The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015520	Mahella australiensis 50-1 BON, complete sequence	3135972	70309	84066	3135972	portal,tail	Bacillus_phage(44.44%)	17	NA	NA
WP_013779718.1|70309_72973_-|tail	phage tail tape measure protein	tail	A0A166XZ24	Gordonia_phage	47.0	5.6e-56
WP_013779719.1|73175_73547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779720.1|73555_74158_-	hypothetical protein	NA	A0A0A8WJ49	Clostridium_phage	28.4	1.7e-08
WP_171804948.1|74138_74306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779722.1|74310_74697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779723.1|74693_75026_-	hypothetical protein	NA	G1JWD8	Mycobacterium_phage	34.3	2.8e-10
WP_041643721.1|75025_75403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779725.1|75389_75761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779726.1|75781_76834_-	hypothetical protein	NA	A0A0N7ACJ3	Bacillus_phage	43.1	3.5e-70
WP_013779727.1|76849_77188_-	DUF2190 family protein	NA	A0A0A8WJN5	Clostridium_phage	43.6	1.3e-18
WP_013779728.1|77201_78653_-	hypothetical protein	NA	A0A0N7ACY8	Bacillus_phage	42.5	2.0e-63
WP_171804949.1|78712_78868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779730.1|78851_79157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779731.1|79125_79350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779732.1|79351_81154_-	hypothetical protein	NA	A0A0N7ACI5	Bacillus_phage	34.5	1.6e-43
WP_013779733.1|81134_82613_-|portal	phage portal protein	portal	A0A0N6W8H8	Bacillus_phage	38.8	7.3e-90
WP_013779734.1|82605_84066_-	hypothetical protein	NA	B6SBS6	Clostridium_virus	36.3	5.5e-74
>prophage 2
NC_015520	Mahella australiensis 50-1 BON, complete sequence	3135972	589173	627648	3135972	terminase,tail,integrase,plate,portal	Bacillus_phage(38.71%)	56	590146:590195	630435:630484
WP_041644277.1|589173_590079_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.4	4.7e-31
590146:590195	attL	CTGATTCGTAATCAGCAGGTCAAGGGTTCGAGTCCCTTCGAAAGCTCCAT	NA	NA	NA	NA
WP_013780176.1|590264_591389_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	39.5	3.2e-69
WP_013780177.1|591440_591866_-	ImmA/IrrE family metallo-endopeptidase	NA	Q0H245	Geobacillus_phage	38.1	9.0e-17
WP_013780178.1|591882_592248_-	helix-turn-helix transcriptional regulator	NA	I3VYZ1	Thermoanaerobacterium_phage	40.5	4.1e-10
WP_013780179.1|592479_592704_+	helix-turn-helix transcriptional regulator	NA	I3VYZ1	Thermoanaerobacterium_phage	44.1	7.5e-07
WP_013780180.1|592718_593399_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013780181.1|593411_593810_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013780182.1|593814_593988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013780183.1|594057_594303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013780184.1|594318_594570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013780186.1|594725_594944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013780187.1|594957_595512_+	host-nuclease inhibitor Gam family protein	NA	A0A2K9V2U0	Faecalibacterium_phage	32.5	9.9e-16
WP_013780188.1|595531_596275_+	hypothetical protein	NA	E5DV80	Deep-sea_thermophilic_phage	59.4	4.1e-49
WP_013780190.1|596478_596781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013780191.1|596785_597727_+	DnaD domain protein	NA	A0A193GZ86	Enterobacter_phage	30.4	6.0e-05
WP_013780192.1|597723_599061_+	AAA family ATPase	NA	A0A1B0VG30	Salmonella_phage	33.7	4.5e-46
WP_013780193.1|598999_599197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013780195.1|599299_599671_+	hypothetical protein	NA	A8AU00	Listeria_phage	42.0	5.4e-18
WP_013780196.1|599672_599876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013780197.1|599865_600015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013780198.1|600004_600289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013780199.1|600288_600483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171804955.1|600479_600656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013780200.1|600627_601074_+	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_013780202.1|601436_601949_+|terminase	terminase small subunit	terminase	A0A2K9V3C4	Faecalibacterium_phage	62.4	2.7e-36
