The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_016041	Glaciecola nitratireducens FR1064, complete sequence	4134229	1035035	1095057	4134229	protease,integrase	Clostridium_phage(25.0%)	51	1027915:1027964	1059226:1059275
1027915:1027964	attL	AGAAATGGTGGCCCAACCCTGACTTGAACAGGGGACCTGCCGATTATGAG	NA	NA	NA	NA
WP_014107958.1|1035035_1035659_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WF93	Clostridium_phage	29.0	5.5e-07
WP_148261688.1|1036203_1036950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014107960.1|1037327_1038254_-	EamA family transporter	NA	NA	NA	NA	NA
WP_014107961.1|1038355_1039063_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014107962.1|1039555_1039804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014107963.1|1039814_1040648_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014107964.1|1040768_1041617_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041246299.1|1041792_1042182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041246300.1|1042178_1042622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014107968.1|1042890_1044051_+	amidohydrolase	NA	NA	NA	NA	NA
WP_014107969.1|1044043_1045207_+	YbdK family carboxylate-amine ligase	NA	NA	NA	NA	NA
WP_014107970.1|1045687_1047457_-	amidohydrolase	NA	NA	NA	NA	NA
WP_014107972.1|1048042_1048666_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WF93	Clostridium_phage	29.0	5.5e-07
WP_014107973.1|1049736_1050141_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_014107974.1|1051066_1052302_+|integrase	site-specific integrase	integrase	Q7Y5X7	Haemophilus_phage	29.8	1.9e-22
WP_049786923.1|1052418_1052946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014107976.1|1053057_1053963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014107977.1|1054049_1054292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083822412.1|1054552_1056295_+	replication endonuclease	NA	Q19US8	Mannheimia_phage	38.7	1.1e-84
WP_014107979.1|1057173_1057803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041246301.1|1058322_1058871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014107981.1|1059610_1059940_+	hypothetical protein	NA	NA	NA	NA	NA
1059226:1059275	attR	AGAAATGGTGGCCCAACCCTGACTTGAACAGGGGACCTGCCGATTATGAG	NA	NA	NA	NA
WP_014107982.1|1059960_1060377_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_148261762.1|1060387_1061119_+	LrgB family protein	NA	NA	NA	NA	NA
WP_014107984.1|1061266_1062253_+	response regulator	NA	NA	NA	NA	NA
WP_014107985.1|1062256_1062745_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_148261763.1|1062900_1064568_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_014107987.1|1064564_1065110_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_148261764.1|1065247_1067317_+	response regulator	NA	A0A1V0SGX0	Hokovirus	30.7	6.0e-58
WP_014107989.1|1067318_1068551_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_014107990.1|1068592_1069198_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_014107991.1|1069198_1070470_-	ATP-dependent RNA helicase SrmB	NA	A0A1V0SIR5	Klosneuvirus	35.0	2.9e-55
WP_041246302.1|1070671_1071583_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_014107993.1|1071575_1072760_+	general secretion pathway protein GspB	NA	NA	NA	NA	NA
WP_014107994.1|1072896_1073343_+	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_014107995.1|1073329_1074139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014107996.1|1074266_1075574_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_014107997.1|1075600_1076200_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_014107998.1|1076201_1077602_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_014107999.1|1077622_1078711_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_014108000.1|1078712_1080290_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	27.5	6.1e-10
WP_014108002.1|1080622_1082875_-	malate synthase G	NA	NA	NA	NA	NA
WP_014108003.1|1082991_1083945_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014108005.1|1084231_1085833_-	isocitrate lyase	NA	NA	NA	NA	NA
WP_014108006.1|1086582_1087935_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_014108007.1|1087950_1088817_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_014108008.1|1088958_1090347_-	carotenoid 1,2-hydratase	NA	NA	NA	NA	NA
WP_148261765.1|1090334_1092872_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_014108010.1|1092939_1093656_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	2.0e-21
WP_014108011.1|1093714_1094413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014108012.1|1094493_1095057_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 2
NC_016041	Glaciecola nitratireducens FR1064, complete sequence	4134229	1987195	1994428	4134229	integrase	Vibrio_phage(28.57%)	12	1986983:1986997	1995348:1995362
1986983:1986997	attL	CGGGTTCCGCCTCCA	NA	NA	NA	NA
WP_014108787.1|1987195_1988452_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.9	2.4e-70
WP_014108788.1|1988453_1988909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014108789.1|1988905_1989139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014108790.1|1989173_1989404_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	42.1	3.5e-07
WP_014108791.1|1989500_1989674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014108792.1|1989673_1990561_-	prohibitin family protein	NA	R4VJU7	Alteromonas_phage	52.0	1.8e-67
WP_014108793.1|1990563_1991253_-	dUTP diphosphatase	NA	NA	NA	NA	NA
WP_014108794.1|1991313_1992027_-	FAD-dependent thymidylate synthase	NA	M4SL34	Vibrio_phage	50.0	5.8e-61
WP_014108795.1|1992026_1992992_-	RnlB RNA ligase 2	NA	A0A2H5BGP6	Vibrio_virus	41.8	9.0e-65
WP_014108796.1|1992993_1993218_-	hypothetical protein	NA	A0A2I7QTX7	Vibrio_phage	44.0	3.4e-07
WP_014108797.1|1993220_1993370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148261703.1|1993366_1994428_-	oxidoreductase	NA	A0A0F6N5T0	Escherichia_phage	37.0	1.2e-62
1995348:1995362	attR	CGGGTTCCGCCTCCA	NA	NA	NA	NA
>prophage 3
NC_016041	Glaciecola nitratireducens FR1064, complete sequence	4134229	2758433	2767715	4134229		Salmonella_phage(16.67%)	6	NA	NA
WP_041246411.1|2758433_2759180_-	glycosyltransferase family 2 protein	NA	B9UDL7	Salmonella_phage	26.9	8.9e-12
WP_041246831.1|2759535_2760591_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	2.0e-118
WP_014109478.1|2761022_2761649_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	42.3	8.5e-24
WP_014109479.1|2761740_2764422_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.2	8.1e-39
WP_014109480.1|2764696_2766325_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.1	1.1e-150
WP_014109481.1|2766413_2767715_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	57.7	3.4e-131
>prophage 4
NC_016041	Glaciecola nitratireducens FR1064, complete sequence	4134229	3438886	3445320	4134229		Enterobacteria_phage(33.33%)	7	NA	NA
WP_014110054.1|3438886_3440380_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	39.9	9.6e-98
WP_014110056.1|3440491_3441559_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.3	5.4e-87
WP_014110057.1|3441563_3442472_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.3	1.5e-32
WP_014110058.1|3442474_3443023_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	50.0	6.3e-47
WP_014110059.1|3443025_3443907_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.5	2.0e-95
WP_041246457.1|3444001_3444304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014110061.1|3444300_3445320_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	48.6	8.9e-87
