The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015602	Lactobacillus kefiranofaciens ZW3, complete sequence	2113023	275280	353116	2113023	tRNA,protease,transposase	Bacillus_phage(15.38%)	57	NA	NA
WP_013853763.1|275280_276330_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.1	1.2e-33
WP_013853764.1|276333_278748_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_013853765.1|278822_279299_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_013853766.1|279353_280265_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_143000326.1|280416_280635_+	type II toxin-antitoxin system HicA family toxin	NA	K7PH44	Enterobacterial_phage	44.4	2.7e-09
WP_013853768.1|280667_280892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013853769.1|281126_282050_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_013853770.1|282148_284743_-	YfhO family protein	NA	NA	NA	NA	NA
WP_013853771.1|284831_286940_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_006351577.1|287015_287165_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_013853772.1|287218_287785_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_013853773.1|287818_288499_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_013853774.1|288498_288735_+	YqgQ family protein	NA	NA	NA	NA	NA
WP_013853775.1|288793_289195_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_025084208.1|289264_290185_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_013853777.1|290177_291428_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_013853778.1|291574_292912_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_013853779.1|293029_293917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013853780.1|294037_295051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081462963.1|295091_296378_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.4	7.3e-54
WP_013853782.1|296573_297779_-	acetate kinase	NA	NA	NA	NA	NA
WP_013853783.1|299283_299553_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_013853784.1|299552_299795_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_013853785.1|299934_301206_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	38.3	2.7e-64
WP_013853786.1|302117_303110_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	37.1	2.5e-49
WP_013853787.1|303207_304170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013853788.1|304153_306040_-	beta galactosidase jelly roll domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	33.5	8.1e-94
WP_013853789.1|306231_307260_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_013853790.1|307449_309363_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_013853791.1|309369_311376_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_013853792.1|311473_312637_+	galactokinase	NA	NA	NA	NA	NA
WP_013853793.1|312647_314111_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_013853794.1|314114_315101_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_013853795.1|315336_315945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013853796.1|316077_316917_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_013853797.1|319063_321265_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_013853798.1|322873_323485_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
WP_013853799.1|323493_324159_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	29.2	7.7e-23
WP_013853800.1|324167_325445_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_013853801.1|325494_326667_+	MFS transporter	NA	NA	NA	NA	NA
WP_013853803.1|327105_327813_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_013853804.1|327898_328639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013853805.1|328883_329249_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_013853808.1|331038_332598_+	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	31.5	5.2e-38
WP_013853810.1|332972_334553_-	SH3-like domain-containing protein	NA	NA	NA	NA	NA
WP_003626431.1|334701_335139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_176752298.1|335746_336976_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	55.1	4.9e-116
WP_041817200.1|337124_338189_-	BMP family protein	NA	A0A0A7DN02	Lactobacillus_phage	49.2	6.0e-78
WP_013853815.1|340948_341326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025084343.1|341927_342194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013853818.1|342195_342675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143445839.1|342965_343070_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_013853819.1|343464_344979_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	24.2	3.5e-23
WP_013853821.1|345950_348239_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_013853822.1|348254_349832_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	33.3	2.0e-24
WP_013853823.1|350085_351135_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	36.6	2.0e-49
WP_013853824.1|351937_353116_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_015602	Lactobacillus kefiranofaciens ZW3, complete sequence	2113023	717177	761607	2113023	integrase,tRNA,protease,transposase	Staphylococcus_phage(16.67%)	37	731252:731268	752942:752958
WP_081462963.1|717177_718464_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.4	7.3e-54
