The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017554	Pantoea ananatis PA13, complete sequence	4586378	612641	723688	4586378	capsid,terminase,tail,lysis,tRNA,portal,head,holin,plate,integrase	Salmonella_phage(44.29%)	119	681841:681862	716983:717004
WP_013027332.1|612641_613037_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_014604934.1|613039_613345_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_013027330.1|613380_613755_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_013027329.1|613942_614290_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_014594688.1|614286_614961_-	DedA family protein	NA	NA	NA	NA	NA
WP_014594687.1|615273_616050_-	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_013027326.1|616137_617442_-	MFS transporter	NA	NA	NA	NA	NA
WP_014604935.1|617841_619257_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_014604936.1|619259_620708_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_013027323.1|620710_622201_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_013027322.1|622255_623227_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	36.4	4.4e-35
WP_014604937.1|623487_624468_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_014604938.1|624603_626292_+	chloride channel protein	NA	NA	NA	NA	NA
WP_014604939.1|626288_626792_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_014594681.1|626874_627993_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_044042268.1|627993_630015_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_014604941.1|630177_630885_-	polyphenol oxidase family protein	NA	NA	NA	NA	NA
WP_013027315.1|630993_631803_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_014604942.1|632375_633008_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_013027313.1|633004_634480_+	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_014604943.1|634741_636166_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.9	2.9e-19
WP_014594675.1|636184_637282_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_022622436.1|637380_637734_-	anti-adapter protein IraP	NA	NA	NA	NA	NA
WP_014604944.1|638098_639676_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.0	6.9e-22
WP_014604945.1|639692_641474_-	GGDEF and EAL domain-containing protein	NA	NA	NA	NA	NA
WP_014594672.1|641814_643278_+	methyl-accepting chemotaxis citrate transducer Tcp	NA	NA	NA	NA	NA
WP_014604946.1|643700_643940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014604947.1|644185_646360_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_013027304.1|646976_647219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013027303.1|647955_648264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014604948.1|648533_648773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014604949.1|648914_649184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014604950.1|649326_649602_+	regulatory protein AriR	NA	NA	NA	NA	NA
WP_014604951.1|649687_649885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014604952.1|650014_650272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014604953.1|650586_652515_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_013027297.1|653555_655100_+	MCP four helix bundle domain-containing protein	NA	NA	NA	NA	NA
WP_013027296.1|655555_657034_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	70.3	1.4e-186
WP_014604955.1|657204_658752_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_014594664.1|658744_659218_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_014604956.1|659238_660648_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_014604957.1|660651_661509_+	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_014594661.1|661715_662300_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	42.2	2.5e-33
WP_014604958.1|662723_663092_+	hypothetical protein	NA	F1BUS4	Erwinia_phage	58.3	9.4e-39
WP_014604959.1|663158_663377_+	DUF2732 family protein	NA	F1BUS3	Erwinia_phage	54.1	6.0e-09
WP_014594660.1|663376_663604_+	TraR/DksA C4-type zinc finger protein	NA	F1BUS2	Erwinia_phage	50.0	1.4e-13
WP_014604960.1|663600_665664_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	70.8	9.0e-264
WP_013027286.1|665871_666096_+	hypothetical protein	NA	F1BUR9	Erwinia_phage	64.6	2.6e-15
