The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017248	Brucella melitensis NI chromosome I, complete sequence	2117717	534962	608850	2117717	transposase,holin,tail,portal	Paracoccus_phage(15.79%)	68	NA	NA
WP_077281772.1|534962_535313_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002963675.1|536740_537520_-	LPS biosynthesis N-formyltransferase WbkC	NA	E3SNR5	Prochlorococcus_phage	31.4	3.3e-09
WP_002963676.1|537546_538401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004686562.1|538397_539156_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_004683211.1|539152_539935_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002963679.1|539949_541053_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L470	Tupanvirus	31.9	3.5e-44
WP_002963680.1|541060_542149_-	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	68.4	3.4e-137
WP_002963682.1|545408_546527_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_077281774.1|547284_547437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005975609.1|547479_548034_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	33.9	3.0e-12
WP_148262946.1|548197_548960_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	40.0	2.8e-21
WP_002975117.1|548857_549175_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004685492.1|549785_551141_+	phosphomannomutase	NA	NA	NA	NA	NA
WP_002963689.1|551211_552636_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	9.0e-53
WP_002963690.1|552668_553841_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_002969456.1|553923_555033_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002969455.1|558359_559322_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004683241.1|559379_560432_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_004683244.1|560439_561612_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002966715.1|561653_562961_-	xylose isomerase	NA	NA	NA	NA	NA
WP_004683247.1|563007_564459_-	xylulokinase	NA	NA	NA	NA	NA
WP_004685498.1|564491_565523_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004686553.1|565785_566229_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004683253.1|566210_566780_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004686552.1|567318_568782_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004686551.1|568933_570616_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.6	6.0e-40
WP_004683258.1|570618_571215_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_002963705.1|571405_572428_+	asparaginase	NA	NA	NA	NA	NA
WP_002967489.1|572472_572943_+	GreA/GreB family elongation factor	NA	NA	NA	NA	NA
WP_004686549.1|572939_573329_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	43.1	7.7e-07
WP_004683261.1|573325_573556_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002963709.1|573616_574609_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_004683264.1|574764_575442_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004686548.1|575438_576737_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_002963712.1|576793_577156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963713.1|577491_579003_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	1.4e-83
WP_002963714.1|579200_579917_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_006139491.1|579975_580218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683270.1|581094_581694_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	43.1	6.2e-40
WP_002963717.1|581865_582201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002967492.1|582318_584427_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_002963720.1|584999_585428_+	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	47.6	1.0e-20
WP_006136191.1|585635_585947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004686544.1|586128_586584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005969604.1|586580_587354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002967494.1|587466_588804_+	amidase	NA	NA	NA	NA	NA
WP_002963725.1|588844_589270_-	SufE family protein	NA	NA	NA	NA	NA
WP_004683280.1|589349_589814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004686543.1|590104_591934_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.9	1.2e-22
WP_002971535.1|591908_592877_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_002963729.1|592890_593238_+	DUF1491 family protein	NA	NA	NA	NA	NA
WP_006136186.1|593248_594307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683287.1|594504_595047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963732.1|595039_595651_-	DUF1214 domain-containing protein	NA	NA	NA	NA	NA
WP_006136183.1|595657_597832_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_014490024.1|598171_598684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005969588.1|598622_599882_+	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	40.6	1.3e-71
WP_002963736.1|599913_601107_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	40.0	7.0e-67
WP_002967499.1|601103_601481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963743.1|601531_601945_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_004683300.1|601941_602283_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_004683301.1|602326_602497_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_002970984.1|602501_603047_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	46.4	2.8e-07
WP_002963747.1|603049_603682_+	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	47.6	2.9e-48
WP_004683305.1|603678_604554_+	DUF2163 domain-containing protein	NA	A0A0K1Y6Z2	Rhodobacter_phage	38.9	4.5e-47
WP_004683307.1|604550_604985_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_014490027.1|604988_606176_+	hypothetical protein	NA	A0A0B5A7K5	Paracoccus_phage	34.8	6.4e-36
WP_006136163.1|606192_608850_+|tail	glycoside hydrolase/phage tail family protein	tail	A0A0B5A7K5	Paracoccus_phage	35.4	2.7e-143
>prophage 2
NC_017248	Brucella melitensis NI chromosome I, complete sequence	2117717	872198	884110	2117717	tRNA	uncultured_Mediterranean_phage(90.0%)	13	NA	NA
WP_004683698.1|872198_873050_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.5	4.4e-31
WP_002964011.1|873042_873768_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.7	1.5e-43
WP_002964012.1|873913_874132_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
WP_006094283.1|874242_874809_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_002964014.1|874805_875630_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.1	9.8e-44
WP_004683702.1|875706_876990_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.2	2.6e-104
WP_004683703.1|877138_877906_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	1.0e-39
WP_004683704.1|877902_878571_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
WP_002964018.1|878715_878901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002964019.1|878949_880248_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
WP_002964020.1|880296_881163_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_002964021.1|881322_881664_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
WP_014490079.1|881782_884110_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.2e-51
>prophage 3
NC_017248	Brucella melitensis NI chromosome I, complete sequence	2117717	953130	963020	2117717	integrase	Brucella_phage(42.86%)	14	953013:953053	967995:968035
953013:953053	attL	AGCTTGGGAAGCTGACAGGCTACCATTACATCATACCCGCA	NA	NA	NA	NA
WP_004686457.1|953130_954156_-|integrase	site-specific integrase	integrase	A0A141GEZ3	Brucella_phage	36.7	5.6e-49
WP_004683737.1|954142_954346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005968947.1|954348_954564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964088.1|954560_954764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005968944.1|954813_955518_+	hypothetical protein	NA	A0A076GD06	Sinorhizobium_phage	46.8	4.5e-05
WP_002964091.1|955514_955745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002964092.1|955741_956017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002966806.1|956039_956516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683739.1|956861_957572_+	porin family protein	NA	O11861	Bartonella_henselae_phage	36.8	5.1e-41
WP_002964095.1|957919_958090_-	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	45.1	3.1e-05
WP_004683740.1|958437_958752_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	42.1	2.0e-05
WP_002966807.1|958751_958997_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_006135935.1|960464_961157_+	hypothetical protein	NA	A0A141GEY5	Brucella_phage	97.5	4.4e-106
WP_006135932.1|961568_963020_+	hypothetical protein	NA	A0A141GEY6	Brucella_phage	56.9	1.1e-135
967995:968035	attR	AGCTTGGGAAGCTGACAGGCTACCATTACATCATACCCGCA	NA	NA	NA	NA