WP_013780203.1|601941_603327_+	DEAD/DEAH box helicase family protein	NA	B6SBS6	Clostridium_virus	49.8	6.8e-122
WP_013780204.1|603319_604831_+|portal	phage portal protein	portal	A0A0N6W8H8	Bacillus_phage	55.9	4.7e-161
WP_013780205.1|604834_606514_+	hypothetical protein	NA	A0A0N7ACI5	Bacillus_phage	46.7	7.0e-81
WP_013780206.1|606514_606739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041643800.1|606716_608201_+	hypothetical protein	NA	A0A0N7ACY8	Bacillus_phage	48.5	1.5e-87
WP_013780208.1|608197_608383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013780209.1|608397_608781_+	DUF2190 family protein	NA	A0A0A8WJN5	Clostridium_phage	46.2	1.3e-19
WP_013780210.1|608800_609844_+	hypothetical protein	NA	A0A0N7ACJ3	Bacillus_phage	40.1	3.6e-67
WP_013780212.1|610021_610366_+	hypothetical protein	NA	A0A0N7ACH0	Bacillus_phage	54.9	6.5e-26
WP_013780213.1|610368_610749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171804996.1|610759_611077_+	hypothetical protein	NA	A0A0A8WFF6	Clostridium_phage	37.3	2.6e-13
WP_013780215.1|611079_611910_+	hypothetical protein	NA	A0A0N7ACG6	Bacillus_phage	40.7	8.3e-51
WP_013780216.1|611914_612142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013780217.1|612141_613593_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0N7AEC6	Bacillus_phage	40.5	7.6e-92
WP_013780218.1|613606_614026_+|tail	phage tail tube protein	tail	A0A2H4J032	uncultured_Caudovirales_phage	39.1	1.2e-18
WP_013780219.1|614029_614455_+	XkdN-like protein	NA	A0A2H4J883	uncultured_Caudovirales_phage	42.6	6.0e-21
WP_013780220.1|614472_614631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013780221.1|614620_617998_+	tape measure protein	NA	U5PX90	Bacillus_virus	32.4	6.7e-22
WP_013780222.1|618068_619346_+	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
WP_013780223.1|619416_620052_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0N7ACF7	Bacillus_phage	51.0	1.1e-47
WP_013780224.1|620048_621023_+	hypothetical protein	NA	A0A0N6W8H4	Bacillus_phage	38.9	2.0e-56
WP_013780225.1|621012_621348_+	hypothetical protein	NA	A0A2H4J746	uncultured_Caudovirales_phage	43.4	1.9e-17
WP_013780226.1|621349_621799_+	DUF2634 domain-containing protein	NA	A0A0N7ACH4	Bacillus_phage	45.8	4.8e-29
WP_013780227.1|621798_623367_+|plate	baseplate J/gp47 family protein	plate	A0A0N7ACK1	Bacillus_phage	36.1	2.3e-33
WP_013780228.1|623363_623933_+	YmfQ family protein	NA	A0A0A7RTU9	Clostridium_phage	34.4	4.7e-21
WP_013780229.1|623932_624994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013780230.1|624977_626144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013780231.1|626156_626489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013780232.1|626491_626626_+	XkdX family protein	NA	NA	NA	NA	NA
WP_013780233.1|626640_626877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013780234.1|626883_627648_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J1JCJ2	Escherichia_phage	27.3	2.4e-12
630435:630484	attR	CTGATTCGTAATCAGCAGGTCAAGGGTTCGAGTCCCTTCGAAAGCTCCAT	NA	NA	NA	NA
>prophage 3
NC_015520	Mahella australiensis 50-1 BON, complete sequence	3135972	966980	978054	3135972	tRNA	Bacillus_phage(14.29%)	11	NA	NA
WP_013780558.1|966980_969140_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	U5J9N6	Bacillus_phage	41.4	4.1e-17
WP_013780559.1|969136_969772_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_013780560.1|969800_969971_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013780561.1|970033_971296_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.6	5.2e-28
WP_013780562.1|971307_973095_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	26.5	2.0e-17
WP_013780563.1|973411_974131_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	A0A291ATS8	Pandoravirus	36.9	9.5e-27
WP_041644346.1|974236_974518_+	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_013780565.1|974527_974995_+	SoxR reducing system RseC family protein	NA	NA	NA	NA	NA
WP_013780566.1|974987_975317_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	42.7	6.3e-18