WP_013854150.1|718525_718756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013854153.1|720941_722348_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_013854154.1|722599_722953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013854155.1|723011_724220_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_013854156.1|724302_724860_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_013854157.1|724861_725695_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_013854158.1|726982_727597_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_013854159.1|727695_728328_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_013854160.1|728559_729552_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_013854161.1|729674_730127_-	Trp operon repressor	NA	NA	NA	NA	NA
731252:731268	attL	CCTTATTTAAAATAATA	NA	NA	NA	NA
WP_013854162.1|731628_733404_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	41.0	2.4e-79
WP_013854163.1|734828_735512_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_013854164.1|735571_736831_-	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_013854165.1|736844_738938_-	putative ornithine decarboxylase	NA	NA	NA	NA	NA
WP_013854166.1|739167_740625_+	APC family permease	NA	NA	NA	NA	NA
WP_013854167.1|740682_741168_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_013854168.1|741251_741626_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	34.5	1.2e-09
WP_013854169.1|741627_742017_-	CrcB family protein	NA	NA	NA	NA	NA
WP_013854170.1|742232_743054_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_013854171.1|743109_744012_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_013854172.1|744159_745575_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IB03	Erwinia_phage	25.2	5.8e-28
WP_013854173.1|745584_746109_-	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
WP_013854174.1|746117_747026_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	27.9	1.3e-17
WP_013854175.1|747018_748341_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_013854176.1|748421_750554_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.5	9.8e-96
WP_013854177.1|750627_751476_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	37.6	5.7e-31
WP_013854178.1|751533_752286_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	39.2	1.7e-26
WP_013854179.1|752282_753122_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
752942:752958	attR	CCTTATTTAAAATAATA	NA	NA	NA	NA
WP_013854180.1|753142_754741_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_013854181.1|754785_755016_-	YozE family protein	NA	NA	NA	NA	NA
WP_025084227.1|755018_755870_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	39.5	4.7e-17
WP_013854183.1|755978_756644_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_013854184.1|756677_757877_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	34.1	7.3e-48
WP_013854185.1|757968_758856_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	38.0	1.4e-51
WP_013854186.1|758884_760132_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_013854187.1|760329_761607_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.5	2.9e-10
>prophage 3
NC_015602	Lactobacillus kefiranofaciens ZW3, complete sequence	2113023	1177104	1216881	2113023	integrase,transposase	Lactobacillus_virus(14.29%)	37	1197824:1197883	1216899:1217839
WP_081462950.1|1177104_1178358_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	56.4	7.7e-117
WP_013854552.1|1179903_1180755_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013854553.1|1180863_1181553_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_013854554.1|1181717_1182266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013854555.1|1182392_1182863_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013854556.1|1183123_1184401_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.2	2.2e-10
WP_013854557.1|1184922_1185312_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_013854558.1|1185301_1185559_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013854559.1|1185921_1186818_-	MFS transporter	NA	NA	NA	NA	NA
WP_023061312.1|1186772_1187114_-	MFS transporter	NA	NA	NA	NA	NA
WP_025084327.1|1187116_1187551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013854560.1|1187554_1188664_-	beta-ketoacyl synthase	NA	NA	NA	NA	NA
WP_013854561.1|1188678_1188840_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_013854562.1|1190761_1191886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013854563.1|1191946_1197448_-	DEAD/DEAH box helicase family protein	NA	A0A248SL14	Klebsiella_phage	30.7	4.5e-201
1197824:1197883	attL	ACGCGTGGTGCTAGTTAAATCGTTTTAGTTAATATAGACTCAAGTTGTAGTATCAAAAAG	NA	NA	NA	NA
WP_013854565.1|1197900_1198752_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_013854566.1|1198861_1200106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013854567.1|1200425_1201130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025084306.1|1201223_1201838_-	hypothetical protein	NA	A0A0E3XCL7	Enterococcus_phage	66.7	7.3e-20
WP_025084305.1|1201869_1202145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013854569.1|1202162_1202807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013854571.1|1203915_1204542_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7Y2	Bacillus_phage	31.9	4.7e-14