WP_014604961.1|666789_666993_+|tail	tail protein X	tail	F1BUQ5	Erwinia_phage	80.6	2.9e-26
WP_014604962.1|666998_667223_+	hypothetical protein	NA	F1BUQ4	Erwinia_phage	82.4	9.8e-31
WP_014604963.1|667206_667716_+	lysozyme	NA	E5G6N1	Salmonella_phage	66.3	4.8e-57
WP_014604964.1|667712_668147_+	hypothetical protein	NA	F1BUQ1	Erwinia_phage	58.3	1.6e-37
WP_014594656.1|668233_668704_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	63.2	1.3e-48
WP_013027279.1|668796_669381_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	79.4	9.9e-83
WP_013027278.1|669377_669728_+	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	81.9	2.1e-48
WP_014604965.1|669731_670640_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	82.1	9.5e-133
WP_014604966.1|670632_671166_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	79.1	4.2e-80
WP_014604968.1|672782_673316_+|tail	tail fiber assembly protein	tail	A0A0A7NRZ7	Enterobacteria_phage	47.8	8.0e-39
WP_014594650.1|673794_674964_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	89.7	3.3e-202
WP_013027271.1|674976_675489_+|tail	phage major tail tube protein	tail	F1BUU2	Erwinia_phage	85.3	3.3e-82
WP_013027270.1|675543_675840_+|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	72.2	6.0e-28
WP_013027268.1|675872_675995_+|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	61.5	7.4e-09
WP_014604969.1|675987_678054_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	46.3	9.8e-08
WP_014604970.1|678060_678564_+|tail	phage tail protein	tail	F1BUT6	Erwinia_phage	69.5	4.4e-55
WP_014604971.1|678565_679723_+	cytochrome c1	NA	A0A0M5M5V5	Salmonella_phage	43.2	2.2e-81
WP_014604972.1|679796_680018_+	ogr/Delta-like zinc finger family protein	NA	F1BUT0	Erwinia_phage	68.1	8.2e-22
WP_014604973.1|680395_680926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014604974.1|681063_681255_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
681841:681862	attL	GTCTGCTGCCATTTTGCTGCCA	NA	NA	NA	NA
WP_014604975.1|682170_683022_+	DNA processing protein DprA	NA	NA	NA	NA	NA
WP_014604976.1|683046_684339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014604977.1|684390_685404_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	60.4	3.8e-114
WP_014604978.1|685413_686019_-	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	41.2	1.0e-29
WP_014604979.1|686108_686345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014604980.1|686379_686889_+	phage regulatory CII family protein	NA	F1BUS6	Erwinia_phage	72.8	1.9e-61
WP_044042276.1|686893_687079_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	48.2	3.0e-09
WP_014604982.1|687080_687464_+	hypothetical protein	NA	F1BUS4	Erwinia_phage	68.1	1.0e-40
WP_014604983.1|687533_687761_+	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
WP_014604984.1|687760_687988_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	61.3	1.1e-18
WP_014604985.1|687984_688821_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	59.9	3.0e-88
WP_014604986.1|688817_689822_+	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	42.9	3.8e-66
WP_151243577.1|689821_692107_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	77.7	0.0e+00
WP_014604988.1|692190_692379_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	78.3	1.9e-19
WP_014604989.1|692394_692628_+	DinI-like family protein	NA	E5G6M1	Salmonella_phage	71.4	1.2e-23
WP_014604990.1|692784_693504_+	hypothetical protein	NA	Q37850	Escherichia_phage	49.4	9.4e-59
WP_014604991.1|693550_693817_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	48.3	9.5e-17
WP_014604992.1|694125_695457_+	AAA family ATPase	NA	A0A2I7RNF1	Vibrio_phage	22.9	3.7e-16
WP_014604993.1|695446_696052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014604994.1|696121_697156_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	78.6	1.8e-159
WP_014604995.1|697155_698922_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	84.9	2.4e-305
WP_014604996.1|699066_699930_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	61.3	2.0e-84
WP_014604997.1|699974_701180_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	67.4	6.3e-132
WP_014604998.1|701183_701828_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	74.5	2.0e-84
WP_014604999.1|701925_702390_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	71.4	4.6e-59
