The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017168	Yersinia pestis A1122, complete sequence	4553770	15090	90916	4553770	transposase,tRNA,plate,protease	Escherichia_phage(20.0%)	54	NA	NA
WP_002215902.1|15090_15741_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002215900.1|16191_16587_+	lipoprotein	NA	NA	NA	NA	NA
WP_002211662.1|18862_19363_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002215896.1|19405_20950_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211664.1|20961_22314_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210015.1|22310_22997_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_014465985.1|22996_24733_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210014.1|24736_25228_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002210013.1|25645_28294_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.5	4.8e-92
WP_002210012.1|28290_30639_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.3	3.1e-18
WP_002210011.1|30653_32876_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_016590715.1|33019_33367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002216110.1|33530_33725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210010.1|34949_35585_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002210009.1|35600_37898_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002210008.1|37884_38652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086016632.1|38747_39444_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.5	1.3e-60
WP_002210005.1|40052_40688_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002210002.1|42016_44179_+	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_002210001.1|44734_45694_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002210000.1|45739_47239_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	5.2e-19
WP_002209999.1|47271_48255_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002209998.1|48337_50371_-	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	4.5e-05
WP_002209997.1|50474_51575_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002209995.1|51874_52951_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_002209994.1|53133_53406_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_002228057.1|53583_54699_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002209991.1|55036_55756_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_002209990.1|55755_56082_+	YggL family protein	NA	NA	NA	NA	NA
WP_002209989.1|56192_57119_+	glutaminase B	NA	NA	NA	NA	NA
WP_002224905.1|58462_67795_+	phage minor structural protein	NA	NA	NA	NA	NA
WP_002209987.1|67984_69115_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_002215614.1|69107_69701_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_002215612.1|69800_70091_-	YggU family protein	NA	NA	NA	NA	NA
WP_002209984.1|70087_70642_-	YggT family protein	NA	NA	NA	NA	NA
WP_002209983.1|70929_71751_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_002215609.1|71883_72582_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_002209981.1|72601_73726_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_002209980.1|73834_74950_-	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	50.7	3.0e-96
WP_002209979.1|74953_75838_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	51.0	3.1e-80
WP_002209978.1|76017_76440_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002209977.1|76439_77003_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_002209976.1|77118_78078_-	glutathione synthase	NA	NA	NA	NA	NA
WP_002209975.1|78103_78835_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_002209973.1|79086_79794_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_002228059.1|79891_80404_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_002209971.1|80596_81751_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.1	1.7e-126
WP_002209969.1|82957_84937_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_002209968.1|85096_85417_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_071525520.1|85450_85561_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002209967.1|85706_86459_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_002209965.1|86949_88944_+	transketolase	NA	NA	NA	NA	NA
WP_002213759.1|89251_89710_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	9.4e-12
WP_000255944.1|89893_90916_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 2
NC_017168	Yersinia pestis A1122, complete sequence	4553770	244969	262478	4553770	transposase	Tupanvirus(50.0%)	7	NA	NA
WP_002211384.1|244969_245764_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	62.9	8.9e-119
WP_099156340.1|246104_246401_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_000255944.1|246482_247505_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|247504_248284_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211387.1|248491_254950_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.0	8.5e-42
WP_002214915.1|254957_256646_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.0	3.1e-36
WP_002211388.1|256658_262478_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	31.3	1.3e-41
>prophage 3
NC_017168	Yersinia pestis A1122, complete sequence	4553770	475223	531825	4553770	transposase,holin	Clostridium_phage(33.33%)	53	NA	NA
WP_002213775.1|475223_475682_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_002210407.1|475799_476330_-	YgjV family protein	NA	NA	NA	NA	NA
WP_002210408.1|476482_477973_-	altronate dehydratase	NA	NA	NA	NA	NA
WP_002210409.1|477983_479435_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_002210410.1|479633_481043_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_002353699.1|481790_483092_+	MFS transporter	NA	NA	NA	NA	NA
WP_002210412.1|483354_484149_+	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_002218957.1|484397_484931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210414.1|485208_485907_+	DedA family protein	NA	NA	NA	NA	NA
WP_002210415.1|485903_486293_+	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_002210416.1|486518_486899_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_002210418.1|487053_487359_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_002210419.1|487361_487757_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_002210420.1|487753_488038_+	YqjK-like family protein	NA	NA	NA	NA	NA
WP_002210421.1|488341_488737_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000255944.1|489015_490038_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|490037_490817_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210424.1|491078_491465_-	8-oxo-dGTP diphosphatase MutT	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	30.4	8.4e-06
WP_002210426.1|491759_494474_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_002210427.1|494551_495085_-	secA regulator SecM	NA	NA	NA	NA	NA
WP_002210428.1|495113_495638_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_002228285.1|495804_496725_-	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_002210430.1|496824_497976_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_002210431.1|498048_499305_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_002228100.1|499331_500159_-	cell division protein FtsQ	NA	NA	NA	NA	NA
WP_002210432.1|500160_501081_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002216457.1|501073_502549_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_002210434.1|502686_503757_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_002210435.1|503753_504956_-	cell division protein FtsW	NA	NA	NA	NA	NA
WP_002210436.1|504955_506272_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_002210437.1|506274_507357_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_002210438.1|507350_508727_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_002210439.1|508723_510211_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_002210440.1|510197_511961_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_002210441.1|512026_512344_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_002210442.1|512340_513303_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_002210443.1|513305_513764_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_087768171.1|514318_514408_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002210446.1|514865_515306_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_002210447.1|515436_516447_-	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_002213759.1|516951_517410_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	9.4e-12
WP_002424260.1|517608_518133_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_002228103.1|518105_519833_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.4	7.8e-59
WP_002216437.1|520292_522098_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	3.5e-38
WP_002216434.1|522634_523591_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_002210452.1|524268_524484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213775.1|524912_525371_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_002210453.1|525517_527080_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002210454.1|527082_528174_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_002210455.1|528175_529606_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_002210456.1|529620_530223_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_002397472.1|530463_530715_-	sugar transporter	NA	NA	NA	NA	NA
WP_000255944.1|530802_531825_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 4
NC_017168	Yersinia pestis A1122, complete sequence	4553770	552648	599120	4553770	transposase,tRNA,plate	Clostridium_phage(28.57%)	38	NA	NA
