283743_284799_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554757.1|284850_285144_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263490.1|285146_285545_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059847.1|285554_286007_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001293003.1|287032_288490_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|288750_289209_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189541.1|289300_290545_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|290602_291004_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|291042_292098_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|292385_293489_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893279.1|293500_294754_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	2.2e-95
294899:294954	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTTAAATCAA	NA	NA	NA	NA
WP_000051887.1|294958_296122_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000206732.1|296348_296654_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_001242749.1|296653_297016_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008241.1|297006_297543_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	97.8	1.5e-98
WP_000196298.1|298184_298679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848748.1|299020_299695_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|299785_299986_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515835.1|300029_300581_+	protein YmfL	NA	S5FXP0	Shigella_phage	98.9	2.9e-100
WP_001250267.1|300756_300936_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	66.7	2.3e-14
WP_000104963.1|300925_301867_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.4	8.6e-153
WP_074151952.1|301863_302358_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	92.6	3.0e-80
WP_000210164.1|302357_302684_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_000767096.1|302680_303070_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	2.7e-68
WP_001061416.1|303089_303887_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.9	1.7e-149
WP_015675130.1|303894_304884_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	1.4e-193
WP_001205452.1|304901_305255_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	82.3	6.4e-53
WP_000709408.1|305285_306251_-	caspase family protein	NA	NA	NA	NA	NA
WP_001258750.1|306261_306663_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_001120497.1|306964_307291_+|holin	phage holin, lambda family	holin	S5FM86	Shigella_phage	99.1	1.5e-56
WP_001157005.1|307294_307771_+	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	96.8	1.2e-86
WP_001434542.1|307754_308135_+	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	87.2	2.6e-52
WP_000613840.1|308310_308880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001089762.1|308980_309316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001135197.1|309466_309817_+	HNH endonuclease	NA	U5P4L6	Shigella_phage	98.3	2.1e-64
WP_000929175.1|309942_310437_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_122987458.1|310670_312167_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.4	8.2e-299
WP_000605605.1|312178_312361_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	3.8e-25
WP_000466255.1|312360_313602_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_001193631.1|313579_314230_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000257507.1|314244_315450_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	100.0	1.8e-224
WP_000601363.1|315499_315700_+	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	1.7e-26
WP_000927715.1|315702_316026_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	98.1	3.3e-56
WP_000702389.1|316022_316433_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.9	6.1e-71
WP_000224834.1|316407_316914_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.3	6.6e-83
WP_000779292.1|316910_317471_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000497751.1|317479_317650_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000155701.1|317633_319130_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	S5FKL0	Shigella_phage	97.4	2.9e-272
WP_000090998.1|319129_319486_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661047.1|319485_319755_+|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000807192.1|319896_321729_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	98.5	8.8e-303
WP_024250676.1|321761_322208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000219904.1|322318_323647_+	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.0	1.0e-244
WP_000999520.1|323643_324723_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	2.6e-206
WP_000643723.1|324722_325271_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	95.6	6.9e-94
WP_000424728.1|325270_325696_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	99.3	1.5e-80
WP_000785329.1|325682_326741_+|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	98.0	6.8e-199
WP_000383567.1|326731_327316_+	YmfQ family protein	NA	O22003	Shigella_phage	99.0	2.7e-112
WP_000554714.1|327319_328066_+	hypothetical protein	NA	K7PH60	Enterobacterial_phage	82.3	4.1e-81
WP_000805544.1|328065_328659_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_000344820.1|328630_329074_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000905041.1|329535_330090_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	87.8	3.7e-87
WP_000609167.1|330310_333121_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_001111347.1|333733_334144_-	hypothetical protein	NA	NA	NA	NA	NA
333562:333617	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTTAAATCAA	NA	NA	NA	NA
WP_000121342.1|334122_335079_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667036.1|335088_337287_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	4.3e-38
WP_000643332.1|337283_338240_-	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000070699.1|338236_338926_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001303809.1|340204_340534_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001301243.1|340846_341557_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001301239.1|341525_343169_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131096.1|343158_345684_-	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_000716383.1|345709_346378_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|346435_347023_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_015675133.1|347097_347640_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147279.1|348463_348691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|348725_348866_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|348865_349129_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|349492_349594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000020231.1|350708_354965_+	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_001459486.1|355104_355956_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|356545_357139_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474084.1|357150_357387_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046307.1|357495_358821_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000339594.1|359046_359901_+	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001102108.1|360427_361147_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000023927.1|361157_362585_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_000370307.1|362577_363273_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001209096.1|363515_364184_-	membrane protein	NA	NA	NA	NA	NA
WP_001159095.1|364396_366067_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089110.1|366080_367553_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001335745.1|367566_368154_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|368282_370316_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 3
NC_017641	Escherichia coli UMNK88, complete sequence	5186416	914298	1044046	5186416	integrase,tail,protease,lysis,transposase,head,terminase,portal,holin,tRNA,plate,capsid	Salmonella_phage(34.65%)	139	914072:914086	1040758:1040777
914072:914086	attL	TTTTTGCCATCTTTA	NA	NA	NA	NA
WP_000290930.1|914298_915315_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.7	3.2e-105
914072:914086	attL	TTTTTGCCATCTTTA	NA	NA	NA	NA
WP_001321204.1|915501_915693_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
WP_001047321.1|915708_916278_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	3.8e-39
WP_001247707.1|916403_916625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|916657_917167_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956182.1|917174_917375_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000963472.1|917338_917680_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_001244230.1|917747_917981_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
WP_000752607.1|917980_918208_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	94.7	8.6e-35
WP_000104174.1|918204_919059_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	88.7	1.6e-145
WP_001420002.1|919064_919886_+	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	75.7	1.1e-122
WP_001109973.1|919885_922258_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.6	0.0e+00
WP_001154434.1|922410_922599_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|922609_922843_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000140689.1|924250_924787_+	hypothetical protein	NA	NA	NA	NA	NA
923676:923690	attR	TAAAGATGGCAAAAA	NA	NA	NA	NA
WP_000818977.1|925154_926936_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
923676:923690	attR	TAAAGATGGCAAAAA	NA	NA	NA	NA
WP_000520345.1|926976_928002_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.2	1.9e-169
WP_001098438.1|928001_929768_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216237.1|929910_930744_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_000742510.1|930760_931819_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_000059191.1|931822_932473_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673523.1|932568_933033_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000868175.1|933032_933236_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|933239_933455_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069915.1|933435_933948_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	1.8e-88
WP_000727860.1|933949_934327_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	1.8e-16
WP_001759368.1|934323_934752_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	1.9e-46
WP_001039935.1|934847_935279_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