WP_014605000.1|702389_702593_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	83.6	1.2e-27
WP_014605001.1|702596_702809_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	60.3	9.9e-17
WP_014605002.1|702789_703305_+	lysozyme	NA	E5G6N1	Salmonella_phage	79.9	1.1e-74
WP_014605003.1|703301_703733_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	54.2	2.0e-32
WP_014605005.1|703828_704260_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	68.5	3.3e-51
WP_014605006.1|704252_704699_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	57.5	2.3e-39
WP_049792165.1|704746_705628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014605008.1|705771_706350_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	68.1	2.6e-67
WP_014605009.1|706349_706703_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	59.0	4.2e-36
WP_014605010.1|706689_707607_+|plate	baseplate J/gp47 family protein	plate	A0A1S6KZY6	Salmonella_phage	63.4	2.2e-100
WP_014605011.1|707603_708206_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	73.6	4.6e-83
WP_014605012.1|708207_709395_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	63.0	1.7e-110
WP_014605013.1|709399_709828_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	40.0	1.5e-19
WP_014605014.1|709945_711118_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	84.4	2.2e-190
WP_014605015.1|711130_711646_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	84.8	5.3e-80
WP_014605016.1|711704_712007_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	72.4	2.5e-29
WP_013027006.1|712021_712144_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_014605017.1|712136_715049_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	46.0	1.9e-195
WP_014605018.1|715045_715528_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	69.8	9.4e-55
WP_014605019.1|715527_716628_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	74.1	2.3e-149
WP_014605020.1|716688_716907_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	68.7	2.3e-21
WP_014605021.1|717449_717965_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
716983:717004	attR	GTCTGCTGCCATTTTGCTGCCA	NA	NA	NA	NA
WP_013027259.1|718035_719880_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_014605022.1|720318_722064_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	37.5	2.8e-72
WP_001144069.1|722180_722396_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_014605023.1|722674_723688_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.0	2.9e-106
>prophage 2
NC_017554	Pantoea ananatis PA13, complete sequence	4586378	1685489	1695789	4586378		Enterobacteria_phage(57.14%)	9	NA	NA
WP_014594076.1|1685489_1686386_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	40.1	6.7e-46
WP_014605453.1|1686431_1687445_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	43.7	3.5e-75
WP_014605454.1|1687955_1689032_+	UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase	NA	NA	NA	NA	NA
WP_014605455.1|1689175_1690261_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	6.3e-99
WP_014605456.1|1690260_1691157_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	33.4	1.3e-25
WP_014605457.1|1691207_1692086_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	3.0e-107
WP_014605458.1|1692088_1692628_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.7	1.1e-51
WP_014605459.1|1692730_1693945_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_014605460.1|1693932_1695789_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	27.0	1.1e-31
>prophage 3
NC_017554	Pantoea ananatis PA13, complete sequence	4586378	1974144	2017610	4586378	capsid,terminase,tail,lysis,holin,plate,integrase	Salmonella_phage(34.15%)	63	1974024:1974049	2017797:2017822
1974024:1974049	attL	TGGCGGTGAGAGGGGGATTCGAACCC	NA	NA	NA	NA
WP_014605596.1|1974144_1975323_-|integrase	tyrosine-type recombinase/integrase	integrase	I6PDJ1	Cronobacter_phage	66.2	5.5e-149
WP_014605598.1|1975483_1977562_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	50.8	3.1e-203
WP_014605599.1|1977558_1978431_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	50.9	5.1e-83