WP_002210470.1|552648_554004_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210471.1|554123_554615_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002214737.1|554607_554973_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_002210473.1|554978_555596_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_002214739.1|555588_556692_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002210474.1|558949_561298_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	2.1e-14
WP_002210475.1|561401_563990_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	28.7	1.9e-77
WP_002210476.1|564007_564991_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002210477.1|564983_566828_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002210478.1|566860_567304_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002210479.1|567377_567896_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002210480.1|568058_569561_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002210481.1|569569_570130_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002210482.1|570140_571154_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002214747.1|571483_572227_+	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_002210485.1|573449_574070_+|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_002210486.1|574367_575201_-	co-chaperone DjlA	NA	NA	NA	NA	NA
WP_002228111.1|575385_577728_+	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_002210488.1|577795_579100_+	peptidylprolyl isomerase SurA	NA	NA	NA	NA	NA
WP_002210489.1|579083_580079_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_002210490.1|580071_580890_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_002210491.1|580903_581281_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_002210492.1|581297_582167_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH	NA	NA	NA	NA	NA
WP_002210493.1|582256_582721_-	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_071525509.1|582847_583162_-	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_002213775.1|583603_584062_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_002210497.1|584273_584756_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	42.6	4.7e-30
WP_002210498.1|584905_585361_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_002210499.1|585357_586158_-	threonine/serine exporter ThrE family protein	NA	NA	NA	NA	NA
WP_002210501.1|586481_587096_+	LysE family translocator	NA	NA	NA	NA	NA
WP_002210502.1|587323_590557_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_002224759.1|590572_591748_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.3	6.9e-51
WP_002210504.1|592220_593042_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_002213775.1|593494_593953_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_002210506.1|594334_595288_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_002228112.1|595268_595727_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_002210508.1|595794_596304_-	signal peptidase II	NA	NA	NA	NA	NA
WP_002210509.1|596303_599120_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.1	1.0e-63
>prophage 5
NC_017168	Yersinia pestis A1122, complete sequence	4553770	974787	1020345	4553770	transposase,protease	Escherichia_phage(28.57%)	38	NA	NA
WP_002216348.1|974787_975624_+|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
WP_002208930.1|975658_976417_+	DeoR/GlpR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100067904.1|976609_977963_+|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
WP_002208933.1|978149_979034_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_002208934.1|979266_981702_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_002208935.1|983241_983559_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_002208936.1|983907_984363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002216737.1|984905_985121_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002208938.1|985363_987562_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_002216730.1|987914_988943_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_002208941.1|989008_989854_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_002208942.1|989953_990478_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_002208943.1|990548_991880_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.8	1.2e-43
WP_002208944.1|992115_993033_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_002208945.1|993174_993660_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_002228141.1|993776_994361_-	DUF4232 domain-containing protein	NA	NA	NA	NA	NA
WP_002215873.1|994990_995230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208949.1|995442_996735_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000255944.1|997646_998669_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|998668_999448_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002213759.1|1001179_1001638_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	9.4e-12
WP_002208953.1|1001845_1002085_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_002208954.1|1002712_1003561_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.5	3.2e-13
WP_029812010.1|1003769_1005260_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_002223912.1|1005496_1006507_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_002208956.1|1006661_1007408_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_002208957.1|1007748_1008183_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_002215864.1|1008330_1008966_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_002208959.1|1009094_1009862_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_002208960.1|1010093_1011329_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208961.1|1011465_1012203_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_002208962.1|1012199_1012913_+	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_002208963.1|1012978_1014406_+	anion permease	NA	NA	NA	NA	NA
WP_002218867.1|1014523_1015300_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002208965.1|1015549_1016539_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002208966.1|1016759_1017743_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_002208967.1|1017960_1018863_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_002353252.1|1019424_1020345_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	8.6e-73
>prophage 6
NC_017168	Yersinia pestis A1122, complete sequence	4553770	1548020	1626938	4553770	transposase,plate	Escherichia_phage(15.38%)	54	NA	NA
WP_000255944.1|1548020_1549043_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|1549042_1549822_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210669.1|1550878_1552063_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.9	2.0e-13
WP_002210670.1|1552313_1552697_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002210671.1|1552698_1553244_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.3	5.9e-13
WP_002210672.1|1553434_1553863_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002210673.1|1553866_1554571_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002210674.1|1554935_1555433_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002210675.1|1555499_1555868_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002210676.1|1556210_1560239_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	1.2e-22
WP_002210677.1|1560367_1564588_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.0	8.5e-67
WP_002213775.1|1564714_1565173_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_002210678.1|1565604_1566735_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_002217273.1|1566727_1567543_-	thiazole synthase	NA	NA	NA	NA	NA
WP_002217275.1|1567544_1567760_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_002210680.1|1567756_1568554_-	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	27.8	1.6e-11
WP_002210681.1|1568543_1569218_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_002210682.1|1569204_1571250_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_002210683.1|1571625_1572135_-	sigma D regulator	NA	NA	NA	NA	NA
WP_002210684.1|1572231_1573014_+	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_002210685.1|1573106_1573892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210686.1|1574010_1575078_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_002210687.1|1575107_1575848_+	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_002210688.1|1575893_1576484_+	YjaG family protein	NA	NA	NA	NA	NA
WP_002210689.1|1576672_1576948_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	55.6	3.6e-19
WP_002355296.1|1576997_1577651_+	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_002210691.1|1577798_1579085_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002210692.1|1579144_1580734_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.4	2.2e-68
WP_002218887.1|1581201_1581387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212076.1|1587330_1588260_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_002212077.1|1588680_1590279_+	malate synthase A	NA	NA	NA	NA	NA
WP_002212078.1|1590325_1591633_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_002212079.1|1591888_1593616_+	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_002212080.1|1594794_1598490_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	82.5	4.6e-24
WP_002212081.1|1598585_1603493_-	hemagglutinin repeat-containing protein	NA	NA	NA	NA	NA