WP_000829147.1|935271_935718_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	86.3	1.7e-63
WP_000993775.1|935786_936365_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000177398.1|936361_936721_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_000268314.1|936707_937616_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	1.2e-143
WP_001086826.1|937608_938214_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.5	4.7e-112
WP_000104749.1|938210_939740_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	72.3	2.3e-200
WP_000368081.1|939739_940342_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	91.0	3.5e-99
WP_001008227.1|940313_940757_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	98.6	8.3e-82
WP_024250680.1|940777_941188_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	99.2	2.0e-66
WP_000905070.1|941218_941785_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	85.7	7.1e-86
WP_000046146.1|941927_943100_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
WP_001207660.1|943109_943625_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|943679_943982_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|943996_944116_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282735.1|944108_947186_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.5	0.0e+00
WP_000980413.1|947182_947668_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_001011804.1|947664_948765_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.2e-175
WP_000972391.1|948855_949074_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|949309_950995_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|951264_951642_+	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001195225.1|951671_951929_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	3.0e-23
WP_001201560.1|952088_952376_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000684321.1|954367_955270_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|955357_955834_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126087.1|956184_957297_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996005.1|957391_958525_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_001093854.1|958534_959488_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|959484_960330_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|960389_960878_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149767.1|960918_962046_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
WP_001295339.1|962244_962976_-	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_000464491.1|963266_963935_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|963934_964651_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|964657_965389_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027213.1|965406_966135_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	4.6e-29
WP_001270734.1|966352_966868_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|966993_967317_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255168.1|967313_968144_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001338420.1|968140_969154_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136577.1|969252_970683_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566372.1|970693_971695_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815362.1|971731_973450_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_000178677.1|973582_974551_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458809.1|974562_976215_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_001338421.1|976358_977258_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|977752_978448_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599802.1|978872_980531_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001380339.1|980527_981484_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746460.1|981634_982750_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188141.1|982746_984693_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|984765_984990_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|985312_985633_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|985663_987940_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|988800_989019_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241676.1|989303_990008_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202202.1|990049_991771_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
WP_001043578.1|991771_993538_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_000537418.1|993660_994626_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|995169_995664_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077038.1|995798_999788_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|999942_1000554_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|1000564_1001908_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|1001998_1003291_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000157344.1|1003524_1003905_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_015675153.1|1003904_1004531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000488105.1|1004929_1005190_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132819.1|1005232_1006333_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	99.7	3.5e-206
WP_000005448.1|1006490_1007675_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	95.2	4.8e-217
WP_000290459.1|1007674_1008187_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	94.1	6.2e-89
WP_000665319.1|1008241_1008610_+	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	93.4	1.3e-51
WP_000333495.1|1008618_1008774_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000853471.1|1008760_1011562_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	87.7	0.0e+00
WP_000979940.1|1011573_1012062_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	93.8	5.9e-81
WP_001165553.1|1012090_1012690_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	82.2	2.0e-86
WP_001077784.1|1013106_1013550_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	72.1	1.7e-58
WP_000368071.1|1013521_1014124_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	98.0	1.0e-106
WP_000071742.1|1015621_1016230_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	75.4	1.5e-86
WP_001111934.1|1016222_1017119_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	95.6	1.5e-151
WP_171021414.1|1017122_1017452_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	98.2	2.4e-54
WP_172836937.1|1017469_1018036_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	93.6	2.9e-95
WP_077633960.1|1018263_1019478_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	2.9e-169
WP_000920577.1|1019991_1020459_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.1	1.3e-85
WP_000780572.1|1020596_1021004_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_000072327.1|1021000_1021393_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|1021389_1021713_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|1021715_1021916_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063082.1|1021915_1022410_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000632304.1|1022512_1023313_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	90.6	1.3e-128
WP_001055119.1|1023358_1024411_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	99.7	1.5e-198
WP_001262662.1|1024434_1025271_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	1.0e-149
WP_000613778.1|1025425_1027177_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
WP_000087796.1|1027176_1028223_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	4.4e-206
WP_001140702.1|1028716_1030942_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_000502620.1|1030965_1032087_-	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	29.5	3.7e-17
WP_000123142.1|1032267_1035033_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.1	0.0e+00
WP_000599405.1|1035039_1035405_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.0	7.3e-60
WP_112014643.1|1035401_1036019_-	ash family protein	NA	S5MQL6	Escherichia_phage	40.7	1.2e-09
WP_001274218.1|1036030_1036330_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	90.9	1.6e-41
WP_000153708.1|1036326_1036572_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	96.3	2.8e-39
WP_032166931.1|1036568_1036760_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.9	2.2e-23
WP_001092663.1|1036796_1037213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021656.1|1037305_1037419_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_000514283.1|1037415_1037658_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	5.2e-38
WP_000158961.1|1037669_1037948_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	6.2e-35
WP_001381918.1|1037958_1038309_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	91.4	8.9e-55
WP_000203251.1|1038428_1038635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204233.1|1038645_1039167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000247830.1|1039270_1039612_+	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	47.1	2.5e-17
WP_000023738.1|1039681_1040674_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.5	2.0e-104
WP_000850306.1|1040973_1043418_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|1043428_1044046_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 4
NC_017641	Escherichia coli UMNK88, complete sequence	5186416	1253158	1260584	5186416	transposase	Stx2-converting_phage(50.0%)	9	NA	NA
WP_001285508.1|1253158_1254391_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.9	9.5e-59
WP_000502842.1|1254375_1255014_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.9e-55
WP_000226520.1|1255092_1255362_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001333354.1|1255382_1256027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422760.1|1257026_1257452_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	1.5e-43
WP_000282125.1|1257751_1257934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000381464.1|1257995_1259567_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.9	5.8e-170
WP_000624618.1|1259586_1259934_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	77.6	5.2e-47
WP_000993956.1|1259933_1260584_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.9	1.4e-16
>prophage 5
NC_017641	Escherichia coli UMNK88, complete sequence	5186416	1365452	1416131	5186416	integrase,tail,protease,lysis,head,terminase,portal,holin,tRNA,capsid	Escherichia_phage(45.24%)	59	1363171:1363186	1381954:1381969
1363171:1363186	attL	ATCCACCGCATCACCG	NA	NA	NA	NA
WP_000074995.1|1365452_1366571_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.2	5.9e-84
WP_000003742.1|1366539_1366809_-	excisionase	NA	NA	NA	NA	NA