WP_044042326.1|1978908_1979190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_193372488.1|1979226_1979382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044042327.1|1979375_1979618_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014605601.1|1979735_1980275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014605602.1|1980271_1980514_-	DNA polymerase III subunit theta	NA	A0A2H4J4A9	uncultured_Caudovirales_phage	82.1	2.1e-31
WP_014605603.1|1980559_1980799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014605604.1|1980963_1981413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014605605.1|1981412_1981946_-	hypothetical protein	NA	A0A2D1GNL9	Pseudomonas_phage	63.2	5.7e-53
WP_049792166.1|1982030_1982720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014605607.1|1982728_1983406_-	AAA family ATPase	NA	G9L667	Escherichia_phage	45.5	8.3e-49
WP_014605608.1|1983406_1984075_-	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	34.3	2.2e-22
WP_014605609.1|1984043_1984253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014605610.1|1984374_1984779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158307927.1|1985011_1985167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044042329.1|1985727_1986411_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNG6	Salmonella_phage	45.4	3.0e-14
WP_044042330.1|1986449_1986686_+	helix-turn-helix domain-containing protein	NA	A0A2D1GLN0	Escherichia_phage	68.1	2.4e-19
WP_014605612.1|1986698_1987001_+	hypothetical protein	NA	I6PCV6	Cronobacter_phage	46.7	1.6e-12
WP_014605613.1|1986993_1987179_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_158307928.1|1987234_1987387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014605614.1|1987379_1988444_+	replication protein	NA	A0A2H4J2W5	uncultured_Caudovirales_phage	87.6	2.5e-55
WP_014605615.1|1988436_1989825_+	replicative DNA helicase	NA	K7P852	Enterobacteria_phage	55.0	2.4e-127
WP_044042536.1|1989824_1990181_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	67.8	1.0e-42
WP_080561259.1|1990264_1991071_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	48.8	4.6e-62
WP_014605618.1|1991425_1991779_+|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_193372493.1|1991784_1992267_+	glycoside hydrolase family protein	NA	A0A1W6JP42	Morganella_phage	56.5	2.2e-43
WP_014605620.1|1992263_1992764_+|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	46.4	1.6e-28
WP_044042331.1|1992768_1993026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044042332.1|1993079_1993259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014605621.1|1993338_1993839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014605622.1|1993871_1994057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014605623.1|1994058_1994676_+	hypothetical protein	NA	F1C5D5	Cronobacter_phage	76.4	4.7e-91
WP_014605624.1|1994706_1995180_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	75.9	2.6e-49
WP_014605625.1|1995394_1995619_-	YegP family protein	NA	NA	NA	NA	NA
WP_014605626.1|1995720_1997331_+|terminase	phage terminase large subunit TerL	terminase	A0A0M5M1R6	Salmonella_phage	88.9	2.5e-293
WP_014605627.1|1997341_1998814_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	78.0	2.7e-225
WP_014605628.1|1998773_1999439_+|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	69.7	1.2e-73
WP_014605629.1|1999474_2000701_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	65.0	6.4e-140
WP_014605630.1|2000712_2001210_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	74.5	6.3e-62
WP_014605631.1|2001219_2002161_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	83.1	5.9e-154
WP_014605632.1|2002204_2002540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014605633.1|2002543_2002951_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	78.5	1.2e-55
WP_014605634.1|2002947_2003577_+	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	41.5	3.7e-27
WP_014605635.1|2003563_2003953_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	77.5	7.1e-53
WP_014605636.1|2003942_2004491_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	56.1	6.3e-55
WP_014605637.1|2004494_2005640_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	68.8	4.5e-148
WP_014605638.1|2005652_2006093_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.6	5.2e-68
WP_014605639.1|2006095_2006572_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	62.7	6.5e-40