WP_002228189.1|1603562_1605248_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_002212084.1|1605815_1607201_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_002212085.1|1607570_1609217_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002212086.1|1609351_1609759_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_002212087.1|1609901_1610792_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_002212088.1|1610805_1612383_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_002212089.1|1612569_1613781_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_002221973.1|1614342_1614579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002212091.1|1614582_1615692_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	G9BWD6	Planktothrix_phage	35.5	5.0e-27
WP_002212092.1|1615762_1617034_+	maltoporin	NA	NA	NA	NA	NA
WP_002212093.1|1617274_1618186_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_002212095.1|1618656_1618935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002212097.1|1619086_1619605_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002212098.1|1620128_1620626_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002212099.1|1620693_1622175_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002212100.1|1622181_1622622_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_100067904.1|1623737_1625092_-|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
WP_002228704.1|1625142_1625886_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002213885.1|1625849_1626938_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 7
NC_017168	Yersinia pestis A1122, complete sequence	4553770	1721152	1780827	4553770	holin,transposase,protease	Escherichia_phage(15.38%)	51	NA	NA
WP_002210082.1|1721152_1722598_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002210083.1|1722800_1725659_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210084.1|1725683_1728515_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210086.1|1728715_1729075_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_002210087.1|1729071_1729473_-	M15 family metallopeptidase	NA	A0A249XWK9	Proteus_phage	61.0	3.6e-36
WP_002214300.1|1729485_1729788_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_002210089.1|1729921_1734412_-	toxin	NA	NA	NA	NA	NA
WP_002229661.1|1734468_1736610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002229660.1|1736678_1738061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210090.1|1738101_1740603_-	toxin	NA	NA	NA	NA	NA
WP_002214297.1|1740838_1741705_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210092.1|1741965_1742877_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002210093.1|1743179_1743383_+	AaeX family protein	NA	NA	NA	NA	NA
WP_002210094.1|1743390_1744326_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002210095.1|1744327_1746283_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002214288.1|1748212_1748686_+	ribonuclease Ba	NA	NA	NA	NA	NA
WP_002210098.1|1748690_1748972_+	ribonuclease inhibitor	NA	NA	NA	NA	NA
WP_002210099.1|1749083_1749632_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_002210100.1|1749812_1751153_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011055205.1|1751401_1752046_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	3.4e-52
WP_002210102.1|1752253_1752640_+	cytochrome b562	NA	NA	NA	NA	NA
WP_002210103.1|1752863_1753274_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_002210104.1|1753626_1755294_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_002215779.1|1755388_1756804_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002210106.1|1757214_1758168_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_002210107.1|1758401_1758878_-	PliI family lysozyme inhibitor of I-type lysozyme	NA	NA	NA	NA	NA
WP_001297096.1|1758993_1759773_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|1759772_1760795_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002210109.1|1761135_1761522_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002210110.1|1761659_1762124_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002210111.1|1762135_1763071_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.5	1.5e-48
WP_002210112.1|1763408_1763681_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002210113.1|1763677_1764532_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002213952.1|1764837_1765320_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002210115.1|1765748_1767182_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002210116.1|1767243_1767969_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_002210117.1|1767975_1768521_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002218352.1|1768504_1769068_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002228203.1|1769064_1769628_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_002210119.1|1769876_1770863_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_002210120.1|1770973_1771948_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210121.1|1772212_1773031_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
WP_002210122.1|1773248_1774031_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_002210123.1|1774035_1774593_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002210124.1|1774605_1775229_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_002210125.1|1775264_1775567_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_002210126.1|1775713_1775968_+	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_002210127.1|1776121_1777384_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002210128.1|1777564_1778653_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
WP_002213775.1|1778878_1779337_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_002218066.1|1779453_1780827_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
>prophage 8
NC_017168	Yersinia pestis A1122, complete sequence	4553770	2044626	2099186	4553770	transposase,tRNA	Escherichia_phage(47.37%)	48	NA	NA
WP_002213775.1|2044626_2045085_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_002216011.1|2045335_2046340_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002209424.1|2046500_2047310_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002209426.1|2048012_2048708_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_002209427.1|2049170_2051621_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	1.2e-219
WP_002209428.1|2051632_2052250_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	1.8e-74
WP_002209429.1|2052251_2053112_+	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	33.7	7.6e-23
WP_002209430.1|2053257_2053968_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.5	4.8e-23
WP_002215100.1|2054224_2054755_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	42.1	1.6e-15
WP_002215101.1|2054902_2055286_-	cytochrome b562	NA	NA	NA	NA	NA
WP_002209433.1|2055362_2057576_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_002209434.1|2058111_2059053_+	D-ribose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002209435.1|2059145_2059763_+	DUF2291 family protein	NA	NA	NA	NA	NA
WP_002209436.1|2059762_2061286_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.0	9.1e-19
WP_002209437.1|2061282_2062428_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002209438.1|2062683_2063514_+	transketolase	NA	NA	NA	NA	NA
WP_002209439.1|2063506_2064451_+	transketolase family protein	NA	NA	NA	NA	NA
WP_002209440.1|2064453_2065941_+	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_002209441.1|2065961_2067386_+	fucose isomerase	NA	NA	NA	NA	NA
WP_002209443.1|2067607_2068552_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002209444.1|2068799_2070140_-	MFS transporter	NA	NA	NA	NA	NA
WP_002209445.1|2070456_2070945_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.0	2.6e-28
WP_002209446.1|2071059_2072130_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.3	4.1e-111
WP_002209447.1|2072267_2072831_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_002209448.1|2072970_2075598_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.3	1.8e-78
WP_002209449.1|2075847_2076033_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	3.8e-12
WP_002209450.1|2077285_2077852_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_002209451.1|2077848_2078277_+	DedA family protein	NA	NA	NA	NA	NA
WP_002228236.1|2078359_2079919_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_002209453.1|2080086_2080602_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_002213775.1|2080805_2081264_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_002213759.1|2081516_2081975_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	9.4e-12
WP_001297096.1|2082840_2083620_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|2083619_2084642_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002209455.1|2085424_2086216_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002209456.1|2086381_2087743_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002209458.1|2087970_2088219_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002209459.1|2088240_2088789_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002222284.1|2088827_2089568_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002209461.1|2089648_2089996_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002213759.1|2090207_2090666_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	9.4e-12
WP_002209462.1|2090968_2091736_-	YdiY family protein	NA	NA	NA	NA	NA
WP_002209463.1|2093831_2094548_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_002228238.1|2094780_2095851_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.4	1.5e-89