WP_001083297.1|1369433_1369625_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|1369621_1369810_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000920491.1|1370372_1370606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394519.1|1370583_1370991_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	40.9	1.0e-09
WP_001171939.1|1371013_1371232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044502262.1|1371303_1371603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000362155.1|1371929_1372349_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|1372449_1372731_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693834.1|1372714_1373140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262360.1|1373211_1374282_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	1.9e-63
WP_001151178.1|1374322_1374748_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.2	1.5e-64
WP_000086482.1|1374744_1374945_+	hypothetical protein	NA	A0A2R2Z315	Escherichia_phage	71.2	3.3e-14
WP_001224945.1|1375040_1375223_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	91.7	1.1e-24
WP_000753061.1|1375215_1375392_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	5.7e-26
WP_001289996.1|1375388_1375904_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	76.5	2.5e-37
WP_001176099.1|1376043_1376301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168997827.1|1376554_1376710_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	4.2e-17
WP_000737636.1|1376853_1377246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032173433.1|1377542_1377821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015675170.1|1377822_1378872_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	2.1e-107
WP_001217424.1|1378884_1379244_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	8.3e-40
WP_001064900.1|1379240_1379930_+	antiterminator	NA	I6PDF8	Cronobacter_phage	49.8	5.8e-58
WP_001294581.1|1381093_1381486_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	96.9	5.3e-56
WP_000950564.1|1381475_1381751_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	96.7	9.5e-44
WP_000014554.1|1381753_1382131_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	98.4	7.8e-65
1381954:1381969	attR	CGGTGATGCGGTGGAT	NA	NA	NA	NA
WP_001140046.1|1382370_1382721_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	95.7	2.3e-63
WP_000796994.1|1383031_1383352_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.2	1.9e-51
WP_001140897.1|1383351_1385109_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.5	0.0e+00
WP_000478598.1|1385120_1385303_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	83.3	4.8e-20
WP_000466015.1|1385302_1386544_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	94.4	4.6e-231
WP_001193624.1|1386521_1387172_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	99.5	1.7e-120
WP_096247121.1|1387183_1388410_+|capsid	phage major capsid protein	capsid	Q8W627	Enterobacteria_phage	92.9	1.7e-209
WP_000719062.1|1388455_1388773_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	1.4e-22
WP_001147815.1|1388781_1389120_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	91.1	1.2e-51
WP_000347790.1|1389119_1389566_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.4	2.3e-63
WP_001206306.1|1389562_1389907_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.4e-55
WP_000097533.1|1389966_1390671_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	96.2	1.5e-117
WP_000164663.1|1390685_1391057_+|tail	phage tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	99.2	1.5e-63
WP_000978931.1|1391080_1391359_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	98.9	1.6e-43
WP_001330090.1|1394613_1394970_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_001152456.1|1394969_1395668_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.6	4.4e-130
WP_063096966.1|1395672_1396416_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	1.1e-147
WP_000090949.1|1396352_1396955_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	2.6e-86
WP_000515470.1|1397015_1400411_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	90.5	0.0e+00
WP_001233158.1|1400478_1401078_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.5	7.7e-107
WP_000885608.1|1404106_1404691_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	4.6e-104
WP_000240999.1|1404745_1405414_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937496.1|1405470_1405737_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.3	2.3e-18
WP_000799406.1|1405969_1406833_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|1406816_1407953_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359441.1|1408202_1409429_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|1409477_1410599_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735411.1|1410674_1412135_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265476.1|1412134_1412806_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1412973_1414344_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|1414347_1414989_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1415024_1416131_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 6
NC_017641	Escherichia coli UMNK88, complete sequence	5186416	1616248	1638227	5186416	integrase	Salmonella_phage(31.82%)	41	1612899:1612915	1618502:1618518
1612899:1612915	attL	CTTTTGCCGCATCCTCA	NA	NA	NA	NA
WP_000945011.1|1616248_1616764_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000954580.1|1617019_1618219_+|integrase	tyrosine-type recombinase/integrase	integrase	I6R9B6	Salmonella_phage	45.1	1.6e-98
WP_015675180.1|1618176_1618395_-	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	44.3	5.4e-10
WP_001037501.1|1618394_1619054_-	hypothetical protein	NA	NA	NA	NA	NA
1618502:1618518	attR	CTTTTGCCGCATCCTCA	NA	NA	NA	NA
WP_162471050.1|1619068_1619230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001249000.1|1619244_1619676_-	recombination protein NinB	NA	A0A2I6PIF6	Escherichia_phage	53.5	3.5e-37
WP_001030726.1|1619672_1619870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021217.1|1620082_1620640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000255737.1|1620719_1622141_-	AAA family ATPase	NA	A0A192Y673	Salmonella_phage	57.4	3.9e-141
WP_000083088.1|1622159_1623278_-	hypothetical protein	NA	M9QWT5	Shigella_phage	67.4	3.5e-153
WP_001292738.1|1623311_1624031_-	phage regulatory protein/antirepressor Ant	NA	A0A1I9SEU7	Klebsiella_phage	52.7	1.0e-57
WP_000870794.1|1624397_1625465_-	DUF4373 domain-containing protein	NA	A0A2I7RBL5	Vibrio_phage	63.2	3.0e-45
WP_000061689.1|1625468_1625723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000853269.1|1626030_1626678_+	helix-turn-helix domain-containing protein	NA	A0A286S2B2	Klebsiella_phage	51.8	4.8e-54
WP_000219058.1|1627181_1627472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000845849.1|1627621_1628257_+	ERF family protein	NA	I6RSN3	Salmonella_phage	54.8	4.7e-54
WP_000056216.1|1628256_1628673_+	single-stranded DNA-binding protein	NA	H9C0R6	Aeromonas_phage	48.5	5.9e-21
WP_001286915.1|1628689_1628968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000228950.1|1628982_1629207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000189370.1|1629444_1629717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985621.1|1629707_1629899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693610.1|1629888_1630221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997869.1|1630234_1630855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000439076.1|1630954_1631173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000755354.1|1631271_1631463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000669333.1|1631452_1631656_+	hypothetical protein	NA	H6WCL9	Enterobacteria_phage	82.1	1.8e-28
WP_000240885.1|1631657_1631894_+	hypothetical protein	NA	H6WCM0	Enterobacteria_phage	60.5	7.4e-21
WP_001173212.1|1631896_1632130_+	hypothetical protein	NA	H6WCM1	Enterobacteria_phage	93.5	6.8e-35
WP_000786934.1|1632139_1632679_+	phage N-6-adenine-methyltransferase	NA	H6WCM2	Enterobacteria_phage	93.9	5.1e-102
WP_000832597.1|1633143_1633647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024250685.1|1633643_1634432_+	hypothetical protein	NA	S4TQH6	Salmonella_virus	61.1	4.0e-79
WP_015675187.1|1634782_1635388_+	recombination protein NinG	NA	G0ZNC4	Cronobacter_phage	53.1	4.2e-44
WP_001008217.1|1635384_1635792_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M4REJ2	Salmonella_phage	58.7	9.7e-37
WP_000787015.1|1635788_1635971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047628.1|1635970_1636699_+	antitermination protein	NA	Q76H66	Enterobacteria_phage	41.8	1.1e-38
WP_000359233.1|1636698_1636902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000691754.1|1636888_1637236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000802884.1|1637225_1637495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836928.1|1637484_1637796_+	hypothetical protein	NA	I6S5Y4	Salmonella_phage	61.8	5.0e-25
WP_000841536.1|1637785_1638001_+	hypothetical protein	NA	A0A1P8DTK9	Salmonella_phage	51.4	8.2e-11
WP_032193522.1|1638005_1638227_+	hypothetical protein	NA	A0A1P8DTX0	Salmonella_phage	47.1	3.3e-07
>prophage 7
NC_017641	Escherichia coli UMNK88, complete sequence	5186416	1642738	1672511	5186416	lysis,head,tail	Salmonella_phage(50.0%)	36	NA	NA
WP_000460269.1|1642738_1642939_+	hypothetical protein	NA	A0A1V0E5H9	Salmonella_phage	47.1	4.3e-06
WP_024250687.1|1642943_1643432_+	glycoside hydrolase family protein	NA	A0A1V0E5Q7	Salmonella_phage	61.6	7.3e-55
WP_000361993.1|1643419_1643890_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_001029620.1|1644168_1644711_+	hypothetical protein	NA	Q76H27	Enterobacteria_phage	44.8	2.9e-20
WP_000124594.1|1645635_1646121_+	DNA-binding protein	NA	Q716H4	Shigella_phage	41.1	8.1e-22
WP_000949802.1|1646123_1647602_+	hypothetical protein	NA	G0ZND4	Cronobacter_phage	68.8	1.2e-198
WP_001139784.1|1647680_1649054_+	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	57.8	1.9e-145
WP_077633973.1|1649043_1649940_+|head	phage head morphogenesis protein	head	H6WRT1	Salmonella_phage	49.8	3.2e-72
WP_001062577.1|1649920_1651213_+	hypothetical protein	NA	A0A1V0E5Q9	Salmonella_phage	54.6	2.1e-117
WP_000488264.1|1651229_1651601_+	hypothetical protein	NA	G0ZND8	Cronobacter_phage	44.2	5.2e-21
WP_000273967.1|1651618_1652668_+	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	65.5	2.9e-133
WP_000258869.1|1652735_1653122_+	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	60.9	5.2e-40
WP_000266990.1|1653124_1653310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034171.1|1653302_1653671_+	hypothetical protein	NA	Q5G8X6	Enterobacteria_phage	50.8	2.7e-30
