The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_HG938370	Burkholderia cenocepacia H111 chromosome 1	3572953	100205	172400	3572953	holin,plate,integrase,tail	Burkholderia_phage(70.97%)	70	100107:100137	123014:123044
100107:100137	attL	CTCCGAAGGCAGGGGTTGCTGGTTCGATCCC	NA	NA	NA	NA
WP_006496274.1|100205_101282_-|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	81.7	4.2e-164
WP_059721111.1|101284_101557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006496273.1|101608_101980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006496272.1|101976_104769_-	toprim domain-containing protein	NA	E5E3N5	Burkholderia_phage	90.8	0.0e+00
WP_006496271.1|104774_105032_-	hypothetical protein	NA	A4JWQ9	Burkholderia_virus	57.1	1.2e-13
WP_006485448.1|105159_105408_-	ogr/Delta-like zinc finger family protein	NA	K4PAZ0	Burkholderia_phage	91.5	3.5e-37
WP_006485450.1|105589_105805_-	hypothetical protein	NA	E5E3U1	Burkholderia_phage	80.0	4.4e-20
WP_077176263.1|105931_106387_+	helix-turn-helix transcriptional regulator	NA	E5E3U2	Burkholderia_phage	62.3	7.0e-44
WP_006485449.1|106704_107001_+	hypothetical protein	NA	E5E3U3	Burkholderia_phage	50.5	1.6e-12
WP_006496269.1|107188_108259_-	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	70.6	1.4e-135
WP_006485447.1|108255_108687_-|tail	phage tail protein	tail	K4NXK5	Burkholderia_phage	67.4	8.2e-42
WP_006496268.1|108709_111280_-	hypothetical protein	NA	E5E3U6	Burkholderia_phage	46.8	9.0e-136
WP_006484104.1|111295_111409_-|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	85.7	1.1e-09
WP_171984197.1|111417_111753_-|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	65.5	1.5e-27
WP_006484101.1|111864_112374_-|tail	phage major tail tube protein	tail	E5E3U9	Burkholderia_phage	74.6	1.5e-71
WP_006484096.1|112402_113575_-|tail	phage tail sheath protein	tail	A4JWS7	Burkholderia_virus	81.7	3.0e-187
WP_006496267.1|113629_114328_-|tail	tail assembly chaperone	tail	E5E3V1	Burkholderia_phage	82.0	2.3e-86
WP_006496266.1|114344_116915_-	hypothetical protein	NA	E5E3V2	Burkholderia_phage	63.9	6.8e-269
WP_006484097.1|116921_117464_-|tail	phage tail protein I	tail	E5FFH2	Burkholderia_phage	70.9	5.2e-70
WP_006484106.1|117456_118371_-|plate	baseplate J/gp47 family protein	plate	E5FFH3	Burkholderia_phage	72.6	1.5e-117
WP_006496265.1|118367_118730_-	GPW/gp25 family protein	NA	K4PAX6	Burkholderia_phage	69.2	1.5e-41
WP_006496264.1|118726_119413_-|plate	phage baseplate assembly protein V	plate	K4NXJ5	Burkholderia_phage	68.7	4.4e-82
WP_006484113.1|119922_120372_-|tail	phage tail protein	tail	E5E3V9	Burkholderia_phage	54.2	1.5e-30
WP_006496262.1|120488_120929_-	protein lysB	NA	K4NXJ2	Burkholderia_phage	44.4	2.4e-17
WP_043205315.1|120925_121777_-	DUF3380 domain-containing protein	NA	A4JWZ0	Burkholderia_virus	65.8	7.6e-92
WP_006484102.1|121779_122046_-|holin	phage holin family protein	holin	E5E3W3	Burkholderia_phage	65.5	6.2e-24
WP_006484093.1|122047_122392_-	membrane protein	NA	A4JWU2	Burkholderia_virus	77.9	5.7e-38
WP_006484103.1|122408_122615_-|tail	tail protein X	tail	E5E3W5	Burkholderia_phage	64.7	5.1e-18
WP_043205285.1|123177_124797_+	TIGR04222 domain-containing membrane protein	NA	NA	NA	NA	NA
123014:123044	attR	CTCCGAAGGCAGGGGTTGCTGGTTCGATCCC	NA	NA	NA	NA
WP_046336751.1|125036_126983_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_006496257.1|127074_127806_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_043205283.1|127810_128596_-	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_043205306.1|128620_129151_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_043205281.1|129147_130119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006496253.1|130115_130817_-	WbqC family protein	NA	NA	NA	NA	NA
WP_006496252.1|130819_131965_-	dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase VioA	NA	A0A0P0CNN6	Ostreococcus_mediterraneus_virus	24.8	5.0e-14
WP_006496251.1|131992_134341_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_006484091.1|134598_134898_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_006484094.1|134923_136432_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_006496250.1|136564_137722_-	flagellin	NA	NA	NA	NA	NA
WP_006401410.1|138252_138465_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_043205278.1|138631_140755_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_006496248.1|140984_142220_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_006489711.1|142318_142921_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_006496247.1|143062_143944_+	ATPase	NA	NA	NA	NA	NA
WP_006496246.1|144105_144930_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_006489324.1|145060_145804_-	aquaporin Z	NA	A0A1B1ISL4	uncultured_Mediterranean_phage	50.8	8.1e-05
WP_006489320.1|146103_146400_+	H-NS histone family protein	NA	F8TUP5	EBPR_podovirus	41.1	1.9e-10