WP_002209465.1|2095863_2096985_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002209466.1|2097089_2097308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297096.1|2097384_2098164_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|2098163_2099186_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 9
NC_017168	Yersinia pestis A1122, complete sequence	4553770	2415501	2484309	4553770	transposase,tRNA,plate	Escherichia_phage(33.33%)	60	NA	NA
WP_002213759.1|2415501_2415960_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	9.4e-12
WP_002208491.1|2416102_2416612_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002208490.1|2416660_2418388_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	33.3	3.0e-18
WP_002208488.1|2418436_2418694_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_002222180.1|2419192_2420161_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.8	4.8e-74
WP_002213487.1|2420317_2421052_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_002227089.1|2421300_2422287_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_002213368.1|2422377_2424390_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.2	1.7e-142
WP_002213369.1|2424409_2424625_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_002213372.1|2424725_2425073_-	FlxA-like family protein	NA	NA	NA	NA	NA
WP_002213374.1|2425204_2425810_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_002213775.1|2426523_2426982_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_002222185.1|2427174_2428590_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002211622.1|2429823_2431008_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_002211621.1|2431442_2432672_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_002354622.1|2432764_2433079_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_002211618.1|2433348_2434338_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_002211617.1|2434473_2435352_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211616.1|2435454_2435931_+	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_002211615.1|2436111_2437083_+	glucokinase	NA	NA	NA	NA	NA
WP_002211614.1|2437160_2438408_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_002211613.1|2438673_2439909_+	alanine transaminase	NA	NA	NA	NA	NA
WP_002211611.1|2440153_2440678_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	47.1	9.3e-24
WP_002211610.1|2440772_2441204_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	48.2	2.4e-25
WP_002215847.1|2441793_2442465_+	lipoprotein	NA	NA	NA	NA	NA
WP_002215846.1|2442491_2442848_+	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_002211607.1|2442844_2443501_+	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_002211606.1|2443746_2444316_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_002228419.1|2444312_2444909_-	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	49.2	9.2e-44
WP_002211604.1|2445266_2446043_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	41.4	3.9e-42
WP_002211603.1|2446044_2446662_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	68.3	1.1e-87
WP_002211602.1|2446673_2449100_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	54.4	1.1e-255
WP_002211601.1|2449930_2450779_+	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_002354621.1|2451008_2451488_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002211599.1|2451954_2452479_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_002211598.1|2452551_2453601_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	3.9e-21
WP_002215840.1|2453597_2455184_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002211596.1|2455239_2456259_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002211594.1|2456587_2457682_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_002211590.1|2458936_2459539_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002215321.1|2459896_2460379_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_002211588.1|2460375_2462058_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002211587.1|2462058_2462742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211586.1|2462738_2464076_-	glycosyl transferase	NA	A0A292GJ55	Xanthomonas_phage	32.8	2.0e-70
WP_002215319.1|2464115_2465147_-	fimbrial protein	NA	NA	NA	NA	NA
WP_002211584.1|2465153_2466335_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002211583.1|2466433_2467459_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002211582.1|2467458_2469339_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002215317.1|2470121_2472797_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.3	1.0e-81
WP_002211580.1|2472997_2473543_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211579.1|2473699_2474461_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002215157.1|2474588_2476139_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002209743.1|2476160_2477369_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211577.1|2477393_2478584_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002211576.1|2478568_2479177_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211575.1|2479281_2479806_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002211574.1|2479829_2481332_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211573.1|2481657_2482143_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002211572.1|2482416_2482956_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211571.1|2482959_2484309_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 10
NC_017168	Yersinia pestis A1122, complete sequence	4553770	3310327	3409824	4553770	tRNA,lysis,tail,integrase,transposase,holin	Escherichia_phage(14.55%)	101	3357518:3357548	3399242:3399272
WP_000255944.1|3310327_3311350_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3311349_3312129_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210659.1|3312497_3313088_-	thymidine kinase	NA	A0A1Z1LYD5	Serratia_phage	55.8	1.5e-54
WP_002403760.1|3313837_3314248_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_002210664.1|3314682_3316029_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.9e-81
WP_002210665.1|3316335_3317352_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_002210666.1|3318685_3319150_+	YchJ family protein	NA	NA	NA	NA	NA
WP_002210667.1|3319233_3320103_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	5.5e-13
WP_002209743.1|3320065_3321274_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211665.1|3321972_3322833_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211667.1|3323642_3324449_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_002211668.1|3324546_3324933_+	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211669.1|3324945_3325236_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_002211670.1|3325232_3327158_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	4.2e-37
WP_002211671.1|3327219_3328266_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_002211673.1|3328490_3329042_-	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_002211674.1|3329204_3331055_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_002211675.1|3331171_3332188_+	asparaginase	NA	NA	NA	NA	NA
WP_002211676.1|3332202_3332850_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	33.0	1.8e-21
WP_002217933.1|3332983_3333256_-	YeaC family protein	NA	NA	NA	NA	NA
WP_002211677.1|3333326_3333740_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002224141.1|3334087_3335083_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002211679.1|3335396_3336272_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_002430110.1|3336344_3337094_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_002211681.1|3337537_3339472_+	protein kinase YeaG	NA	NA	NA	NA	NA
WP_002216501.1|3339621_3340896_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	1.5e-11
WP_002211683.1|3341003_3342122_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002211684.1|3342156_3343062_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211685.1|3343259_3344129_+	pirin family protein	NA	NA	NA	NA	NA
WP_002216508.1|3344393_3345596_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.1	7.6e-29
WP_002211686.1|3345611_3346916_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_002211687.1|3347380_3348916_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_002211688.1|3349133_3349853_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_002211689.1|3350096_3351671_+	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_002227934.1|3351906_3352437_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_002214494.1|3352853_3353210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211692.1|3354301_3355042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211693.1|3355058_3356258_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.6	2.4e-38
WP_002214492.1|3356261_3357434_+	MFS transporter	NA	NA	NA	NA	NA
3357518:3357548	attL	GTTATTTAGCCCAACTCGGCTTATTCAATAT	NA	NA	NA	NA
WP_002209743.1|3357738_3358947_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_097608205.1|3359167_3359536_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	42.0	5.0e-08
WP_002211696.1|3359597_3360515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211697.1|3360531_3361530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211698.1|3361529_3364733_-	host specificity protein J	NA	F1C571	Cronobacter_phage	60.5	0.0e+00
WP_002359202.1|3364908_3365130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211700.1|3365304_3365925_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.0	3.2e-55
WP_002211701.1|3365980_3366196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214482.1|3366338_3366890_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	58.0	9.5e-27
WP_002211704.1|3366988_3367996_-	Bro-N domain-containing protein	NA	A0A2H4J0P1	uncultured_Caudovirales_phage	33.0	4.1e-36