WP_001121836.1|1653673_1654114_+	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	53.1	3.4e-35
WP_000830404.1|1654110_1654497_+	hypothetical protein	NA	Q5G8X4	Enterobacteria_phage	61.7	2.1e-41
WP_015675202.1|1654509_1654986_+	hypothetical protein	NA	H6WRU1	Salmonella_phage	64.7	9.3e-55
WP_044536830.1|1655039_1655720_+	hypothetical protein	NA	I6R0Q2	Salmonella_phage	42.7	6.4e-41
WP_000424346.1|1655734_1656037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235993.1|1656506_1658846_+	tape measure protein	NA	A0A291AXC6	Shigella_phage	29.5	6.0e-46
WP_000586143.1|1658878_1659058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158414284.1|1659096_1659267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000779575.1|1659385_1659640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001115388.1|1659807_1660161_+|tail	phage tail protein	tail	A0A1V0E5N3	Salmonella_phage	68.7	7.4e-41
WP_000533561.1|1660461_1660710_-	phage antirepressor KilAC domain-containing protein	NA	NA	NA	NA	NA
WP_148277494.1|1660715_1660955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024250691.1|1660970_1661324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000342214.1|1661292_1661496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001244460.1|1661626_1662331_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	71.7	5.9e-98
WP_000244935.1|1662333_1663065_+	C40 family peptidase	NA	Q5G8W2	Enterobacteria_phage	63.6	2.0e-88
WP_044536834.1|1663007_1663538_+|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	51.2	6.3e-36
WP_000094327.1|1663552_1668595_+	DUF1983 domain-containing protein	NA	A0A1V0E5M1	Salmonella_phage	42.0	1.0e-21
WP_000190105.1|1668646_1668958_+	hypothetical protein	NA	C0LP47	Escherichia_virus	54.0	4.4e-21
WP_000190104.1|1668957_1669590_+	hypothetical protein	NA	K7PJV8	Enterobacteria_phage	47.9	4.0e-45
WP_049943756.1|1669586_1669793_-	hypothetical protein	NA	C0LP45	Escherichia_virus	66.7	1.5e-17
WP_077633974.1|1671077_1672511_+|tail	tail fiber domain-containing protein	tail	A0A2D1UII2	Escherichia_phage	72.5	9.0e-69
>prophage 8
NC_017641	Escherichia coli UMNK88, complete sequence	5186416	1852880	1957140	5186416	tail,integrase,transposase,lysis,head,terminase,portal,capsid	Enterobacteria_phage(38.33%)	114	1887769:1887783	1956170:1956184
WP_113705674.1|1852880_1853991_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	6.8e-48
WP_001125439.1|1854302_1855625_-	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001301023.1|1855624_1855891_-	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_001459748.1|1856113_1857514_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.2	3.1e-106
WP_000113162.1|1862063_1863656_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_000154351.1|1863734_1864688_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001194849.1|1864936_1866472_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	23.6	7.2e-16
WP_001222727.1|1867493_1868486_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000172466.1|1868497_1869520_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774189.1|1869546_1870422_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000558527.1|1870445_1870736_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001286597.1|1870792_1871551_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_001313828.1|1871554_1872469_-	bestrophin family inner membrane protein	NA	NA	NA	NA	NA
WP_000854633.1|1872675_1874127_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000558031.1|1874353_1875772_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	2.5e-18
WP_001191027.1|1875910_1876270_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257409.1|1876269_1877196_-	glutaminase B	NA	NA	NA	NA	NA
WP_001459751.1|1877259_1878648_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366507.1|1878748_1879624_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000258584.1|1879707_1880823_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210799.1|1880972_1882163_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885033.1|1882187_1882853_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000843419.1|1883064_1883499_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|1883518_1883902_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803532.1|1883933_1884152_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012628.1|1884208_1885648_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	6.3e-30
WP_001022786.1|1885672_1887346_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_001459752.1|1887401_1887713_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_015675220.1|1887740_1889063_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
1887769:1887783	attL	TTGTTGGCGGCAATA	NA	NA	NA	NA
WP_000722572.1|1889177_1889489_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000577188.1|1889687_1890386_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000087221.1|1890430_1891330_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054152.1|1891524_1892712_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|1892838_1892934_+	protein MgtS	NA	NA	NA	NA	NA
WP_000671735.1|1894297_1894690_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024745.1|1894964_1895483_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_001459755.1|1895527_1897573_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|1897709_1898456_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|1898544_1899231_+	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000214712.1|1899407_1899611_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527813.1|1899646_1901107_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	8.6e-43
WP_120795384.1|1903080_1903194_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1903262_1903496_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086522.1|1903812_1904403_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000885595.1|1904500_1905076_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	2.9e-103
WP_000279160.1|1905075_1908183_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	59.9	3.1e-82
WP_001233110.1|1908247_1908847_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.0	7.2e-105
WP_000515295.1|1908914_1912394_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.8	0.0e+00
WP_071881833.1|1912454_1913087_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.0	2.1e-94
WP_000140768.1|1913023_1913767_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.7e-149
WP_001152612.1|1913771_1914470_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847342.1|1914469_1914799_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	97.2	4.0e-57
WP_000840341.1|1914795_1917357_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.9	0.0e+00
WP_000459471.1|1917349_1917784_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	5.8e-64
WP_000479164.1|1917765_1918188_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.1e-70
WP_015675224.1|1918203_1918944_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000683142.1|1918951_1919347_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	2.9e-70
WP_000985129.1|1919343_1919922_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	8.6e-79
WP_000752963.1|1919933_1920287_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	9.9e-62
WP_000158861.1|1920298_1920697_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	82.6	8.3e-49
WP_000063274.1|1920738_1921764_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	7.3e-190
WP_001299443.1|1921819_1922152_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123321.1|1922161_1923481_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.9	1.6e-234
WP_015675225.1|1923461_1925063_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.3	1.4e-307
WP_000198153.1|1925059_1925266_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027314.1|1925262_1927188_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.9	0.0e+00
WP_000453576.1|1927162_1927708_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001368374.1|1928096_1928330_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1928387_1928798_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1928949_1929123_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1929294_1929450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122134696.1|1929529_1929595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|1929597_1929786_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1929796_1930009_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071766.1|1930372_1930870_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.2e-06
WP_001092971.1|1930866_1931400_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189915.1|1931396_1931708_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1931712_1931928_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1932681_1932897_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1933197_1933410_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1933464_1933554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047136.1|1933831_1934584_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.4	2.7e-133
WP_001424248.1|1934597_1935647_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	7.4e-113
WP_012304870.1|1935648_1935927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1935993_1936245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1936461_1936617_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1936688_1936976_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1936975_1937215_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1937239_1937545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1937747_1938080_+	protein FlxA	NA	NA	NA	NA	NA
WP_000589009.1|1938516_1939830_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001310834.1|1941496_1941853_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_001151262.1|1941849_1942272_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_000054512.1|1942312_1943278_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_000705358.1|1943258_1943780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1943763_1943994_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448565.1|1944077_1944485_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1944651_1944807_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|1944966_1945185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1945744_1945933_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|1945929_1946121_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_148277496.1|1947094_1948456_+	exonuclease	NA	A0A0U2I1R6	Escherichia_phage	79.1	2.9e-40
WP_015675228.1|1948452_1948683_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	68.1	4.5e-23