WP_014605641.1|2006749_2008726_+	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	71.6	1.7e-280
WP_014605642.1|2008725_2009343_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	62.9	1.1e-55
WP_014605643.1|2009339_2009642_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	54.0	1.8e-24
WP_014605644.1|2009645_2010674_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.1	4.7e-96
WP_044042333.1|2010673_2011372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014605645.1|2011655_2012699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014605646.1|2012695_2013208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014605647.1|2013287_2013944_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	55.1	1.1e-69
WP_014605648.1|2013940_2014294_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	86.3	2.9e-53
WP_014605649.1|2014293_2015493_+|plate	baseplate J/gp47 family protein	plate	A0A2H4J5T1	uncultured_Caudovirales_phage	73.6	4.1e-160
WP_014605650.1|2015489_2016170_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	77.5	1.5e-98
WP_014605651.1|2016169_2017174_+	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	52.3	4.5e-43
WP_151243580.1|2017184_2017610_+|tail	tail fiber assembly protein	tail	M1SNQ2	Escherichia_phage	50.0	8.1e-34
2017797:2017822	attR	TGGCGGTGAGAGGGGGATTCGAACCC	NA	NA	NA	NA
>prophage 4
NC_017554	Pantoea ananatis PA13, complete sequence	4586378	2237001	2243948	4586378	terminase	Cronobacter_phage(42.86%)	12	NA	NA
WP_044042337.1|2237001_2237349_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A2H4J472	uncultured_Caudovirales_phage	88.5	2.7e-51
WP_014605746.1|2237472_2237691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049792169.1|2237653_2237833_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	60.9	5.8e-10
WP_193372489.1|2237829_2238000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014605748.1|2238198_2238714_+	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	85.9	4.1e-80
WP_044042341.1|2238800_2239226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151243570.1|2239294_2239630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_193372494.1|2239652_2240654_+|terminase	terminase small subunit	terminase	F1C5D8	Cronobacter_phage	67.1	4.6e-88
WP_044042345.1|2240650_2240854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014605750.1|2240908_2242105_+	hypothetical protein	NA	F1C5D9	Cronobacter_phage	51.6	9.4e-104
WP_014605751.1|2242108_2242549_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	63.7	1.1e-41
WP_044042346.1|2243051_2243948_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	6.5e-09
>prophage 5
NC_017554	Pantoea ananatis PA13, complete sequence	4586378	2605482	2619217	4586378	tRNA	Pandoravirus(11.11%)	15	NA	NA
WP_013025587.1|2605482_2606529_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	47.9	3.0e-82
WP_014605962.1|2606530_2607967_-	YdiU family protein	NA	NA	NA	NA	NA
WP_014605963.1|2608057_2608792_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_014605964.1|2609084_2609543_-	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	38.4	5.5e-12
WP_014605965.1|2609609_2610359_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	NA	NA	NA	NA
WP_013025582.1|2610359_2610905_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	40.7	1.8e-14
WP_013025581.1|2610938_2611928_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	1.5e-14
WP_006118960.1|2612027_2612330_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	5.6e-13
WP_014593594.1|2612334_2614722_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	30.9	4.6e-09
WP_013025578.1|2614736_2615720_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.1	1.4e-33
WP_106120997.1|2615868_2615913_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_006118956.1|2616034_2616391_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_004157374.1|2616435_2616633_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_026020952.1|2616733_2617285_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.8	4.9e-15
WP_014593593.1|2617288_2619217_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	3.1e-125
>prophage 6
NC_017554	Pantoea ananatis PA13, complete sequence	4586378	3351904	3401838	4586378	terminase,protease,head,plate,integrase	Edwardsiella_phage(23.64%)	74	3351682:3351738	3398764:3398820
