The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007032	Desulfitobacterium metallireducens DSM 15288 chromosome, complete genome	3176073	618057	670208	3176073	integrase,protease,transposase,holin	Bacillus_phage(40.0%)	54	619607:619629	674556:674578
WP_006717482.1|618057_619272_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	29.8	7.4e-40
619607:619629	attL	CGCGCGTCCATGCGCGGATTTTT	NA	NA	NA	NA
WP_006715346.1|619705_620314_+	lipase	NA	NA	NA	NA	NA
WP_156922784.1|620679_621048_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_006715344.1|621293_621893_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_006715219.1|622525_623809_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_006715343.1|624138_624714_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_006715342.1|624750_625938_-	MFS transporter	NA	NA	NA	NA	NA
WP_006715341.1|625977_626325_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006715340.1|626555_627803_-	threonine ammonia-lyase IlvA	NA	NA	NA	NA	NA
WP_006715339.1|628072_628999_-	DUF2935 domain-containing protein	NA	NA	NA	NA	NA
WP_006715338.1|629183_629750_+	cache domain-containing protein	NA	NA	NA	NA	NA
WP_006715337.1|629904_631509_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_006715336.1|631501_632224_+	response regulator	NA	NA	NA	NA	NA
WP_006715335.1|632336_633668_+	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	43.9	4.3e-17
WP_006715334.1|633700_634933_+	NAD-dependent malic enzyme 4	NA	NA	NA	NA	NA
WP_006715333.1|635066_636017_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_006715332.1|636261_636666_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_006715331.1|636678_636939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006715330.1|636983_638237_-	DNA polymerase IV	NA	A0A1P8CWP4	Bacillus_phage	29.8	9.1e-33
WP_006715329.1|638445_638592_-	alpha/beta-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_006715328.1|638698_638845_-	alpha/beta-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_006715327.1|639061_640201_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_006715326.1|640464_641871_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_006715324.1|642188_643751_+	acyl CoA:acetate/3-ketoacid CoA transferase	NA	NA	NA	NA	NA
WP_006715323.1|643766_645164_+	GntP family permease	NA	NA	NA	NA	NA
WP_006715322.1|645215_646355_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_006715321.1|646465_647233_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_006715320.1|647253_648165_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_006715319.1|648179_649466_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006715318.1|649462_649744_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_006715317.1|649803_650223_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_006715316.1|650286_651051_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_006715315.1|651051_651255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167998825.1|651519_651693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006715314.1|651857_652277_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_156922752.1|652323_652629_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_006715312.1|652604_653891_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006715311.1|653902_654811_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_006715310.1|654824_655598_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_006715309.1|655714_656854_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_006715308.1|656911_658309_-	GntP family permease	NA	NA	NA	NA	NA
WP_174377973.1|658329_659898_-	malonate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_006715306.1|660050_660269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006715305.1|660489_661632_+	acyltransferase	NA	NA	NA	NA	NA
WP_006715304.1|661838_662234_+	DUF2089 domain-containing protein	NA	NA	NA	NA	NA
WP_006715303.1|662251_662674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006715302.1|662663_662990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006715301.1|663002_663344_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_006715300.1|663749_664757_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006715299.1|664888_665095_-	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_006715298.1|665302_666052_-	exonuclease domain-containing protein	NA	A0A2H4N840	Lake_Baikal_phage	27.9	1.6e-05
WP_006715297.1|666787_667624_+|integrase	site-specific integrase	integrase	S5W9T9	Leptospira_phage	36.9	2.4e-42
WP_006715296.1|667620_668796_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_041483955.1|669278_670208_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
674556:674578	attR	CGCGCGTCCATGCGCGGATTTTT	NA	NA	NA	NA
>prophage 2
NZ_CP007032	Desulfitobacterium metallireducens DSM 15288 chromosome, complete genome	3176073	893510	901275	3176073		Synechococcus_phage(33.33%)	7	NA	NA
WP_006715091.1|893510_894002_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	1.6e-25
WP_006715090.1|894064_895360_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.0	6.1e-24
WP_006715089.1|895892_896612_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	NA	NA	NA	NA
WP_006715088.1|896645_898052_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	36.9	8.8e-61
WP_006715087.1|898083_899100_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D8KMR0	Synechococcus_phage	47.0	1.1e-73
WP_006715086.1|899096_899669_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.3	6.2e-29
WP_006715085.1|899721_901275_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.1	2.6e-77