WP_000005552.1|1948755_1949007_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000877005.1|1949041_1950322_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	2.5e-155
WP_015953164.1|1950323_1950452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836059.1|1950509_1951529_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|1951540_1952755_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001295395.1|1952960_1953287_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_000705209.1|1953421_1953763_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138583.1|1953797_1954358_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_072104773.1|1954360_1955071_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|1955178_1955484_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041683.1|1955682_1957140_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.1	3.0e-120
1956170:1956184	attR	TTGTTGGCGGCAATA	NA	NA	NA	NA
>prophage 9
NC_017641	Escherichia coli UMNK88, complete sequence	5186416	2342776	2413858	5186416	tail,integrase,protease,transposase,head,terminase,portal,holin,capsid	Escherichia_phage(41.67%)	65	2358529:2358544	2388597:2388612
WP_001254922.1|2342776_2343928_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	9.8e-42
WP_000218212.1|2345396_2346248_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826790.1|2346345_2347704_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	2.3e-05
WP_001339045.1|2347703_2348375_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920120.1|2348507_2348921_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740107.1|2349029_2350034_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240091.1|2350034_2350670_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007805.1|2350926_2351577_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001079074.1|2351919_2352450_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_000885571.1|2353940_2354522_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.9e-103
WP_024250696.1|2354521_2355340_-|tail	tail fiber protein	tail	X2KTY7	Enterobacteria_phage	67.5	6.7e-53
WP_001209399.1|2355595_2355940_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_000347790.1|2355936_2356383_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.4	2.3e-63
WP_001147820.1|2356382_2356721_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
WP_000983037.1|2356729_2357035_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
WP_000601355.1|2357046_2357235_-	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_000257522.1|2357285_2358491_-|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	99.3	1.0e-222
WP_001193631.1|2358505_2359156_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
2358529:2358544	attL	CATTCAGTGCAGAGCC	NA	NA	NA	NA
WP_000466257.1|2359133_2360375_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	2.9e-241
WP_000478564.1|2360374_2360557_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	95.0	2.5e-24
WP_001140903.1|2360568_2362326_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.7	0.0e+00
WP_001312917.1|2362325_2362808_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	4.3e-84
WP_001140046.1|2362955_2363306_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	95.7	2.3e-63
WP_000014554.1|2363545_2363923_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	98.4	7.8e-65
WP_000950564.1|2363925_2364201_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	96.7	9.5e-44
WP_001294581.1|2364190_2364583_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	96.9	5.3e-56
WP_000833657.1|2364673_2364826_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000466930.1|2364822_2365248_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	85.1	5.5e-59
WP_096098552.1|2366680_2367394_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001064899.1|2367919_2368588_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.9	1.1e-58
WP_000139991.1|2368584_2368950_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	6.0e-38
WP_001265309.1|2368950_2370006_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.3	1.0e-85
WP_032084570.1|2370007_2370286_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	4.8e-11
WP_000813254.1|2370453_2370609_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000161640.1|2371233_2372043_+	hypothetical protein	NA	A0A0F7L9X0	Escherichia_phage	94.8	2.1e-155
WP_001151221.1|2372189_2372612_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.2	9.7e-64
WP_001262361.1|2372652_2373723_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	6.5e-64
WP_000693883.1|2373794_2374220_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001397087.1|2374838_2375177_+	peptidase S24-like family protein	NA	H9C160	Pectobacterium_phage	30.7	2.5e-06
WP_064226608.1|2375469_2375625_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	4.4e-06
WP_001171946.1|2375784_2376003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854562.1|2376570_2376759_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070257.1|2376755_2376947_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102141.1|2377040_2379482_+	exonuclease	NA	V5UQJ3	Shigella_phage	47.0	2.7e-113
WP_000096344.1|2379540_2379744_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_015675246.1|2379743_2380769_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.6e-102
WP_001301431.1|2381004_2381802_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000480512.1|2390533_2391586_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
2388597:2388612	attR	CATTCAGTGCAGAGCC	NA	NA	NA	NA
WP_000378594.1|2391900_2393217_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|2393318_2394773_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532923.1|2395115_2395832_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122653965.1|2396458_2398102_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011039.1|2398219_2399170_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011483.1|2399271_2400189_-	nitrogen assimilation transcriptional regulator NAC	NA	NA	NA	NA	NA
WP_001310930.1|2400646_2401582_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193786.1|2401643_2402723_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001297350.1|2402734_2403478_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|2403474_2404020_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_000667426.1|2406074_2407289_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001066368.1|2407302_2408061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077633976.1|2408129_2409338_-|transposase	IS3-like element ISEc48 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	1.8e-99
WP_000739813.1|2409470_2410079_+	DMT family transporter	NA	NA	NA	NA	NA
WP_077248216.1|2410085_2410436_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000656352.1|2410438_2411473_+	phosphotriesterase	NA	NA	NA	NA	NA
WP_113705675.1|2412696_2413858_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	5.2e-51
>prophage 10
NC_017641	Escherichia coli UMNK88, complete sequence	5186416	2458785	2467083	5186416		Enterobacteria_phage(28.57%)	7	NA	NA
WP_000532600.1|2458785_2459622_-	polysaccharide pyruvyl transferase family protein	NA	A0A1V0SAR6	Catovirus	32.5	2.5e-26
WP_001100800.1|2460778_2461324_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.7	4.9e-52
WP_000857502.1|2461328_2462207_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	5.1e-107
WP_001023639.1|2462264_2463164_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	2.2e-28
WP_000699432.1|2463163_2464249_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	3.9e-101
WP_000183032.1|2464620_2465514_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_001116039.1|2465688_2467083_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
>prophage 11
NC_017641	Escherichia coli UMNK88, complete sequence	5186416	2561713	2571155	5186416		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001333512.1|2561713_2562850_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
WP_001423058.1|2562846_2564847_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001373589.1|2564971_2565433_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_001295430.1|2565473_2565944_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2565990_2566710_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2566706_2568392_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2568613_2569345_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2569404_2569512_+	protein YohO	NA	NA	NA	NA	NA
WP_000783119.1|2569492_2570224_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569315.1|2570228_2571155_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.0e-08
>prophage 12
NC_017641	Escherichia coli UMNK88, complete sequence	5186416	2782763	2856495	5186416	integrase,protease,coat,lysis,head,terminase,holin,tRNA	Enterobacteria_phage(52.46%)	91	2787166:2787182	2822315:2822331
WP_001283585.1|2782763_2783576_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289167.1|2783575_2784589_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699145.1|2784654_2785791_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	5.9e-23
WP_000615835.1|2785889_2786885_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127740.1|2786881_2788060_-	MFS transporter	NA	NA	NA	NA	NA
2787166:2787182	attL	CTTGCCAGAGCAGCAAC	NA	NA	NA	NA
WP_000817177.1|2788324_2789545_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683789.1|2789703_2791710_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|2791830_2792109_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089250.1|2792142_2792691_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|2792690_2793500_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043792.1|2793499_2794324_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|2794327_2795413_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001459941.1|2795447_2796380_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730816.1|2796545_2797097_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001400721.1|2797222_2798047_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000197766.1|2798048_2798600_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000809301.1|2798596_2799076_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000789849.1|2799072_2799579_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001281607.1|2799595_2800348_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112830.1|2800367_2803013_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033319.1|2803094_2803658_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|2804341_2804827_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426161.1|2805029_2807174_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531957.1|2807173_2808484_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|2808664_2808949_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001295701.1|2809320_2810661_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000577524.1|2811411_2812086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|2812267_2813023_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368117.1|2813316_2814249_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.4	2.3e-166