WP_005726889.1|1204897_1205275_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_013854572.1|1205307_1205520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013854573.1|1205789_1206284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013851233.1|1206569_1208117_-	hypothetical protein	NA	A0A0H3UZB6	Geobacillus_virus	23.6	5.2e-06
WP_013851234.1|1208275_1208788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013851235.1|1209079_1209457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013851236.1|1209487_1210141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013851237.1|1210151_1210742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049775987.1|1211078_1211387_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013854575.1|1211386_1211755_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_013854576.1|1211866_1213030_-	DNA polymerase III subunit beta	NA	NA	NA	NA	NA
WP_005730021.1|1213343_1213694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013854577.1|1213895_1214945_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.6	5.4e-47
WP_013854578.1|1215044_1215722_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013854565.1|1216029_1216881_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
1216899:1217839	attR	CTTTTTGATACTACAACTTGAGTCTATATTAACTAAAACGATTTAACTAGCACCACGCGTAAATATATTATATAACTGAAACATTTGATTGCAGTATTTAAAAATTTGCTTAGCCAGCGATTTTTCTGATACGTTTTGCGACACAGTCTTGAAAAAATTTCTTCTTATGTGTGTCTAGCAACCAACCAAAGTGGCTTCGGACAATTGTAGATAAGCACCCCACATGTCGCAAGCAGGTAGCCGGGAGCCCAGGGCAACCTGACCACTACGGTGCGGGTCATGATGATACAAGGTAATGCCATAATCATCATGCTTGCCAAAAAGAAAGATCTAATAATAAGTCTTAGCTGTTTTGCTTTCTAAGACGGTATAGTAATTTCATCGGCATGCAGGATTGGTTGCTTTAATGATTGTGTTGCTCAAGTTCGTTTGACTACAATGTTGGCATTTGTAGGCATGCTGGATATGGTCTAGCCGTTTTATTTGTGCTGAAATTAAGAGCAACTCTTGACGAAGCGAATAGCTGCCGATTTCCGTAAGTTCATTATGACAGTCAGGGCAATGTTTATCGCCTAATTCATGATGAACTTCTTCTGCTGGAAAAGCGTCCAGTAGATCAGCCCGATTTCTTTGATGAGCTCTTTATTTATAAGTAATAGTCTGAACGGCGGCGTCGGGGACGCTCTTCGTCATCTGCTTGTTCTTTGGACTCATCGAATAAGCTGGTTGGGCCAGCTATTGGAATTTGTTTGGAAGACTACTTGCTGTAACGCTTTTGCGTTAGGTAGGCTACTTGTTCACGGAGGAGTTTGATTTCATCGGTTAGGTTTTGGATAGTCGTAACTTGTTGGGCAATGATGAGCTGAATGTATTTTTGACGAGATAACTTATTTCTGTAATGAATAGTTCCCAATATTGGGGATGCACCTTTTGTATCGAGA	NA	NA	NA	NA
>prophage 4
NC_015602	Lactobacillus kefiranofaciens ZW3, complete sequence	2113023	1245762	1255061	2113023	protease,transposase	Enterobacteria_phage(16.67%)	9	NA	NA
WP_013854593.1|1245762_1247667_-	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	33.0	5.5e-82
WP_013854594.1|1247677_1247923_-	helix-turn-helix transcriptional regulator	NA	A0A2K5B263	Erysipelothrix_phage	58.0	2.2e-15
WP_034536270.1|1247903_1248302_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_074484248.1|1249100_1249397_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003674720.1|1249948_1250395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013854598.1|1250603_1250804_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	73.0	4.8e-21
WP_013854599.1|1250898_1252230_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.9	9.3e-52
WP_013854600.1|1252325_1253249_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.7	2.6e-29
WP_013854601.1|1253690_1255061_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	47.8	7.9e-115
>prophage 5
NC_015602	Lactobacillus kefiranofaciens ZW3, complete sequence	2113023	1401048	1458189	2113023	protease,transposase	Planktothrix_phage(22.22%)	50	NA	NA
WP_013854718.1|1401048_1401729_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_013854719.1|1401792_1402443_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_013854720.1|1402482_1404285_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_013854721.1|1404295_1405045_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.9	2.2e-34
WP_013854722.1|1405194_1406460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013854723.1|1406548_1407229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013854725.1|1410326_1410719_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_013854726.1|1410855_1410993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013854727.1|1411093_1412089_-	asparaginase	NA	NA	NA	NA	NA
WP_013854729.1|1416016_1416508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013854730.1|1416547_1417111_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013854731.1|1417486_1419013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074484251.1|1419976_1420468_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013851264.1|1420640_1421249_+|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	42.6	1.2e-33
WP_013851263.1|1421278_1422604_+	IS200/IS605 family accessory protein TnpB-related protein	NA	G3MB42	Bacillus_virus	36.0	8.1e-56
WP_013854735.1|1424019_1425360_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013854736.1|1425466_1426684_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_013854737.1|1426932_1428111_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_074484277.1|1428198_1428480_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013854739.1|1428605_1429466_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013854740.1|1429477_1430218_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.4	2.9e-31
WP_013854741.1|1430227_1430902_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003615004.1|1430882_1431542_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_013854742.1|1431916_1432324_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013854743.1|1432334_1432703_+	DUF2255 family protein	NA	NA	NA	NA	NA