>prophage 3
NZ_CP007032	Desulfitobacterium metallireducens DSM 15288 chromosome, complete genome	3176073	1077787	1086258	3176073		Bodo_saltans_virus(16.67%)	7	NA	NA
WP_006717929.1|1077787_1078621_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	32.6	3.5e-25
WP_006717928.1|1078638_1079418_+	NRDE family protein	NA	A0A0M3ZEJ9	Turkeypox_virus	36.1	6.4e-37
WP_006717926.1|1079418_1080393_+	D-2-hydroxyacid dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	31.3	2.7e-32
WP_006717925.1|1080455_1080656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006717923.1|1080842_1083482_+	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	31.0	2.1e-39
WP_006717921.1|1083527_1084349_+	DNA-formamidopyrimidine glycosylase	NA	G3MA33	Bacillus_virus	32.2	7.3e-23
WP_006717920.1|1084386_1086258_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.2	2.5e-55
>prophage 4
NZ_CP007032	Desulfitobacterium metallireducens DSM 15288 chromosome, complete genome	3176073	1717390	1724795	3176073		Bacillus_phage(33.33%)	8	NA	NA
WP_006717263.1|1717390_1718077_+	C40 family peptidase	NA	S5MM68	Bacillus_phage	41.2	6.5e-17
WP_006717265.1|1718086_1718956_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	44.4	5.6e-58
WP_006717268.1|1719159_1719813_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_006717271.1|1719878_1720652_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	35.4	3.8e-21
WP_006717273.1|1720711_1722307_-	peptide chain release factor 3	NA	A0A2K9L2P9	Tupanvirus	35.7	5.0e-12
WP_006717275.1|1722483_1722942_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_006717276.1|1723072_1723279_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	56.1	1.1e-09
WP_025248628.1|1723385_1724795_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	6.4e-35
>prophage 5
NZ_CP007032	Desulfitobacterium metallireducens DSM 15288 chromosome, complete genome	3176073	1763805	1789445	3176073	transposase,integrase,terminase,capsid	Bacillus_phage(37.5%)	29	1782114:1782129	1792565:1792580
WP_006718579.1|1763805_1764879_-|integrase	site-specific integrase	integrase	A0A2R2ZGM9	Clostridioides_phage	27.7	1.9e-26
WP_006718578.1|1764865_1765114_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006718575.1|1765209_1765431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006718573.1|1765446_1765875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006718571.1|1765973_1766711_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_006718568.1|1766793_1767390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006718564.1|1767682_1767901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006718562.1|1767921_1770534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006716270.1|1770817_1772359_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	35.0	1.9e-80
WP_006716269.1|1772358_1773102_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	24.7	1.2e-19
WP_006719094.1|1773163_1774357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006719096.1|1774369_1775710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006719098.1|1775816_1776233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006719100.1|1776244_1776805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025248734.1|1776820_1777021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006719103.1|1777120_1777741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006719105.1|1777743_1779567_-	hypothetical protein	NA	A0A0S2SXH8	Bacillus_phage	32.9	4.9e-80
WP_006719108.1|1779571_1780159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006719111.1|1780187_1780502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006719113.1|1780566_1781730_-|capsid	phage major capsid protein	capsid	A0A0F7L1U5	uncultured_marine_virus	33.8	3.6e-52
WP_006719115.1|1781760_1782567_-	hypothetical protein	NA	NA	NA	NA	NA
1782114:1782129	attL	ATGAATTTAATTCATT	NA	NA	NA	NA
WP_006719118.1|1782648_1782963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006719120.1|1782959_1783172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006719121.1|1783195_1783528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006715219.1|1783660_1784944_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_025248735.1|1785234_1786926_-	hypothetical protein	NA	A0A0U4IEM9	Arthrobacter_phage	30.9	4.8e-53
WP_156922765.1|1786955_1787165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006718841.1|1787330_1788809_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0S2SXL6	Bacillus_phage	55.5	1.1e-149
WP_006718840.1|1788866_1789445_-|integrase	site-specific integrase	integrase	A0A1B1P7Y2	Bacillus_phage	43.3	2.4e-33
1792565:1792580	attR	AATGAATTAAATTCAT	NA	NA	NA	NA
>prophage 6
NZ_CP007032	Desulfitobacterium metallireducens DSM 15288 chromosome, complete genome	3176073	3140865	3151317	3176073	protease	Escherichia_phage(33.33%)	7	NA	NA
WP_006716736.1|3140865_3142845_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	24.4	5.4e-32
WP_006716735.1|3142879_3144316_-	thioether cross-link-forming SCIFF peptide maturase	NA	A0A1B2IB49	Erwinia_phage	29.8	5.5e-10
WP_006716734.1|3144508_3144649_-	six-cysteine ranthipeptide SCIFF	NA	NA	NA	NA	NA
WP_006716733.1|3145195_3146479_-	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	34.2	9.8e-67
WP_006716732.1|3146526_3147828_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	30.7	6.8e-23
WP_006716731.1|3148076_3149405_-	replicative DNA helicase	NA	O80281	Escherichia_phage	50.2	3.7e-109
WP_006716730.1|3149418_3151317_-|protease	ATP-dependent protease, Lon family	protease	A0A0R6PGP8	Moraxella_phage	25.2	2.3e-27