WP_000958676.1|2814560_2815709_+|integrase	prophage integrase IntS	integrase	Q716F9	Shigella_phage	97.9	1.1e-218
WP_001084296.1|2817517_2818420_-	phage antirepressor Ant	NA	Q0H8C7	Salmonella_phage	97.0	5.7e-170
WP_001210981.1|2818482_2818704_-	hypothetical protein	NA	I6RSG6	Salmonella_phage	100.0	1.9e-34
WP_001161119.1|2818700_2818859_-	Arc family DNA-binding protein	NA	I6S1K8	Salmonella_phage	100.0	7.6e-22
WP_099554642.1|2818985_2819195_+	Arc family DNA-binding protein	NA	I6R0M0	Salmonella_phage	100.0	1.2e-30
WP_000437781.1|2819197_2819431_+	hypothetical protein	NA	I6S5X8	Salmonella_phage	100.0	1.7e-38
WP_001036007.1|2819427_2819637_+	hypothetical protein	NA	I6R975	Salmonella_phage	98.6	5.9e-30
WP_000151196.1|2819611_2819797_-	hypothetical protein	NA	I6RSG3	Salmonella_phage	100.0	1.1e-08
WP_158414285.1|2819920_2820229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000954424.1|2820613_2821057_-	SocA family protein	NA	I6R0L8	Salmonella_phage	70.1	1.2e-59
WP_000467047.1|2821431_2821854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001029858.1|2821878_2824035_-	hypothetical protein	NA	Q9AYY9	Salmonella_phage	86.7	0.0e+00
2822315:2822331	attR	GTTGCTGCTCTGGCAAG	NA	NA	NA	NA
WP_000246974.1|2824034_2825384_-	phage DNA ejection protein	NA	A5VW65	Enterobacteria_phage	98.4	2.3e-244
WP_000964890.1|2825394_2826066_-	hypothetical protein	NA	A5VW66	Enterobacteria_phage	93.3	8.7e-91
WP_000614028.1|2826068_2826524_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	98.0	3.7e-85
WP_000785526.1|2826523_2827477_-	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	84.5	1.6e-93
WP_001122365.1|2827476_2828895_-	packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	98.7	1.7e-274
WP_001140510.1|2828904_2829366_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001389518.1|2829346_2829535_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_000013276.1|2829576_2830830_-|coat	coat protein	coat	A5VW72	Enterobacteria_phage	99.0	4.1e-235
WP_000372579.1|2830848_2831742_-	hypothetical protein	NA	A0A088CPT0	Enterobacteria_phage	98.0	8.2e-129
WP_000417853.1|2835347_2836844_-|terminase	terminase large subunit	terminase	G5DA96	Enterobacteria_phage	93.6	2.4e-282
WP_000729920.1|2836821_2837310_-	DNA-packaging protein	NA	G8EYI7	Enterobacteria_phage	100.0	1.4e-90
WP_000807788.1|2837389_2837632_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000999674.1|2837735_2838116_-	hypothetical protein	NA	Q716B1	Shigella_phage	99.2	1.4e-66
WP_000191869.1|2838350_2838830_-	DUF2829 domain-containing protein	NA	A0A1Y0T2L3	Pseudomonas_phage	60.4	1.1e-55
WP_044537043.1|2838911_2839064_-	hypothetical protein	NA	C6ZR68	Salmonella_phage	98.0	4.7e-21
WP_000092267.1|2839051_2839519_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	98.1	1.4e-76
WP_000229392.1|2839515_2839992_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_000783734.1|2839975_2840299_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_001235461.1|2840967_2841591_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_001271149.1|2841587_2842253_-	serine/threonine protein phosphatase	NA	K7P721	Enterobacteria_phage	100.0	5.9e-132
WP_000144613.1|2842230_2842437_-	phage NinH family protein	NA	Q716C0	Shigella_phage	98.5	8.1e-32
WP_001108074.1|2842433_2843045_-	recombination protein NinG	NA	K7P6N9	Enterobacteria_phage	99.5	1.3e-98
WP_000950963.1|2843037_2843214_-	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_000386662.1|2843213_2843573_-	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	96.6	4.1e-63
WP_001254220.1|2843575_2843752_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_000153270.1|2843748_2844276_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_000736913.1|2844272_2844713_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_001248385.1|2844786_2846163_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.8	9.7e-254
WP_000431325.1|2846159_2847047_-	replication protein	NA	A5VW95	Enterobacteria_phage	98.3	3.8e-142
WP_001244621.1|2847109_2847382_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000438537.1|2847404_2847704_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	100.0	1.3e-49
WP_000437872.1|2847810_2848011_-	Cro/Cl family transcriptional regulator	NA	A4KWT7	Enterobacteria_phage	98.5	5.6e-30
WP_001274764.1|2848111_2848825_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	95.8	7.2e-128
WP_024250699.1|2848949_2849942_+	SppA protein	NA	NA	NA	NA	NA
WP_000216180.1|2850411_2850720_+	hypothetical protein	NA	Q76H58	Enterobacteria_phage	65.7	8.2e-28
WP_000804698.1|2850722_2851001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000167603.1|2851058_2851529_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.4e-87
WP_000865172.1|2851709_2851898_+	hypothetical protein	NA	A0A0B7MKW0	Enterobacteria_phage	59.3	3.8e-12
WP_000005787.1|2852032_2853001_+	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	100.0	2.0e-56
WP_000638547.1|2853025_2853157_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_015675272.1|2853141_2853294_+	host cell division inhibitory peptide Kil	NA	K7PM80	Enterobacteria_phage	98.0	8.1e-21
WP_000050554.1|2853369_2853540_+	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_000031364.1|2853550_2854156_+	ERF family protein	NA	K7P6W7	Enterobacteria_phage	99.5	4.6e-107
WP_000951325.1|2854155_2854539_+	hypothetical protein	NA	A0A2I6PID1	Escherichia_phage	100.0	3.8e-67
WP_001111278.1|2854562_2854856_+	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_001214452.1|2854866_2855031_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
WP_077633977.1|2855417_2855720_+	hypothetical protein	NA	A0A0F6TJ66	Escherichia_coli_O157_typing_phage	89.8	4.1e-24
WP_000002098.1|2855712_2855997_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	97.9	1.2e-49
WP_000545721.1|2856069_2856237_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	90.9	5.0e-24
WP_001163428.1|2856294_2856495_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
>prophage 13
NC_017641	Escherichia coli UMNK88, complete sequence	5186416	3002981	3046039	5186416	integrase,tail,holin,terminase	Escherichia_phage(57.14%)	53	3004818:3004834	3042925:3042941
WP_000017552.1|3002981_3003134_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|3003151_3003343_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001295476.1|3003653_3004172_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_000755173.1|3004187_3004727_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
3004818:3004834	attL	AATCATTCCCACTCAAT	NA	NA	NA	NA
WP_015675280.1|3004930_3005419_-	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	70.2	5.6e-55
WP_000403807.1|3005415_3006045_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	96.7	1.5e-113
WP_000256119.1|3006034_3006343_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	95.1	7.1e-48
WP_000116048.1|3006329_3006734_-	hypothetical protein	NA	T1SA79	Salmonella_phage	92.5	1.1e-61
WP_001188258.1|3009202_3009460_+	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	97.6	4.9e-42
WP_001262276.1|3009775_3010486_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	79.4	7.5e-101
WP_000125783.1|3010586_3010754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000671197.1|3010774_3011215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708858.1|3011309_3011471_+	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_000661385.1|3011509_3011923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248459.1|3011932_3014407_-	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	96.6	0.0e+00
WP_000119858.1|3014412_3016215_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.8	0.0e+00
WP_001145650.1|3016211_3018725_-	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	98.4	0.0e+00
WP_000332883.1|3018724_3019270_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	99.4	2.2e-92
WP_000568023.1|3019269_3019734_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	100.0	8.4e-85
WP_001018537.1|3019733_3022205_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	98.9	0.0e+00
WP_000179260.1|3022204_3022810_-	hypothetical protein	NA	G9L6C9	Escherichia_phage	100.0	2.8e-112
WP_000424496.1|3022809_3023133_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	97.2	1.7e-52
WP_000012376.1|3023183_3023519_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	99.1	8.5e-55
WP_000627075.1|3023529_3023967_-	hypothetical protein	NA	G9L6C6	Escherichia_phage	99.3	1.1e-73
WP_000268709.1|3024018_3025005_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	99.4	4.7e-186
WP_001048072.1|3025019_3025715_-	peptidase	NA	G9L6C4	Escherichia_phage	95.7	3.4e-90
WP_000133160.1|3025717_3026014_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_000852425.1|3026010_3027690_-|tail	tail protein	tail	G9L6C2	Escherichia_phage	99.1	2.0e-301
WP_000335899.1|3027704_3027911_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_001280570.1|3028617_3028989_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	98.4	3.2e-63
WP_000122959.1|3029079_3030555_-	hypothetical protein	NA	G9L6B8	Escherichia_phage	97.4	2.1e-291
WP_001090119.1|3030551_3031226_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	93.8	9.0e-112
WP_001129691.1|3031266_3031605_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	100.0	5.8e-59
WP_001446661.1|3031597_3031948_-	DUF2591 family protein	NA	G9L6B5	Escherichia_phage	73.3	8.6e-42
WP_015675284.1|3031947_3032490_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	81.1	9.0e-38
WP_096194479.1|3033006_3033687_-	ead/Ea22-like family protein	NA	Q1MVF9	Enterobacteria_phage	87.9	3.0e-107
WP_001231263.1|3034159_3034507_-	hypothetical protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	98.3	3.1e-60
WP_000843281.1|3034624_3035407_-	hypothetical protein	NA	G9L6A9	Escherichia_phage	90.8	1.9e-137
WP_000086419.1|3035381_3036239_-	helix-turn-helix domain-containing protein	NA	Q286X4	Escherichia_phage	94.6	4.1e-101
WP_000402893.1|3036254_3036455_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	6.0e-32
WP_001282456.1|3036605_3036836_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	98.7	1.0e-38