WP_013854744.1|1432713_1433322_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_013854745.1|1433296_1433902_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_013853732.1|1436406_1437057_-|transposase	IS607-like element ISLhe9 family transposase	transposase	A0A7Q0	Microcystis_virus	45.2	6.8e-40
WP_013854747.1|1437209_1437440_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_013854748.1|1437514_1438693_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_013854750.1|1439241_1440333_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_013854751.1|1440340_1441156_-	LicD family protein	NA	NA	NA	NA	NA
WP_013854752.1|1441179_1442643_-	flippase	NA	NA	NA	NA	NA
WP_013854753.1|1442639_1443641_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	35.1	1.3e-10
WP_013854754.1|1443630_1444596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013854755.1|1444592_1445756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148234238.1|1445752_1446289_-	acyltransferase	NA	NA	NA	NA	NA
WP_013854757.1|1446493_1446805_-	acyltransferase	NA	NA	NA	NA	NA
WP_013854758.1|1447020_1448046_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_013854759.1|1448063_1448561_-	multidrug MFS transporter	NA	NA	NA	NA	NA
WP_013854760.1|1448560_1449010_-	UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_013854761.1|1449024_1449675_-	sugar transferase	NA	NA	NA	NA	NA
WP_013854762.1|1449794_1450565_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_013854763.1|1450565_1451351_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_013854764.1|1451361_1452249_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_013854765.1|1452260_1453316_-	LCP family protein	NA	A0A1X9I5X1	Streptococcus_phage	30.2	2.5e-15
WP_013854766.1|1453658_1454924_+	GTPase HflX	NA	NA	NA	NA	NA
WP_025084270.1|1454947_1455955_+	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_013851263.1|1456225_1457551_-	IS200/IS605 family accessory protein TnpB-related protein	NA	G3MB42	Bacillus_virus	36.0	8.1e-56
WP_013851264.1|1457580_1458189_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	42.6	1.2e-33
>prophage 6
NC_015602	Lactobacillus kefiranofaciens ZW3, complete sequence	2113023	1701865	1712162	2113023		Tetraselmis_virus(16.67%)	9	NA	NA
WP_003627031.1|1701865_1702354_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.1	4.8e-22
WP_013854990.1|1702346_1703483_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_013854991.1|1703679_1704396_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SPE1	Cyanophage	38.7	2.8e-39
WP_003627027.1|1704395_1704647_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_013854992.1|1704646_1705318_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_013854993.1|1705314_1707546_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	38.7	1.6e-141
WP_013854994.1|1707521_1708955_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.9	1.8e-61
WP_013854995.1|1708980_1710030_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F0L1	Synechococcus_phage	43.6	1.6e-62
WP_013854996.1|1710026_1712162_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.0	2.1e-74
>prophage 7
NC_015602	Lactobacillus kefiranofaciens ZW3, complete sequence	2113023	1841977	1874676	2113023	protease,transposase	Lactobacillus_virus(22.22%)	36	NA	NA
WP_013855101.1|1841977_1843240_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	38.0	2.2e-63
WP_013855102.1|1843419_1843614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013855103.1|1843610_1843982_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_013855104.1|1844202_1844814_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_013855105.1|1844810_1845698_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_013855106.1|1845707_1846592_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_013855107.1|1846597_1847251_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_013855108.1|1847254_1848604_-	ABC transporter ATP-binding protein	NA	A0A1V0SI78	Klosneuvirus	21.7	4.7e-11
WP_013855109.1|1848763_1849705_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013855110.1|1849733_1850630_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_013855111.1|1850641_1851202_-	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	30.2	1.1e-11
WP_013855112.1|1851304_1852411_-	cation transporter	NA	NA	NA	NA	NA
WP_013855113.1|1852597_1852999_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_013855114.1|1853077_1854868_+	glycerophosphoryl diester phosphodiesterase membrane domain-containing protein	NA	NA	NA	NA	NA
WP_003548644.1|1854938_1855079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013855115.1|1855233_1855878_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_143000324.1|1855878_1856799_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_013855117.1|1856958_1857714_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	1.0e-26
WP_013855118.1|1857713_1859327_-	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_013855119.1|1859659_1860292_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_013855120.1|1860360_1860720_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_013855121.1|1860772_1861558_-	TerC family protein	NA	A0A068EP98	Bacillus_phage	44.5	2.2e-40