3351682:3351738	attL	ATTGAAATATATTGGCGCGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_014606350.1|3351904_3352228_-	phage repressor protein	NA	A0A2H4J4R6	uncultured_Caudovirales_phage	47.6	5.9e-21
WP_014606351.1|3352229_3352469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014606352.1|3352742_3353780_+	acyltransferase family protein	NA	S5FNR8	Shigella_phage	40.4	4.2e-68
WP_014606353.1|3353802_3356313_-	hypothetical protein	NA	A0A2H5BPC4	Salmonella_phage	38.9	3.0e-120
WP_014606354.1|3356368_3357712_-	hypothetical protein	NA	Q8HAM8	Burkholderia_phage	42.6	3.1e-39
WP_014606355.1|3357713_3358301_-	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	39.0	3.8e-26
WP_014606356.1|3358297_3359530_-|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	52.3	1.2e-109
WP_014606357.1|3359538_3359898_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	48.6	1.7e-21
WP_158307932.1|3359934_3360573_-	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	45.8	3.9e-32
WP_014606359.1|3360635_3361490_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	41.8	9.2e-53
WP_014606360.1|3361486_3361792_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	46.5	6.2e-20
WP_014606361.1|3361791_3362595_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	45.6	1.4e-26
WP_014606362.1|3362596_3364375_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	27.3	1.2e-38
WP_014606363.1|3364374_3364572_-	hypothetical protein	NA	H9C0W8	Aeromonas_phage	48.9	6.2e-05
WP_014606364.1|3364586_3364991_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	39.8	3.0e-14
WP_044042567.1|3364999_3365341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014606366.1|3365439_3366918_-	DUF3383 domain-containing protein	NA	A0A068C8K3	Acinetobacter_phage	35.0	3.1e-72
WP_044042568.1|3366918_3367410_-	hypothetical protein	NA	A0A077KC88	Edwardsiella_phage	33.3	2.0e-12
WP_014606368.1|3367466_3367835_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	46.7	2.7e-25
WP_014606369.1|3367834_3368281_-	hypothetical protein	NA	A0A077KC03	Edwardsiella_phage	57.8	4.6e-40
WP_014606370.1|3368273_3368678_-	DUF4054 domain-containing protein	NA	Q2NPC6	Xanthomonas_phage	37.1	2.8e-12
WP_044042569.1|3368681_3368885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014606372.1|3369150_3370176_-	hypothetical protein	NA	A0A077KC85	Edwardsiella_phage	39.3	2.3e-58
WP_014606373.1|3370175_3370664_-	hypothetical protein	NA	A0A077KAW3	Edwardsiella_phage	50.3	4.4e-36
WP_080561254.1|3370666_3371881_-	DUF2213 domain-containing protein	NA	A0A219YBB9	Aeromonas_phage	36.6	1.1e-59
WP_014606375.1|3371944_3372655_-|head	putative phage head morphogenesis protein	head	A0A077KGU5	Edwardsiella_phage	48.8	2.4e-51
WP_014606376.1|3372656_3374132_-	DUF1073 domain-containing protein	NA	A0A077KC81	Edwardsiella_phage	35.1	1.2e-73
WP_049792157.1|3374128_3375559_-|terminase	phage terminase large subunit	terminase	D0UIJ7	Aggregatibacter_phage	50.4	4.2e-127
WP_014606378.1|3375602_3376112_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	68.3	8.1e-49
WP_049792171.1|3376143_3376773_-	hypothetical protein	NA	F1C5D5	Cronobacter_phage	77.5	2.1e-91
WP_044042410.1|3377259_3377463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044042412.1|3377579_3377882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044042414.1|3377884_3378094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151243571.1|3378238_3378595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014606381.1|3378633_3379173_-	lysozyme	NA	H9C184	Pectobacterium_phage	77.9	4.7e-79
WP_044042415.1|3379183_3379432_-	hypothetical protein	NA	G0ZNC7	Cronobacter_phage	83.1	2.3e-25
WP_014606383.1|3380077_3380692_-	hypothetical protein	NA	A0A1V0E5R2	Salmonella_phage	42.7	1.5e-36
WP_044042416.1|3380802_3381210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014606384.1|3381549_3382128_-	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	42.9	6.2e-37
WP_014606385.1|3382120_3382426_-	hypothetical protein	NA	A0A220NQY7	Salmonella_phage	33.3	3.0e-06
WP_158307929.1|3382418_3382592_-	hypothetical protein	NA	A0A2H4J175	uncultured_Caudovirales_phage	64.2	4.1e-13
WP_014606386.1|3383302_3383752_-	DUF1367 family protein	NA	A0A2R2Z328	Escherichia_phage	65.1	2.8e-53