WP_000836290.1|3036990_3037575_+	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001198620.1|3037728_3037881_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	100.0	5.4e-25
WP_001102253.1|3037883_3038183_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	97.0	2.5e-45
WP_001068013.1|3038179_3039001_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A2R9YJH7	Escherichia_phage	96.7	9.1e-159
WP_000069417.1|3038997_3039939_+	recombinase RecT	NA	A0A0F6TJP0	Escherichia_coli_O157_typing_phage	98.7	5.5e-176
WP_000675390.1|3039988_3040237_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_001335975.1|3040394_3040646_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
WP_000163465.1|3040638_3041289_+	hypothetical protein	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	97.7	1.1e-125
WP_001077940.1|3041285_3041480_+	DUF1382 family protein	NA	A0A0F6R7M7	Escherichia_coli_O157_typing_phage	100.0	3.3e-27
WP_000954552.1|3041483_3042734_-|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	98.8	5.2e-238
WP_000138270.1|3042926_3044504_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
3042925:3042941	attR	AATCATTCCCACTCAAT	NA	NA	NA	NA
WP_001299507.1|3044572_3046039_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
>prophage 14
NC_017641	Escherichia coli UMNK88, complete sequence	5186416	3123994	3204353	5186416	tail,protease,head,terminase,portal,holin,tRNA,capsid	Escherichia_phage(25.93%)	88	NA	NA
WP_001459997.1|3123994_3124732_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|3124863_3126198_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001351830.1|3126406_3127288_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189231.1|3127390_3127978_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3128033_3128417_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262723.1|3128721_3129411_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997422.1|3129458_3130496_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3130702_3131122_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001300438.1|3131190_3131889_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_000083005.1|3131920_3134581_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3134694_3136050_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|3136095_3136419_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|3136415_3137714_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|3143585_3146159_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040169.1|3146288_3147020_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079100.1|3147016_3147997_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3148131_3148869_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3149139_3149481_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010723158.1|3149584_3149632_+	phe operon leader peptide	NA	NA	NA	NA	NA
WP_000200120.1|3149730_3150891_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225229.1|3150933_3152055_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168037.1|3152065_3153136_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000976004.1|3153345_3153711_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3153860_3154379_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969038.1|3154368_3155595_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589847.1|3155610_3156093_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3156168_3156516_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3156557_3157325_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3157355_3157904_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3157922_3158171_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|3158419_3159781_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|3159947_3160739_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|3160759_3162046_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3162100_3162694_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|3162816_3163695_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|3163780_3165442_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3165590_3165932_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|3165993_3166284_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600189.1|3166273_3166750_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3166881_3167364_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000497435.1|3168212_3168479_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	94.3	8.0e-40
WP_000640714.1|3168521_3169790_-	hypothetical protein	NA	A0A220NRP2	Escherichia_phage	54.6	3.5e-109
WP_000770541.1|3169916_3170279_+	hypothetical protein	NA	A0A192Y9L2	Enterobacteria_phage	37.7	1.1e-12
WP_000012465.1|3170243_3170885_-	hypothetical protein	NA	G8C7R6	Escherichia_phage	90.1	1.0e-112
WP_074151081.1|3170881_3171178_-	hypothetical protein	NA	G8C7R5	Escherichia_phage	81.6	2.1e-41
WP_000179774.1|3171177_3175002_-|tail	phage tail protein	tail	K7PHL5	Enterobacterial_phage	80.8	0.0e+00
WP_000005717.1|3175055_3175655_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	78.4	1.1e-79
WP_024250700.1|3175710_3176049_-	hypothetical protein	NA	Q6UAW3	Klebsiella_phage	46.8	4.0e-20
WP_001249258.1|3176072_3176783_-	C40 family peptidase	NA	K7PJX1	Enterobacterial_phage	97.0	1.0e-142
WP_000055653.1|3176784_3177543_-|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	99.2	3.3e-147
WP_000963855.1|3177539_3177878_-|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	100.0	6.6e-63
WP_000224020.1|3177880_3181162_-|tail	phage tail tape measure protein	tail	A0A220NRN7	Escherichia_phage	98.7	0.0e+00
WP_000050396.1|3181196_3181460_-	DUF4035 domain-containing protein	NA	K7P7L5	Enterobacteria_phage	98.9	8.5e-42
WP_001135721.1|3181483_3181885_-|tail	phage tail assembly chaperone	tail	K7PGV0	Enterobacterial_phage	100.0	4.3e-69
WP_000202242.1|3181939_3182410_-|tail	phage tail protein	tail	A0A220NRQ0	Escherichia_phage	98.7	4.4e-81
WP_000133672.1|3182464_3182812_-	DUF3168 domain-containing protein	NA	A0A220NRP0	Escherichia_phage	98.3	6.5e-58
WP_000580500.1|3182808_3183258_-	HK97 gp10 family phage protein	NA	K7PH84	Enterobacterial_phage	99.3	2.0e-75
WP_000433222.1|3183254_3183593_-|head	phage head closure protein	head	K7P7L2	Enterobacteria_phage	98.2	1.4e-57
WP_000963450.1|3183592_3183919_-|head,tail	phage head-tail connector protein	head,tail	K7PGU9	Enterobacterial_phage	94.4	7.8e-53
WP_001292038.1|3183953_3185111_-|capsid	phage major capsid protein	capsid	Q77WA0	Escherichia_phage	97.7	2.1e-209
WP_001114214.1|3185113_3185791_-|head,protease	HK97 family phage prohead protease	head,protease	K7PKL4	Enterobacterial_phage	99.6	1.6e-124
WP_000392384.1|3185808_3187083_-|portal	phage portal protein	portal	F1C584	Cronobacter_phage	99.5	9.6e-248
WP_000196671.1|3187082_3188597_-|terminase	terminase large subunit	terminase	Q9MCT1	Enterobacteria_phage	95.4	1.3e-283
WP_000764080.1|3188603_3189089_-	hypothetical protein	NA	K7PGU7	Enterobacterial_phage	94.4	3.0e-77
WP_000654109.1|3189273_3189477_-	hypothetical protein	NA	A0A220NRN5	Escherichia_phage	80.6	6.8e-23
WP_001031354.1|3189476_3189818_-	HNH endonuclease	NA	K7PM05	Enterobacterial_phage	99.1	4.6e-64
WP_000230472.1|3189814_3190405_-	hypothetical protein	NA	K7P7D2	Enterobacteria_phage	94.4	1.5e-110
WP_001198424.1|3190386_3191844_-	hypothetical protein	NA	K7PKP3	Enterobacterial_phage	89.5	2.7e-270
WP_000204999.1|3192111_3192462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015675293.1|3192580_3192865_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	67.0	4.9e-27
WP_000505354.1|3193015_3193285_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	94.4	2.1e-35
WP_000373004.1|3193292_3193922_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	92.3	5.6e-108
WP_000243812.1|3193921_3194203_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	46.2	3.7e-19
WP_001283165.1|3194189_3194576_-|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	93.8	7.3e-58
WP_000579590.1|3194684_3194840_-	DUF3927 family protein	NA	S4TRP5	Salmonella_phage	68.8	3.2e-09
WP_000466928.1|3194836_3195262_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	84.4	3.8e-60
WP_000764580.1|3195517_3196318_-	antitermination protein	NA	F1C595	Cronobacter_phage	75.6	4.2e-108
WP_000859367.1|3196314_3197286_-	toprim domain-containing protein	NA	A0A1B5FPA8	Escherichia_phage	81.4	1.7e-156
WP_001177561.1|3197282_3198902_-	DEAD/DEAH box helicase	NA	F1C598	Cronobacter_phage	87.4	4.9e-281
WP_000014299.1|3199607_3199829_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	98.6	1.5e-31
WP_001240978.1|3199926_3200595_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	98.6	9.2e-125
WP_000102580.1|3200765_3201080_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	88.5	2.8e-44
WP_001280518.1|3201072_3201261_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	98.4	7.9e-26
WP_001061798.1|3201429_3201795_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	86.7	2.8e-51
WP_000013343.1|3201787_3202042_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	88.1	6.7e-36
WP_000998504.1|3202231_3202639_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	47.1	3.6e-23
WP_000743358.1|3202742_3203027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024250702.1|3203180_3204353_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	90.8	2.4e-205
>prophage 15
NC_017641	Escherichia coli UMNK88, complete sequence	5186416	3283717	3296900	5186416		Escherichia_phage(40.0%)	12	NA	NA
WP_001272907.1|3283717_3286279_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	2.3e-30
WP_001141339.1|3286384_3287041_+	protein-serine/threonine phosphatase	NA	K7P7V3	Enterobacteria_phage	45.3	5.6e-50
WP_001295181.1|3287091_3287859_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_000847985.1|3288054_3288963_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590404.1|3288959_3290222_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	6.3e-135
WP_001278994.1|3290218_3290857_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136918.1|3290861_3291638_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104429.1|3291726_3293091_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|3293184_3294177_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272590.1|3294239_3295379_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3295518_3296145_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3296138_3296900_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 16
NC_017641	Escherichia coli UMNK88, complete sequence	5186416	4304176	4317479	5186416	integrase	Morganella_phage(44.44%)	15	4296977:4296989	4307823:4307835
4296977:4296989	attL	ACGCAGCAACACC	NA	NA	NA	NA