WP_002211705.1|3368069_3368237_-	hypothetical protein	NA	G9L6D7	Escherichia_phage	61.8	5.2e-13
WP_002211706.1|3368360_3368792_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	58.4	2.5e-30
WP_002211707.1|3368870_3369503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211708.1|3369763_3370474_-	C40 family peptidase	NA	K7P6F5	Enterobacteria_phage	76.8	1.3e-108
WP_002211709.1|3370476_3371229_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
WP_002213759.1|3371349_3371808_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	9.4e-12
WP_002211710.1|3372112_3372454_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	50.0	1.7e-21
WP_002211711.1|3372456_3375960_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	33.2	5.2e-118
WP_071525538.1|3375960_3376221_-	DUF1799 domain-containing protein	NA	A0A0S2SY90	Pseudomonas_phage	50.0	3.7e-13
WP_002211712.1|3376268_3376580_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	58.3	1.4e-30
WP_002211713.1|3376592_3377513_-	Ig-like domain-containing protein	NA	I6PBN6	Cronobacter_phage	49.1	4.4e-61
WP_002211714.1|3377578_3377986_-	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_002211715.1|3377982_3378567_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.6e-48
WP_002211716.1|3378568_3378919_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	56.0	6.9e-31
WP_002211717.1|3378920_3379175_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	53.1	2.2e-18
WP_002211718.1|3379171_3379654_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	46.1	6.4e-27
WP_002211719.1|3379701_3380907_-	Ig-like domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	79.2	1.8e-142
WP_002211720.1|3380920_3381694_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	62.3	2.8e-69
WP_002211721.1|3381815_3382928_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.2	6.0e-121
WP_002228446.1|3382928_3383570_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	54.1	3.8e-59
WP_002228445.1|3383588_3384317_-	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	51.4	4.6e-61
WP_002211722.1|3384316_3385291_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	81.1	2.3e-153
WP_002209743.1|3385295_3386504_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211723.1|3386551_3387136_-	hypothetical protein	NA	A0A0R6PHH0	Moraxella_phage	70.7	4.8e-69
WP_002211724.1|3387139_3387589_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	1.0e-47
WP_002211725.1|3387619_3388255_-	hypothetical protein	NA	I6S676	Salmonella_phage	71.4	7.2e-87
WP_002211727.1|3388711_3389425_-	phage antirepressor KilAC domain-containing protein	NA	Q5MBW0	Stx1-converting_phage	60.2	7.6e-69
WP_002211729.1|3389970_3390429_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	45.3	4.9e-21
WP_002211730.1|3390413_3390926_-	lysozyme	NA	I6PBN2	Cronobacter_phage	61.6	9.7e-50
WP_002430108.1|3390956_3391154_-|holin	phage holin family protein	holin	B6SD15	Bacteriophage	64.4	4.9e-18
WP_002215644.1|3391399_3391675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211731.1|3391671_3391881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211732.1|3392304_3392868_-	Bro-N domain-containing protein	NA	B6SD63	Bacteriophage	58.0	9.4e-30
WP_002215638.1|3392916_3393135_-	ash family protein	NA	NA	NA	NA	NA
WP_002215636.1|3393138_3393528_-	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	68.8	1.4e-45
WP_002211735.1|3393528_3394134_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	56.9	2.8e-56
WP_002211736.1|3394207_3394654_-	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	62.5	3.9e-47
WP_071525537.1|3394629_3395379_+	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	48.5	1.5e-54
WP_002215632.1|3395678_3395939_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	42.9	1.7e-10
WP_001297096.1|3396106_3396886_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_015683826.1|3396885_3397908_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	4.1e-201
WP_002211738.1|3397977_3399216_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
WP_002211739.1|3399242_3399689_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
3399242:3399272	attR	GTTATTTAGCCCAACTCGGCTTATTCAATAT	NA	NA	NA	NA
WP_002211740.1|3399791_3400448_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002211743.1|3401746_3402019_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_002220631.1|3402739_3403426_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_002211179.1|3403450_3404263_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002211180.1|3404266_3404536_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_002211181.1|3404772_3405894_-	ribonuclease D	NA	NA	NA	NA	NA
WP_002211182.1|3406053_3407742_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	1.8e-31
WP_087768167.1|3408276_3408384_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002211184.1|3409125_3409824_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 11
NC_017168	Yersinia pestis A1122, complete sequence	4553770	3683295	3722380	4553770	transposase,coat,protease	Escherichia_phage(14.29%)	31	NA	NA
WP_000255944.1|3683295_3684318_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002209743.1|3685693_3686902_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210828.1|3686949_3687300_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002210829.1|3687635_3688472_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_002210830.1|3688563_3689325_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	3.1e-20
WP_002210831.1|3689660_3691328_+	pectate disaccharide-lyase	NA	NA	NA	NA	NA
WP_002210832.1|3691368_3692259_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002210833.1|3692251_3693172_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002210834.1|3693185_3694313_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	1.6e-12
WP_002210835.1|3694328_3695621_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210836.1|3695918_3696629_+	porin	NA	NA	NA	NA	NA
WP_002210837.1|3697108_3697657_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	32.9	4.0e-09
WP_002210838.1|3697860_3699252_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_002210839.1|3699466_3700318_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	28.8	1.3e-11
WP_002210840.1|3700702_3701494_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_002210841.1|3701680_3702847_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_002210842.1|3703173_3704541_+	MFS transporter	NA	NA	NA	NA	NA
WP_002210843.1|3704594_3705398_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002215120.1|3705394_3706558_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210844.1|3706554_3709167_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002215118.1|3709248_3710028_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_002210846.1|3710180_3710723_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210847.1|3711380_3712262_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_002210848.1|3712735_3714808_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
WP_002210849.1|3714827_3715541_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_002210850.1|3715636_3716134_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002367629.1|3716365_3717613_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_002216616.1|3717581_3720233_+	PqiB family protein	NA	NA	NA	NA	NA
WP_002210852.1|3720711_3721266_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|3721271_3721802_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216611.1|3721822_3722380_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 12
NC_017168	Yersinia pestis A1122, complete sequence	4553770	3794230	3847626	4553770	transposase,tRNA	Clostridium_phage(23.08%)	48	NA	NA
WP_002210913.1|3794230_3795346_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_002210914.1|3795403_3796030_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_002210915.1|3796090_3797461_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.8	2.0e-110
WP_002210916.1|3797648_3798272_+	porin family protein	NA	NA	NA	NA	NA
WP_002210917.1|3798482_3799154_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_002210918.1|3799159_3800614_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_002210919.1|3800697_3801819_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002210920.1|3802051_3803287_-	peptidase T	NA	NA	NA	NA	NA
WP_002210921.1|3803616_3804453_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	2.6e-20
WP_002210922.1|3805435_3806683_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_002210923.1|3806682_3807387_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	43.3	1.4e-35
WP_002222341.1|3807379_3808582_-	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
WP_002210924.1|3808851_3812298_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_002210925.1|3812536_3813076_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_000255944.1|3813180_3814203_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3814202_3814982_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002209743.1|3815365_3816574_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002213101.1|3816669_3817083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215856.1|3817090_3817660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213097.1|3818197_3819502_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002213095.1|3819876_3820419_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002215854.1|3820546_3821566_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_002213090.1|3821648_3822515_-	thiamine kinase	NA	NA	NA	NA	NA