WP_013780567.1|975450_976704_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.1	1.4e-97
WP_013780568.1|976719_978054_+	AAA family ATPase	NA	G3MBE0	Bacillus_virus	51.2	1.2e-115
>prophage 4
NC_015520	Mahella australiensis 50-1 BON, complete sequence	3135972	1468617	1476065	3135972		Bacillus_phage(33.33%)	9	NA	NA
WP_013781012.1|1468617_1469568_+	AAA family ATPase	NA	G3MAX6	Bacillus_virus	44.4	1.2e-50
WP_041643931.1|1469564_1470158_+	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_013781014.1|1470290_1470794_+	DUF4829 domain-containing protein	NA	NA	NA	NA	NA
WP_013781015.1|1470949_1471573_-	transcriptional repressor LexA	NA	A0A1B1P7Q3	Bacillus_phage	52.9	1.2e-12
WP_013781016.1|1471766_1472051_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_041643934.1|1472057_1473038_-	tyrosine recombinase XerC	NA	A0A1B1P7C7	Bacillus_phage	31.9	1.1e-22
WP_013781018.1|1473058_1473487_-	ribonuclease HI	NA	A0A1P8DJF0	Virus_Rctr71	49.3	1.5e-32
WP_049783396.1|1473492_1474260_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	42.8	6.8e-39
WP_013781020.1|1474313_1476065_-	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	31.8	1.7e-08
>prophage 5
NC_015520	Mahella australiensis 50-1 BON, complete sequence	3135972	1716814	1729623	3135972		Synechococcus_phage(40.0%)	12	NA	NA
WP_013781240.1|1716814_1718359_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG3	Prochlorococcus_phage	52.1	5.7e-45
WP_013781241.1|1718656_1719280_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.5	4.7e-22
WP_013781242.1|1719276_1720284_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FC27	Synechococcus_phage	42.9	5.7e-70
WP_013781243.1|1720284_1721760_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.6	9.6e-58
WP_013781244.1|1721720_1723928_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.1e-161
WP_013781245.1|1723917_1724628_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_013781246.1|1724630_1724879_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	38.0	7.1e-06
WP_013781247.1|1724879_1725590_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	42.6	1.2e-42
WP_013781248.1|1725586_1726084_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	5.2e-24
WP_148258480.1|1726157_1727507_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	28.8	2.8e-32
WP_083809940.1|1727888_1728035_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_013781251.1|1728087_1729623_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.9	7.5e-21
>prophage 6
NC_015520	Mahella australiensis 50-1 BON, complete sequence	3135972	2597728	2603133	3135972		Bacillus_phage(33.33%)	8	NA	NA
WP_013782039.1|2597728_2598139_-	single-stranded DNA-binding protein	NA	E5DV85	Deep-sea_thermophilic_phage	54.3	1.4e-22
WP_013782040.1|2598267_2598789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013782041.1|2599123_2599792_-	helix-turn-helix domain-containing protein	NA	Q786F1	Bacillus_phage	42.4	2.6e-10
WP_041644662.1|2600045_2600264_+	helix-turn-helix domain-containing protein	NA	I3VYY8	Thermoanaerobacterium_phage	48.5	1.9e-07
WP_013782043.1|2600278_2601268_+	hypothetical protein	NA	A0A2P1JTY8	Anoxybacillus_phage	52.7	1.3e-31
WP_013782044.1|2601257_2601935_+	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	36.5	3.2e-24
WP_013782045.1|2601939_2602281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013782046.1|2602308_2603133_+	DUF5131 family protein	NA	G8EY42	Synechococcus_phage	33.2	5.6e-31
>prophage 7
NC_015520	Mahella australiensis 50-1 BON, complete sequence	3135972	2921400	3004391	3135972	terminase,tail,protease,capsid,holin,head,portal,transposase	Erysipelothrix_phage(73.81%)	85	NA	NA
WP_041644168.1|2921400_2922174_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013782309.1|2922675_2923776_-	DUF362 domain-containing protein	NA	NA	NA	NA	NA
WP_013782310.1|2923875_2924574_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013782311.1|2924710_2925460_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_013782312.1|2925546_2926767_-	MFS transporter	NA	NA	NA	NA	NA
WP_083809928.1|2927003_2927303_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	74.2	9.7e-18