WP_044042418.1|3383896_3384097_-	hypothetical protein	NA	A0A1B1W2E1	Salmonella_phage	71.7	3.0e-15
WP_044042420.1|3384093_3384306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044042421.1|3384293_3384521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158307930.1|3384722_3384875_-	hypothetical protein	NA	A0A2H4J9R7	uncultured_Caudovirales_phage	80.0	1.6e-16
WP_014606387.1|3384877_3385570_-	DNA replication protein	NA	A0A2H4J1B6	uncultured_Caudovirales_phage	80.3	5.2e-107
WP_080561256.1|3385566_3386424_-	replication protein	NA	H6WRX7	Salmonella_phage	60.7	5.5e-82
WP_014606389.1|3386398_3387049_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_014606390.1|3387083_3387380_-	transcriptional activator-regulatory protein C1	NA	A0A2H4J609	uncultured_Caudovirales_phage	75.5	1.5e-31
WP_014606391.1|3387489_3387675_-	helix-turn-helix domain-containing protein	NA	K7PHK4	Enterobacteria_phage	93.4	5.1e-25
WP_014606392.1|3387758_3388409_+	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	44.7	4.2e-34
WP_044042426.1|3388405_3388798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014606394.1|3389605_3389980_+	hypothetical protein	NA	Q7Y3U8	Yersinia_phage	79.0	2.0e-52
WP_014606395.1|3390100_3390352_+	hypothetical protein	NA	A0A1B0VMC0	Pseudomonas_phage	51.9	1.6e-10
WP_044042428.1|3390355_3390580_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_014606396.1|3390714_3391686_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	59.8	1.7e-42
WP_151243572.1|3391709_3391847_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_014606397.1|3391959_3392271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_193372487.1|3392267_3393167_+	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	71.3	3.0e-115
WP_014606399.1|3393163_3393646_+	siphovirus Gp157 family protein	NA	G8C7S9	Escherichia_phage	77.5	5.3e-66
WP_014606400.1|3393658_3394057_+	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	36.6	5.3e-11
WP_151243573.1|3394071_3394284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014606402.1|3394908_3395142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044042430.1|3395131_3395458_+	hypothetical protein	NA	A0A193GZ33	Enterobacter_phage	66.7	3.4e-08
WP_044042433.1|3395734_3395944_+	hypothetical protein	NA	A0A2H4IYB3	uncultured_Caudovirales_phage	66.7	4.7e-19
WP_044042434.1|3395940_3396192_+	hypothetical protein	NA	A0A2H4N7D4	Pectobacterium_phage	46.2	3.2e-06
WP_014606403.1|3396201_3396426_+	hypothetical protein	NA	A0A2H4J398	uncultured_Caudovirales_phage	79.2	5.5e-26
WP_014606404.1|3396675_3397272_+	adenine methylase	NA	T1SA14	Salmonella_phage	73.7	1.6e-83
WP_014606406.1|3397596_3398760_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	79.1	3.5e-188
WP_014606407.1|3398946_3399450_-	DUF1198 family protein	NA	NA	NA	NA	NA
3398764:3398820	attR	ATTGAAATATATTGGCGCGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_013024950.1|3399624_3400491_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	32.9	6.9e-32
WP_013024949.1|3400490_3400703_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_014593112.1|3400731_3401838_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	56.6	1.2e-113
>prophage 7
NC_017554	Pantoea ananatis PA13, complete sequence	4586378	3556653	3566741	4586378		Streptococcus_phage(25.0%)	10	NA	NA
WP_014593021.1|3556653_3557565_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	35.8	3.0e-33
WP_013024791.1|3557866_3559615_-	amylovoran biosynthesis protein AsmF	NA	A0A1S6L3G8	Erwinia_phage	46.9	1.6e-157
WP_013024790.1|3559814_3560105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013024789.1|3560101_3560449_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	45.1	5.6e-17
WP_013024788.1|3560445_3560913_-	hypothetical protein	NA	H9C148	Vibrio_phage	45.3	1.3e-29
WP_013024787.1|3561109_3561388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014606493.1|3561810_3562530_-	LexA family transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	35.4	2.5e-43
WP_014606494.1|3562889_3564143_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.6	6.6e-92
WP_014593015.1|3564152_3565256_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	3.4e-60
WP_014606495.1|3565607_3566741_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	55.7	3.5e-108