WP_002213089.1|3822495_3823071_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_002213088.1|3823111_3823501_-	YcfL family protein	NA	NA	NA	NA	NA
WP_002213087.1|3823535_3823889_-	purine nucleoside phosphoramidase	NA	NA	NA	NA	NA
WP_002215853.1|3824062_3824881_-	shikimate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002213759.1|3825323_3825782_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	9.4e-12
WP_002213085.1|3825971_3827405_-	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002213084.1|3827710_3828520_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_002213083.1|3828534_3829557_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_002213082.1|3829556_3830195_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.1	4.6e-25
WP_002217396.1|3830184_3831210_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_002213080.1|3831498_3832305_-	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_002213775.1|3832720_3833179_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_002213079.1|3833378_3834620_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_002220787.1|3834714_3834951_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.6	7.7e-10
WP_002210935.1|3835104_3835839_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.1	7.7e-16
WP_002210934.1|3835852_3836782_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002210933.1|3836819_3837770_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_002210932.1|3837776_3838811_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_002210931.1|3838844_3839012_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002210930.1|3839024_3839549_-	23S rRNA accumulation protein YceD	NA	NA	NA	NA	NA
WP_002210928.1|3839690_3840287_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002213759.1|3840441_3840900_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	9.4e-12
WP_002210927.1|3841119_3842082_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_002354074.1|3842665_3846322_+	ribonuclease E	NA	NA	NA	NA	NA
WP_002209743.1|3846417_3847626_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 13
NC_017168	Yersinia pestis A1122, complete sequence	4553770	3924914	3972628	4553770	transposase,tRNA,lysis,plate	Escherichia_phage(16.67%)	40	NA	NA
WP_002211873.1|3924914_3925496_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	2.5e-33
WP_002211872.1|3925600_3926242_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.9	1.0e-35
WP_002211871.1|3926486_3927599_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_002211870.1|3927863_3929891_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.1	8.0e-55
WP_002213775.1|3930054_3930513_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_000255944.1|3930623_3931646_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3931645_3932425_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002228565.1|3932689_3933352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211975.1|3934049_3935126_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002211974.1|3935143_3936397_+	LVIVD repeat-containing protein	NA	NA	NA	NA	NA
WP_002211973.1|3936729_3937911_+	MFS transporter	NA	NA	NA	NA	NA
WP_002211971.1|3938152_3938560_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002211970.1|3938556_3939252_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_002211969.1|3939577_3940462_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_002211968.1|3940817_3942515_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_002211966.1|3942795_3943533_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_002211965.1|3943977_3944988_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_002211964.1|3945008_3946529_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.9	2.6e-10
WP_002215885.1|3946758_3947766_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_002211961.1|3948513_3949680_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_002211960.1|3949734_3950397_-	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	53.5	5.8e-55
WP_002211959.1|3950580_3951732_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_002211958.1|3951867_3952737_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211957.1|3953010_3954150_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.9	5.2e-35
WP_002211956.1|3954170_3955013_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002227980.1|3955269_3955482_+	peptide antibiotic darobactin C	NA	NA	NA	NA	NA
WP_002215886.1|3955565_3957926_+	darobactin export ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002211952.1|3957927_3959190_+	darobactin export ABC transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002211951.1|3959191_3959860_+	darobactin export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	1.4e-35
WP_002211950.1|3959869_3961180_+	darobactin maturation radical SAM/SPASM protein DarE	NA	NA	NA	NA	NA
WP_002211949.1|3961714_3962989_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_002211948.1|3962990_3963761_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_002209743.1|3963896_3965105_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211947.1|3965148_3965802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002227996.1|3966029_3967625_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	6.1e-58
WP_002211945.1|3968307_3968931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211944.1|3969142_3970510_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002211943.1|3970534_3970987_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002214552.1|3970986_3971568_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211941.1|3971542_3972628_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 14
NC_017168	Yersinia pestis A1122, complete sequence	4553770	4031980	4075670	4553770	transposase,tRNA,protease	Clostridium_phage(16.67%)	41	NA	NA
WP_002213775.1|4031980_4032439_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_002226586.1|4032607_4033063_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_002224683.1|4033273_4035025_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_002220006.1|4035093_4035612_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_002211286.1|4035877_4036066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000255944.1|4036699_4037722_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|4037721_4038501_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002228004.1|4039276_4039507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211378.1|4039847_4040774_+	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	44.1	4.6e-50
WP_002211377.1|4041185_4042277_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002231265.1|4042276_4042513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002231264.1|4042509_4042896_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_002211376.1|4042856_4043333_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002211375.1|4043329_4044115_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-10
WP_002211374.1|4044102_4044900_+	nicotianamine synthase	NA	NA	NA	NA	NA
WP_002211373.1|4044892_4046263_+	opine metallophore biosynthesis dehydrogenase	NA	NA	NA	NA	NA
WP_002211372.1|4046259_4047105_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002211370.1|4047294_4047963_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002211369.1|4047962_4048679_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_002211368.1|4048690_4049422_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002228008.1|4049442_4050171_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	34.9	3.3e-27
WP_002211366.1|4050465_4051026_-	chorismate mutase	NA	NA	NA	NA	NA
WP_002211365.1|4051195_4051771_-	lipoprotein	NA	NA	NA	NA	NA
WP_002211364.1|4051867_4052875_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002211363.1|4052974_4054465_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_002211362.1|4054461_4055481_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002211361.1|4055829_4057551_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002211360.1|4057694_4058717_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002429598.1|4058830_4060414_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002211358.1|4060684_4061581_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002211356.1|4061933_4063601_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002211355.1|4063737_4064685_-	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_002216705.1|4064921_4066034_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_002211351.1|4066033_4067983_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	37.7	8.8e-35
WP_002211350.1|4068263_4068527_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	3.6e-16
WP_002211349.1|4068887_4069208_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.7	8.2e-15
WP_002211348.1|4069233_4071510_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.7	7.4e-166
WP_002213759.1|4071802_4072261_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	9.4e-12
WP_002211347.1|4072632_4072851_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002211346.1|4073016_4073727_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211344.1|4073945_4075670_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.8	3.3e-17
>prophage 15
NC_017168	Yersinia pestis A1122, complete sequence	4553770	4119585	4167381	4553770	transposase,tRNA,integrase	Clostridium_phage(20.0%)	38	4152600:4152659	4167467:4168179