WP_041644169.1|2927422_2927680_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_013782314.1|2928147_2928567_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_013782315.1|2928924_2929485_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041644172.1|2929796_2930102_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013782316.1|2930203_2931085_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_013782317.1|2931100_2932000_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_013782318.1|2932113_2933850_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_049783373.1|2933968_2935138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013782320.1|2935121_2936522_-	trimethylamine methyltransferase family protein	NA	NA	NA	NA	NA
WP_013782321.1|2936546_2937557_-	SIS domain-containing protein	NA	M1HHR4	Paramecium_bursaria_Chlorella_virus	28.6	3.0e-18
WP_013782322.1|2937577_2938855_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_013782323.1|2938857_2939994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013782324.1|2940009_2941200_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_041644175.1|2941459_2941969_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_013782325.1|2941986_2942370_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_013782326.1|2942426_2942915_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_041644743.1|2942914_2944177_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_013782328.1|2944178_2945750_-	citramalate synthase	NA	NA	NA	NA	NA
WP_013782329.1|2945770_2947285_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	29.0	6.1e-07
WP_013782330.1|2947303_2948305_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_013782331.1|2948372_2948864_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_013779793.1|2949297_2950635_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_148258505.1|2951144_2953211_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.1	5.3e-14
WP_013782333.1|2953764_2954181_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013782334.1|2954338_2955319_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	27.3	1.3e-05
WP_041644745.1|2955388_2956561_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_013782336.1|2956586_2957012_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_013782337.1|2957016_2957337_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_013782338.1|2957343_2957901_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_013782339.1|2958098_2958413_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013782340.1|2958505_2959519_+	permease	NA	NA	NA	NA	NA
WP_013782341.1|2959534_2960299_+	DUF2703 domain-containing protein	NA	NA	NA	NA	NA
WP_013782342.1|2960335_2960683_+	TM0996/MTH895 family glutaredoxin-like protein	NA	NA	NA	NA	NA
WP_003868548.1|2960838_2961324_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_004103231.1|2961481_2961946_-	signal peptidase II	NA	NA	NA	NA	NA
WP_013782343.1|2962032_2964393_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.4	5.2e-114
WP_005584884.1|2964406_2964781_-	winged helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	40.2	7.4e-15
WP_013782344.1|2965397_2966966_-	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	57.7	5.8e-170
WP_083809929.1|2966928_2967420_-	recombinase	NA	A0A2K5B2B3	Erysipelothrix_phage	40.9	1.2e-20
WP_013782346.1|2967383_2968952_-	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	52.9	2.4e-152
WP_013782347.1|2969013_2969232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013782348.1|2969285_2970290_-	N-acetylmuramoyl-L-alanine amidase	NA	H7BV89	unidentified_phage	66.0	1.0e-10
WP_004400092.1|2970286_2970706_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	69.1	4.6e-50
WP_013782349.1|2970792_2973261_-	glycosyl hydrolase	NA	A0A2K5B2A1	Erysipelothrix_phage	68.6	0.0e+00
WP_003868535.1|2973257_2973833_-	hypothetical protein	NA	A0A2K5B2A0	Erysipelothrix_phage	53.4	3.6e-53
WP_013782350.1|2974047_2976570_-|tail	phage tail protein	tail	A0A2K5B298	Erysipelothrix_phage	63.5	0.0e+00
WP_013782351.1|2976574_2977348_-|tail	phage tail family protein	tail	A0A2I4R672	Erysipelothrix_phage	51.2	7.2e-73