WP_006489318.1|146503_147568_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_006477348.1|148198_148552_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_006493184.1|148644_149199_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_006482649.1|149379_150240_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_006482647.1|150253_151273_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_006482646.1|151297_151675_+	response regulator	NA	NA	NA	NA	NA
WP_006486165.1|153973_154489_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_006497455.1|156484_157477_+	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_006497454.1|157473_158232_+	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_012492268.1|158228_159320_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_006485893.1|159387_159783_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	6.0e-07
WP_006497453.1|159785_160517_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_012492269.1|160776_161280_+	DUF2844 domain-containing protein	NA	NA	NA	NA	NA
WP_006497451.1|161296_162535_+	DUF3443 family protein	NA	NA	NA	NA	NA
WP_006485888.1|162699_163197_+	VOC family protein	NA	NA	NA	NA	NA
WP_006485884.1|163626_164826_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_006485892.1|164822_166925_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_006497450.1|166921_168706_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_006491878.1|168698_169517_+	flagellar biosynthesis protein FlhG	NA	NA	NA	NA	NA
WP_006484033.1|169539_170274_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_006484031.1|170525_171944_+	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	30.1	9.9e-44
WP_006477367.1|172046_172400_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 2
NZ_HG938370	Burkholderia cenocepacia H111 chromosome 1	3572953	301713	358000	3572953	protease,plate,transposase	uncultured_Mediterranean_phage(40.0%)	59	NA	NA
WP_006494443.1|301713_302427_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_006490631.1|302715_307419_+	glutamate synthase subunit alpha	NA	NA	NA	NA	NA
WP_006494441.1|307504_308971_+	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_006490627.1|309347_310838_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_006494440.1|310834_311401_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_006494439.1|311433_312717_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_006494438.1|312742_314005_-	MFS transporter	NA	NA	NA	NA	NA
WP_006494437.1|314133_314910_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006488528.1|314906_316676_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_006494435.1|317295_318432_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006488534.1|318464_318662_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_006494434.1|318700_319516_+	thiazole synthase	NA	NA	NA	NA	NA
WP_006494433.1|319512_320637_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_006477138.1|320721_321543_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	3.1e-21
WP_006486220.1|321539_322307_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_006486221.1|322331_322892_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_020979879.1|322923_323886_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_012492305.1|323997_324627_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006485329.1|324623_324899_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_006485348.1|325091_326018_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	8.2e-23
WP_023476193.1|326074_326836_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_006477131.1|326889_327129_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_006485350.1|327143_328493_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_006477129.1|328489_329143_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_006494431.1|329167_330484_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_006485351.1|330582_331656_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_006477126.1|331721_332309_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_006485349.1|332370_332991_+	YchE family NAAT transporter	NA	NA	NA	NA	NA
WP_012492306.1|332987_333629_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_006477123.1|333792_334548_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_006485327.1|334654_335428_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_006494429.1|335427_335844_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_006485344.1|335840_336206_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_006485332.1|336276_336669_+	membrane protein	NA	NA	NA	NA	NA
WP_006485352.1|336700_337066_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_006477115.1|337159_337390_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_006494428.1|337416_337956_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_006485341.1|337997_338786_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	29.8	1.8e-26