WP_013855122.1|1861544_1862063_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	37.6	1.1e-13
WP_013855123.1|1862106_1862808_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_013855124.1|1862893_1863373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013855125.1|1863367_1864825_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_013855126.1|1865869_1866649_+	viroplasmin family protein	NA	C1KFJ1	Lactobacillus_virus	34.0	1.3e-29
WP_013855127.1|1866692_1867649_-	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_013855128.1|1867804_1868620_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_013855129.1|1868632_1869289_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013855130.1|1869767_1870625_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_013855131.1|1870939_1871437_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013855132.1|1871688_1872327_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_013855133.1|1872328_1872748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013851363.1|1872783_1873248_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	47.7	9.1e-31
WP_013855134.1|1873347_1874676_+|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	37.5	1.2e-59
>prophage 8
NC_015602	Lactobacillus kefiranofaciens ZW3, complete sequence	2113023	1915444	1965621	2113023	bacteriocin,holin,transposase	unidentified_phage(25.0%)	44	NA	NA
WP_004561985.1|1915444_1916434_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	40.5	9.9e-59
WP_013855174.1|1916394_1916967_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	25.6	8.1e-05
WP_013855175.1|1917061_1917205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013439000.1|1917216_1917468_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003596522.1|1918053_1918239_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_143000358.1|1918925_1919684_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_013855177.1|1919652_1919883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143000359.1|1920010_1920082_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_013855178.1|1921708_1922536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013855179.1|1922908_1923283_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_013855181.1|1926966_1928010_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_013855182.1|1928006_1929236_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_025084304.1|1929239_1929530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034536635.1|1929513_1930446_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_025084303.1|1932913_1933600_+	Type 1 glutamine amidotransferase-like domain-containing protein	NA	NA	NA	NA	NA
WP_013855188.1|1933797_1934385_+	recombinase family protein	NA	M4QQC6	Vibrio_phage	42.4	5.9e-19
WP_002831196.1|1934892_1935141_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_013855189.1|1935356_1936286_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	33.7	8.8e-25
WP_013855190.1|1937091_1937352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013855191.1|1937926_1938154_-	helix-turn-helix domain-containing protein	NA	Q5ULQ4	Lactobacillus_virus	52.9	4.9e-14
WP_013855194.1|1941813_1942821_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A160DHK0	Gordonia_phage	54.0	9.3e-97
WP_005720082.1|1942801_1943227_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	J9PTY0	Bacillus_phage	38.3	1.1e-11
WP_013855195.1|1943219_1945388_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0D3MSW9	Lactococcus_phage	47.3	5.5e-171
WP_013855196.1|1945452_1945722_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_013855199.1|1946279_1947227_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_013855200.1|1947322_1948624_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	52.0	1.5e-115
WP_003625233.1|1949133_1949580_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_013855202.1|1949609_1950077_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013855203.1|1950073_1951057_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_013855204.1|1951115_1951358_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_013855205.1|1951367_1952285_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_013855206.1|1952284_1953016_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.0	1.6e-13
WP_013855207.1|1953037_1954267_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_013855208.1|1954270_1954741_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_013855209.1|1954745_1955162_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_013855210.1|1955175_1956555_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_013855211.1|1956535_1957378_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_013855212.1|1957370_1958141_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_013855213.1|1958392_1959151_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_003630368.1|1959198_1960188_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_148234236.1|1960969_1961542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013855218.1|1962451_1963291_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_013855219.1|1963287_1964475_-	MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	22.1	4.4e-05
WP_013855189.1|1964691_1965621_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	33.7	8.8e-25