WP_013782352.1|2977361_2979548_-	hypothetical protein	NA	A0A2K5B297	Erysipelothrix_phage	41.2	1.1e-12
WP_003516030.1|2979763_2980147_-	hypothetical protein	NA	A0A2K5B295	Erysipelothrix_phage	68.8	8.9e-40
WP_013782353.1|2980146_2980746_-|tail	phage tail protein	tail	A0A2K5B294	Erysipelothrix_phage	74.2	6.8e-79
WP_013782354.1|2980751_2981096_-	hypothetical protein	NA	A0A2K5B293	Erysipelothrix_phage	55.0	5.7e-30
WP_003516027.1|2981092_2981524_-	HK97 gp10 family phage protein	NA	A0A2K5B292	Erysipelothrix_phage	62.9	4.2e-46
WP_013782355.1|2981538_2981874_-|head,tail	head-tail adaptor protein	head,tail	A0A2K5B291	Erysipelothrix_phage	57.8	1.0e-28
WP_013782356.1|2981876_2982185_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2K5B290	Erysipelothrix_phage	75.5	2.3e-38
WP_013297316.1|2982206_2983409_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	78.2	4.9e-177
WP_013782357.1|2983422_2984148_-|protease	Clp protease ClpP	protease	A0A2K5B288	Erysipelothrix_phage	64.1	1.1e-75
WP_013782358.1|2984086_2985409_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	75.2	1.4e-188
WP_013782359.1|2985405_2987058_-|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	77.2	1.7e-249
WP_004400074.1|2987112_2987307_-	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_013782360.1|2987310_2987778_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_013782361.1|2987839_2988739_-	amidoligase family protein	NA	A0A2K9V489	Faecalibacterium_phage	41.1	3.9e-54
WP_013782362.1|2988880_2989111_-	DUF4314 domain-containing protein	NA	NA	NA	NA	NA
WP_013782363.1|2989107_2989443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013782364.1|2989435_2990128_-	virulence factor	NA	A0A2K5B280	Erysipelothrix_phage	35.2	6.3e-28
WP_013782365.1|2990244_2991498_-	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	46.5	3.0e-100
WP_013782366.1|2991503_2992802_-	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	40.3	6.2e-77
WP_013782368.1|2992958_2993510_-|terminase	P27 family phage terminase small subunit	terminase	A0A2K5B277	Erysipelothrix_phage	67.0	7.7e-69
WP_013782369.1|2993610_2993988_-	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	66.4	1.6e-41
WP_013782370.1|2994116_2994566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013782371.1|2994562_2995918_-	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	70.8	2.8e-165
WP_013782372.1|2995898_2996180_-	VRR-NUC domain-containing protein	NA	D0R0B7	Streptococcus_phage	57.0	1.5e-23
WP_013782373.1|2996410_2998798_-	virulence-associated E family protein	NA	A0A1W6JQ82	Corynebacterium_phage	46.7	6.7e-210
WP_013782374.1|2998794_2999220_-	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	47.9	6.6e-36
WP_013782375.1|2999221_2999500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013782376.1|2999501_3000302_-	phage antirepressor KilAC domain-containing protein	NA	A0A0B5A507	Paenibacillus_phage	46.1	5.5e-60
WP_013782377.1|3000389_3002363_-	hypothetical protein	NA	A0A2K5B2B0	Erysipelothrix_phage	66.5	5.4e-258
WP_013782378.1|3002359_3002938_-	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	71.1	2.2e-66
WP_013782379.1|3002934_3004071_-	DUF2800 domain-containing protein	NA	A0A2K5B2A8	Erysipelothrix_phage	69.8	1.4e-146
WP_013782380.1|3004067_3004391_-	hypothetical protein	NA	A0A2K5B2A7	Erysipelothrix_phage	54.7	2.5e-19
>prophage 8
NC_015520	Mahella australiensis 50-1 BON, complete sequence	3135972	3059140	3092273	3135972	terminase,tail,protease,integrase,capsid,head,portal	Erysipelothrix_phage(17.39%)	48	3041257:3041301	3060355:3060399
3041257:3041301	attL	TGGAGCTGGCGAGCGGACTTGAACCGCTAACCTGCTGATTACAAA	NA	NA	NA	NA
WP_013782420.1|3059140_3060274_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	41.6	2.1e-60
WP_013782421.1|3060494_3060776_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
3060355:3060399	attR	TGGAGCTGGCGAGCGGACTTGAACCGCTAACCTGCTGATTACAAA	NA	NA	NA	NA
WP_013782422.1|3060905_3062012_+	DUF5009 domain-containing protein	NA	NA	NA	NA	NA