WP_002211311.1|4119585_4120371_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_002211310.1|4120367_4121690_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_002211309.1|4121670_4122399_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_002211308.1|4122395_4126853_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_002213759.1|4127068_4127527_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	9.4e-12
WP_002217987.1|4127810_4129667_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_002211305.1|4129890_4130439_+	YcbK family protein	NA	A0A0K1LLY2	Rhodobacter_phage	34.7	7.8e-05
WP_002211304.1|4130499_4131147_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	32.3	2.2e-22
WP_002430096.1|4131300_4131417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211303.1|4131570_4132761_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_002354007.1|4133017_4134097_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	56.5	3.2e-111
WP_002211301.1|4134397_4135798_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.2	6.5e-80
WP_002228013.1|4136296_4137502_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002220013.1|4138217_4140833_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_002211296.1|4141459_4142470_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_002211295.1|4142652_4143204_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_002363919.1|4143229_4144339_-	YcbX family protein	NA	NA	NA	NA	NA
WP_002211293.1|4144441_4146562_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_002211292.1|4146567_4148481_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	1.5e-47
WP_002211291.1|4148609_4149896_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_002211290.1|4149882_4151535_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_002211289.1|4151531_4152110_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_002228015.1|4152379_4152547_+	ribosome modulation factor	NA	NA	NA	NA	NA
4152600:4152659	attL	TTGTGCCCAGAAAACCCCCAGCTAGGCTGGGGGTTCAGTAAAGCTTTCAGCTTTGGGTCA	NA	NA	NA	NA
WP_002213775.1|4152744_4153203_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_001297096.1|4154363_4155143_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|4155142_4156165_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002215951.1|4156769_4157087_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	48.1	2.0e-13
WP_002210705.1|4157092_4157407_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_002210707.1|4157755_4158844_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.4	1.4e-114
WP_002215950.1|4158840_4159800_-	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	41.0	1.6e-50
WP_002215949.1|4159792_4160335_-	ash family protein	NA	NA	NA	NA	NA
WP_002210709.1|4160334_4160535_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.7	1.6e-08
WP_002210710.1|4160527_4161415_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_002215946.1|4162222_4162450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215945.1|4162611_4164282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210712.1|4164332_4165421_-	DUF4297 domain-containing protein	NA	NA	NA	NA	NA
WP_002210713.1|4165499_4166699_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.2	2.2e-108
WP_002213775.1|4166922_4167381_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
4167467:4168179	attR	TGACCCAAAGCTGAAAGCTTTACTGAACCCCCAGCCTAGCTGGGGGTTTTCTGGGCACAAAAAAGCCCGCAAACCTAGAAGGGATGCGGGCTTTCCGTACTTCACCGGACTTATCTGGTAATAACCGGTTTAACATTTGGTGGAGCTGGGGGGATTTGAACCCCCGTCCGAAATTACTACACCGTCGGCACTACATGCTTAGTCCAATCATTACATTCGCCGGCCAGCTGCGGATGGACACGCTACTGACAAACTATCCTGATTAGTTTTAATGCTTCCACCCCAGGCAAGGTTTCCACACGAGCTCTTTTAGGTTTGACCTCTCTTGATCCCCGTCCTAAGAGCGGAGGCTAGGGAGAGAGGGCTCTAAGCAGGTTATTAAGCTGCTAGTGCGTAGTTTTCGTCGTTTGCAACTATTTTTTTTGCGGTTTTTTACGAGGCCACCGCACCTCGGCATGCACCTTGGGTTTCGCGAATCCCGTCGAATCCAGAATCAGCCCCAAAGAACTCAGCTAGTATAACAGAACTATGTCCTGCGATGCCAGTTACTTAACGATTTGCGTGCTTCATGATGCGCGCTTTGTCTAACTTCCACTCACGATCTCTAATATCATCGCGCTTGTCGTTATCTTTTTTACCTTTTGCTACGCCGATTTTAACTTTCACCCAGGCATTTTTCCAATACATGGAGAGAGCGACAACCGTGTAGCCTT	NA	NA	NA	NA
>prophage 16
NC_017168	Yersinia pestis A1122, complete sequence	4553770	4200923	4243773	4553770	transposase,holin,protease	Planktothrix_phage(16.67%)	41	NA	NA
WP_000255944.1|4200923_4201946_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002210745.1|4202004_4202130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210746.1|4202311_4203064_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002210747.1|4203410_4203746_-	phosphate starvation-inducible protein PsiF	NA	NA	NA	NA	NA
WP_002216812.1|4204038_4204935_-	galactose-1-epimerase	NA	NA	NA	NA	NA
WP_002216814.1|4204955_4205108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210748.1|4205101_4206253_-	galactokinase	NA	NA	NA	NA	NA
WP_002210749.1|4206249_4207302_-	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002210750.1|4207311_4208328_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	44.8	3.0e-79
WP_002210751.1|4208687_4209506_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002210753.1|4209722_4211213_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	26.8	2.8e-12
WP_002210754.1|4211322_4212114_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002217291.1|4212430_4212583_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_002210756.1|4212817_4213597_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210757.1|4213596_4214292_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002210758.1|4214285_4215365_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.1	1.4e-21
WP_002210759.1|4215420_4216242_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_002210760.1|4216532_4217537_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_002210761.1|4217721_4218990_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	32.1	2.4e-17
WP_002210762.1|4219088_4220126_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_002210763.1|4220125_4221277_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_002210764.1|4221260_4222064_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_002216554.1|4222056_4222779_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_002210766.1|4222930_4223641_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.3	3.5e-13
WP_002210767.1|4224730_4226746_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_002210768.1|4227037_4227283_+	VF530 family DNA-binding protein	NA	NA	NA	NA	NA
WP_002210769.1|4227413_4228337_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	27.8	3.7e-23
WP_002210771.1|4228868_4229849_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_002210772.1|4229949_4230429_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_002210773.1|4230425_4230671_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_002210774.1|4230673_4231126_+	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_002210775.1|4231268_4231979_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_002213775.1|4232213_4232672_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_002220180.1|4232900_4234604_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.5	9.4e-57
WP_002218281.1|4234626_4236099_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002218278.1|4236156_4236753_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_002228035.1|4237117_4239166_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-19
WP_002214199.1|4239397_4240291_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002214197.1|4240328_4241177_-	DMT family transporter	NA	NA	NA	NA	NA
WP_002214195.1|4241522_4242386_+	xanthosine phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.7	2.3e-51
WP_002213775.1|4243314_4243773_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
>prophage 17
NC_017168	Yersinia pestis A1122, complete sequence	4553770	4286901	4332243	4553770	tail,plate,transposase,coat,protease	Pseudomonas_phage(23.81%)	39	NA	NA
WP_002210815.1|4286901_4287411_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_002210816.1|4287445_4287703_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.9	4.0e-20
WP_002210817.1|4287706_4288837_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	7.6e-172
WP_002210818.1|4288999_4291288_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.9	1.1e-286
WP_002210820.1|4291781_4292510_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_002210821.1|4292771_4295447_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.4	4.0e-102
WP_002228028.1|4295634_4298508_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.3	3.8e-42
WP_002210824.1|4298575_4299229_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_002216094.1|4299231_4299804_-	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_002216093.1|4299971_4301924_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_002210825.1|4301947_4303102_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210826.1|4304204_4305320_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.6	9.6e-111
WP_002213759.1|4305521_4305980_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	9.4e-12
WP_002228026.1|4306769_4307936_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_002208870.1|4308210_4309737_-	MFS transporter	NA	NA	NA	NA	NA
WP_002208869.1|4310113_4311142_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002208868.1|4311215_4313003_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
WP_002208867.1|4313424_4314360_-	omptin family outer membrane beta-barrel protein YcoA	NA	NA	NA	NA	NA
WP_002208866.1|4314531_4314774_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	65.0	6.9e-22
WP_002208864.1|4314979_4315702_-	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002215470.1|4315975_4316455_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_002208862.1|4316665_4317970_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.0	1.7e-90