WP_001555742.1|4304176_4305436_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.1	3.0e-193
WP_001000001.1|4305531_4306497_+	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	51.2	3.0e-07
WP_001090781.1|4306611_4306815_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000412543.1|4306814_4307246_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	3.9e-28
WP_001019372.1|4307258_4308092_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
4307823:4307835	attR	ACGCAGCAACACC	NA	NA	NA	NA
WP_000476150.1|4308084_4308267_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_032167119.1|4308260_4309289_+	ash family protein	NA	Q8W643	Enterobacteria_phage	53.3	1.0e-13
WP_001065741.1|4309281_4309476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024679.1|4309472_4309736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|4309732_4309954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058744.1|4309946_4310549_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	34.7	5.3e-23
WP_001244114.1|4310561_4313324_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.7	3.4e-298
WP_001018523.1|4313909_4314083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000257016.1|4314087_4315467_+	phage DNA ejection protein	NA	A0A2H4FND5	Salmonella_phage	67.1	1.8e-151
WP_000868971.1|4315466_4317479_+	hypothetical protein	NA	A0A2I7QW93	Vibrio_phage	36.8	7.1e-96
>prophage 17
NC_017641	Escherichia coli UMNK88, complete sequence	5186416	4926535	4992619	5186416	transposase,tRNA,integrase,protease	Escherichia_phage(16.67%)	60	4925179:4925193	4965838:4965852
4925179:4925193	attL	CACAGTAATAACACT	NA	NA	NA	NA
WP_000091035.1|4926535_4927438_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_181389973.1|4927727_4928941_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	2.9e-169
WP_128972544.1|4929487_4929838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000102860.1|4929947_4930340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024250719.1|4930418_4930898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000287231.1|4931003_4931381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001293037.1|4931468_4932098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000521999.1|4932220_4932604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000850393.1|4932696_4933674_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	38.7	3.0e-47
WP_000005868.1|4933788_4934736_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000190117.1|4934857_4935544_+	SAM-dependent DNA methyltransferase	NA	A0A2K9V411	Faecalibacterium_phage	39.0	4.3e-29
WP_000058222.1|4935749_4936793_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_113705677.1|4936903_4938364_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_001352368.1|4938423_4939632_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000426916.1|4939853_4940324_+	Mov34/MPN/PAD-1 family protein	NA	NA	NA	NA	NA
WP_000356475.1|4940331_4941399_+	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_015675349.1|4942612_4943155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424170.1|4943161_4943554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000241216.1|4943733_4946982_+	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_000060048.1|4947106_4948621_+	UvrD-helicase domain-containing protein	NA	A0A1Q1N983	Escherichia_phage	30.4	4.0e-43
WP_000934713.1|4948613_4950179_+	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_000848049.1|4950236_4951229_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001188520.1|4951602_4952178_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068928.1|4952214_4953912_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883400.1|4953887_4954226_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961959.1|4954341_4955643_-	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000069437.1|4955760_4957197_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|4957533_4958010_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015852.1|4958025_4959282_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|4959557_4959851_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|4959894_4961541_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001460206.1|4961678_4962032_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_001008049.1|4962234_4963104_-	YjeJ family protein	NA	NA	NA	NA	NA
WP_000940523.1|4963498_4964527_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|4964568_4965135_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|4965186_4965312_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|4965422_4965569_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118483.1|4965744_4966062_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
4965838:4965852	attR	AGTGTTATTACTGTG	NA	NA	NA	NA
WP_001238379.1|4966055_4966592_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	3.6e-47
WP_001460207.1|4966680_4967814_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_000609663.1|4967876_4968236_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|4968246_4968642_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|4968652_4969387_-	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_001192973.1|4969379_4971188_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004770.1|4971512_4972490_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	1.2e-27
WP_001300174.1|4972708_4974211_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_001236847.1|4974361_4977685_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934920.1|4977706_4978675_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041964.1|4978771_4979824_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|4979918_4980464_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_010723271.1|4981206_4981260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294219.1|4981242_4982382_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001295189.1|4982380_4983928_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|4983899_4984361_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001122505.1|4985726_4987574_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|4987566_4988517_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|4988602_4988911_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|4988986_4990267_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|4990352_4991612_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|4991614_4992619_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 1
NC_017645	Escherichia coli UMNK88 plasmid pUMNK88, complete sequence	160573	108379	124791	160573	integrase,transposase	Salmonella_phage(37.5%)	15	114450:114509	117561:118267
WP_000427619.1|108379_109384_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|109462_112435_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|112437_112995_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000845048.1|113300_114314_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
114450:114509	attL	GTTAGACATCATGAGGGTAGCGGTGACCATCGAAATTTCGAACCAACTATCAGAGGTGCT	NA	NA	NA	NA
WP_024250748.1|114459_115218_+	AadA family aminoglycoside 3''-O-nucleotidyltransferase	NA	NA	NA	NA	NA
WP_032492013.1|115326_115572_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_011977801.1|115590_115929_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_012300772.1|116218_117478_+	chloramphenicol efflux MFS transporter CmlA5	NA	S4TR35	Salmonella_phage	31.7	1.7e-26
WP_001261740.1|117570_118362_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
117561:118267	attR	GTTAGACATCATGAGGGTAGCGGTGACCATCGAAATTTCGAACCAACTATCAGAGGTGCTAAGCGTCATTGAGCGCCATCTGGAATCAACGTTGCTGGCCGTGCATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCATACAGCGATATTGATTTGTTGGTTACTGTGGCCGTAAAGCTTGATGAAACGACGCGGCGAGCATTGCTCAATGACCTTATGGAGGCTTCGGCTTTCCCTGGCGAGAGCGAGACGCTCCGCGCTATAGAAGTCACCCTTGTCGTGCATGACGACATCATCCCGTGGCGTTATCCGGCTAAGCGCGAGCTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCGGGTATCTTCGAGCCAGCCATGATCGACATTGATCTAGCTATCCTGCTTACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCGGCAGCGGAGGAATTCTTTGACCCGGTTCCTGAACAGGATCTATTCGAGGCGCTGAGGGAAACCTTGAAGCTATGGAACTCGCAGCCCGACTGGGCCGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAATAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATAAAACGCCTACCTGCCCAGTATCAGCCCGTCTTACTTGAAGCTAAGCAAGCTTATCTGG	NA	NA	NA	NA
WP_000679427.1|118485_118833_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|118826_119666_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|119793_120294_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000983249.1|120828_121614_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	3.3e-33
WP_001324342.1|121600_123124_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000287615.1|123246_124791_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
>prophage 1
NC_017639	Escherichia coli UMNK88 plasmid pUMNK88_K88, complete sequence	81883	23093	29594	81883		Stx2-converting_phage(42.86%)	8	NA	NA
WP_001384897.1|23093_24191_-	choloylglycine hydrolase family protein	NA	A0A1J0F9I3	Only_Syngen_Nebraska_virus	29.6	1.1e-29
WP_001292878.1|24233_24452_-	hypothetical protein	NA	A0A2H4JB54	uncultured_Caudovirales_phage	46.9	6.9e-05
WP_042634625.1|24570_25410_+	(S)-acetoin forming diacetyl reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.7	2.0e-15
WP_001384894.1|25781_25943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993920.1|26015_26663_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	41.5	8.9e-16
WP_000624624.1|26662_26974_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	77.5	3.7e-44
WP_000422708.1|28827_29247_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	94.8	3.1e-46
WP_000624709.1|29243_29594_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	3.1e-39
>prophage 2
NC_017639	Escherichia coli UMNK88 plasmid pUMNK88_K88, complete sequence	81883	57364	62692	81883	integrase	Escherichia_phage(33.33%)	8	56364:56378	64044:64058
56364:56378	attL	CGGGAGCTGGATGCG	NA	NA	NA	NA
WP_071881846.1|57364_58087_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	8.6e-52
WP_000239529.1|58224_58500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633913.1|58493_59138_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_001103690.1|59366_60338_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
WP_000340829.1|60342_60735_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_000457520.1|60739_62011_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.2	5.4e-142
WP_000457136.1|62010_62388_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.2	6.1e-25
WP_000618111.1|62443_62692_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	49.3	1.1e-14
64044:64058	attR	CGGGAGCTGGATGCG	NA	NA	NA	NA