WP_013782423.1|3062063_3062834_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013782424.1|3062871_3063570_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_013782425.1|3063562_3063730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013782426.1|3063746_3064013_-	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	37.3	8.4e-05
WP_013782427.1|3064073_3064778_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	51.5	7.6e-45
WP_013782428.1|3064787_3065033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148258508.1|3065049_3067479_-	hypothetical protein	NA	A0A2K5B2A1	Erysipelothrix_phage	38.1	2.7e-158
WP_013782430.1|3067472_3068066_-	hypothetical protein	NA	A0A2K5B2A0	Erysipelothrix_phage	25.3	5.1e-10
WP_013782431.1|3068058_3068250_-	hypothetical protein	NA	W8ECV6	Geobacillus_phage	58.7	1.2e-08
WP_013782432.1|3068254_3069631_-|tail	phage tail protein	tail	W8EEW0	Geobacillus_phage	38.7	1.6e-83
WP_013782433.1|3069630_3070575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013782434.1|3070574_3071396_-|tail	phage tail family protein	tail	A0A2I4R672	Erysipelothrix_phage	26.1	8.9e-13
WP_013782435.1|3071392_3073561_-|tail	phage tail tape measure protein	tail	A0A068F1L4	Mycobacterium_phage	35.8	9.5e-54
WP_171804991.1|3073553_3073817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013782437.1|3073906_3074221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013782438.1|3074236_3074644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013782439.1|3074659_3075031_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_013782440.1|3075042_3075420_-	HK97 gp10 family phage protein	NA	A0A1W6JP15	Morganella_phage	30.1	2.8e-06
WP_013782441.1|3075419_3075740_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	45.3	1.0e-17
WP_013782442.1|3075739_3076321_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	51.4	6.3e-05
WP_013782443.1|3076323_3076509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013782444.1|3076556_3077759_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	57.7	1.3e-116
WP_013782445.1|3077763_3078729_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J6Z9	uncultured_Caudovirales_phage	44.0	2.5e-30
WP_013782446.1|3078803_3078995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171804992.1|3078963_3081327_-|portal	phage portal protein	portal	A0A142K630	Streptomyces_phage	39.6	1.8e-122
WP_013782448.1|3082980_3083457_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B0RXG3	Streptococcus_phage	49.1	5.9e-33
WP_013782449.1|3083548_3083899_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	44.4	4.6e-19
WP_041644187.1|3083957_3084383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013782451.1|3084693_3085107_-	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_013782452.1|3085107_3085296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013782453.1|3085292_3085640_-	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	29.4	4.0e-07
WP_013782454.1|3085664_3085910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013782455.1|3085881_3086112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148258509.1|3086111_3086462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013782457.1|3086476_3087163_-	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	33.2	8.8e-22
WP_013782458.1|3087181_3088078_-	replication protein	NA	A0A1W6JNY0	Morganella_phage	33.3	2.1e-07
WP_013782459.1|3088159_3089023_-	hypothetical protein	NA	E5DV80	Deep-sea_thermophilic_phage	35.1	2.1e-20
WP_013782460.1|3089096_3089306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013782461.1|3089302_3089524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013782462.1|3089527_3089911_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013782463.1|3089926_3090163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013782464.1|3090176_3090434_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013782465.1|3090599_3090983_+	helix-turn-helix transcriptional regulator	NA	A0A0A8WFG2	Clostridium_phage	45.5	2.6e-15
WP_013782466.1|3091026_3091386_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_013782467.1|3091382_3092273_+	ribonuclease H-like domain-containing protein	NA	A0A0A7RWA3	Clostridium_phage	39.4	2.4e-32