WP_002208861.1|4318678_4319491_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002208860.1|4319466_4320261_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208859.1|4320874_4321165_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
WP_002208858.1|4321210_4321828_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002208857.1|4321832_4322027_+	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	60.4	3.5e-08
WP_002208856.1|4322023_4323532_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	44.2	2.4e-104
WP_002208855.1|4323553_4323922_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_002208854.1|4323923_4324223_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002208853.1|4324343_4325837_+|coat	coat protein	coat	NA	NA	NA	NA
WP_002208852.1|4326103_4327510_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208850.1|4327506_4328562_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_002215460.1|4328577_4329174_+|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_002208848.1|4329170_4329626_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002208847.1|4329629_4330766_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
WP_002215458.1|4330762_4331023_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_002208846.1|4331019_4331367_+	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_002208845.1|4331463_4332243_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
>prophage 1
NC_017169	Yersinia pestis A1122 plasmid unnamed, complete sequence	96210	0	69766	96210	transposase,terminase,integrase	Salmonella_phage(77.36%)	74	14189:14204	66033:66048
WP_002211785.1|869_1703_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	91.3	5.8e-137
WP_002211786.1|1725_3300_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.2	2.4e-301
WP_002211787.1|3333_4590_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_002211788.1|4592_5234_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	1.2e-108
WP_000176291.1|5429_5696_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211789.1|5705_6596_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_002211790.1|6601_6856_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
WP_002211791.1|6848_7487_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
WP_002211792.1|7483_8152_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
WP_002228791.1|8151_8850_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	9.6e-125
WP_002211794.1|8914_10474_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.0	1.1e-293
WP_002214131.1|10476_10755_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
WP_002211796.1|10814_11237_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
WP_002214134.1|11241_11769_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.0	6.4e-81
WP_002211799.1|12090_12741_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
WP_002214137.1|12825_13053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211801.1|13691_14174_-	hypothetical protein	NA	J9Q805	Salmonella_phage	94.4	5.1e-85
14189:14204	attL	AAACAATTTGTTTTCT	NA	NA	NA	NA
WP_002211802.1|14379_14661_-	hypothetical protein	NA	J9Q753	Salmonella_phage	93.5	6.1e-46
WP_002213759.1|14860_15319_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002214145.1|15527_16097_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
WP_002213303.1|16109_16856_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_038918515.1|16845_17205_-	hypothetical protein	NA	J9Q741	Salmonella_phage	100.0	5.2e-58
WP_002213300.1|18991_20077_-	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
WP_002213298.1|20492_21515_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002214160.1|21874_22519_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	1.8e-122
WP_002214164.1|23263_24328_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	2.4e-188
WP_002222711.1|24896_25109_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002227818.1|25108_25444_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002228796.1|25440_25620_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002228797.1|25660_25936_-	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002222869.1|26003_26414_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	4.1e-75
WP_002222868.1|26397_26769_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
WP_002222866.1|26922_27753_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002213439.1|27756_27957_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	97.0	1.1e-25
WP_161597819.1|28047_29079_-	recombinase	NA	J9Q736	Salmonella_phage	99.1	6.9e-196
WP_000920226.1|29126_29393_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_002225551.1|29392_30337_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	1.3e-180
WP_002213132.1|30397_31426_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
WP_002213135.1|31545_31977_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	2.6e-72
WP_002215095.1|32197_32449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213141.1|32521_33085_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	64.6	2.2e-63
WP_002425587.1|33114_33540_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.5e-72
WP_050551281.1|33554_34049_-	DNA polymerase III	NA	J9Q7Z2	Salmonella_phage	99.4	3.2e-90
WP_041176132.1|34109_34889_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	2.2e-138
WP_000255944.1|34888_35911_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211744.1|36034_38044_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.3	7.7e-26
WP_002211745.1|38116_38347_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_002211746.1|39059_39566_-	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	29.5	1.1e-08
WP_002211747.1|39964_40744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215082.1|40797_41217_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_002211748.1|41227_41449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211749.1|41448_42126_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_002211750.1|42626_42827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228775.1|42988_44386_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_002215070.1|44764_45736_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.3	1.5e-112
WP_002211752.1|45732_46938_-	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
WP_002211753.1|47239_47467_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002215068.1|47466_47793_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002211754.1|47992_48613_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.1	6.5e-08
WP_002215065.1|48678_49620_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.0e-68
WP_002211756.1|49642_49918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211757.1|50657_51146_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_002211758.1|51223_52987_+	phospholipase D	NA	NA	NA	NA	NA
WP_002211760.1|55062_56085_-|transposase	IS110-like element IS1618 family transposase	transposase	NA	NA	NA	NA
WP_002209743.1|56553_57762_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211761.1|58110_59016_-	F1 operon transcriptional regulator Caf1R	NA	NA	NA	NA	NA
WP_002211762.1|59343_60120_+	F1 capsule chaperone Caf1M	NA	NA	NA	NA	NA
WP_002211763.1|60144_62646_+	F1 capsule-anchoring usher protein Caf1A	NA	NA	NA	NA	NA
WP_002216410.1|62726_63239_+	F1 capsule protein Caf1	NA	NA	NA	NA	NA
WP_002353208.1|63998_65102_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	30.9	5.2e-24
WP_002228802.1|65096_65483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228800.1|65745_65958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211766.1|66067_68434_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.4	0.0e+00
66033:66048	attR	AGAAAACAAATTGTTT	NA	NA	NA	NA
WP_002211767.1|68530_69766_+	AAA family ATPase	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
>prophage 2
NC_017169	Yersinia pestis A1122 plasmid unnamed, complete sequence	96210	73073	96103	96210	tail,transposase	Salmonella_phage(80.0%)	20	NA	NA
WP_000255944.1|73073_74096_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|74095_74875_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211769.1|75008_75617_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
WP_002211770.1|75918_78807_-|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	33.1	4.5e-11
WP_002211771.1|78887_79466_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.4e-27
WP_002214118.1|79522_84154_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.6	0.0e+00
WP_002211773.1|84175_84763_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.8	5.1e-103
WP_002211774.1|84750_85548_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	96.2	1.4e-156
WP_002211775.1|85540_86239_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.1	7.1e-136
WP_000440566.1|86328_86664_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_002211776.1|86705_91283_-	tape measure protein	NA	J9Q712	Salmonella_phage	90.5	0.0e+00
WP_000952684.1|91290_91515_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|91640_91958_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_002211778.1|92017_92764_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
WP_002211779.1|92838_93222_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
WP_002211780.1|93223_93697_-	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
WP_001027662.1|93687_94032_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_002211781.1|94129_94963_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
WP_002211782.1|94962_95397_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
WP_002211783.1|95440_96103_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