WP_006494427.1|338993_340199_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.3	1.9e-11
WP_006485336.1|340220_340967_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_006491868.1|341185_341806_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_006485333.1|341805_343188_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_006477108.1|343209_343968_+	cytochrome c1	NA	NA	NA	NA	NA
WP_006400565.1|344062_344674_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_006485328.1|344745_345267_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.0	9.6e-21
WP_006485326.1|345745_345949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006494426.1|346058_346859_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_006485338.1|347140_347458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006494425.1|347539_347875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006494424.1|347989_348772_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_006477098.1|348768_350115_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_006485335.1|350220_350820_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_043204524.1|351207_351834_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_006484395.1|351880_352396_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_006484397.1|352411_353902_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_006477093.1|353972_354476_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_006477092.1|354538_355024_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_006494422.1|355100_356936_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_006494420.1|356899_358000_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 3
NZ_HG938370	Burkholderia cenocepacia H111 chromosome 1	3572953	660824	669897	3572953		Hokovirus(16.67%)	7	NA	NA
WP_006484920.1|660824_662777_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.3	2.5e-146
WP_006476837.1|663030_664167_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	5.0e-22
WP_006497492.1|664170_666093_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	37.6	1.5e-55
WP_006485002.1|666220_667036_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	34.2	1.8e-37
WP_006497491.1|667079_667766_-	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	27.1	5.5e-08
WP_006476832.1|667762_668305_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_006497490.1|668340_669897_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	30.8	1.6e-23
>prophage 4
NZ_HG938370	Burkholderia cenocepacia H111 chromosome 1	3572953	795437	802013	3572953		Enterobacteria_phage(66.67%)	7	NA	NA
WP_006496668.1|795437_796499_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.4	2.1e-86
WP_006496667.1|796510_797404_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.8	1.3e-97
WP_006496666.1|797388_797940_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.2	6.5e-52
WP_043205452.1|797954_798881_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.6	6.1e-26
WP_171984179.1|798877_800380_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	2.0e-58
WP_006496663.1|800383_801202_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_006496662.1|801206_802013_+	ABC transporter ATP-binding protein	NA	Q66093	Chlorella_virus	25.1	9.4e-07
>prophage 5
NZ_HG938370	Burkholderia cenocepacia H111 chromosome 1	3572953	1610562	1660660	3572953	tRNA,plate,tail,head,capsid,portal,integrase,terminase	Burkholderia_virus(27.59%)	66	1640542:1640557	1647998:1648013
WP_006495281.1|1610562_1610862_+	hypothetical protein	NA	E5E3P2	Burkholderia_phage	53.6	2.0e-15
WP_006495280.1|1610960_1611260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144417361.1|1611261_1611621_+	hypothetical protein	NA	A1YZR1	Burkholderia_virus	66.7	5.2e-42
WP_006495278.1|1611630_1612515_+	hypothetical protein	NA	Q8W6P2	Burkholderia_virus	66.5	1.4e-91
WP_080346051.1|1612511_1613366_+	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	47.6	3.7e-30
WP_006495276.1|1613370_1614051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043204886.1|1614047_1614593_+	DUF1064 domain-containing protein	NA	A4JX56	Burkholderia_virus	45.5	1.8e-30
WP_158380833.1|1614620_1614947_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043204882.1|1614943_1615387_+	DUF1364 family protein	NA	Q3HR02	Burkholderia_phage	88.4	9.8e-75
WP_043204881.1|1615389_1615722_+	hypothetical protein	NA	Q6JIF6	Burkholderia_virus	71.3	6.7e-36
WP_052739281.1|1615772_1615958_+	hypothetical protein	NA	A4JX60	Burkholderia_virus	55.0	8.9e-14
WP_144417362.1|1615927_1616215_+	hypothetical protein	NA	Q6V7S5	Burkholderia_virus	46.8	1.4e-13
WP_006495270.1|1616268_1616700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144417363.1|1616822_1617128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173448948.1|1617127_1617817_+	hypothetical protein	NA	A0A1W6JTE1	Pseudomonas_phage	31.3	7.2e-16
WP_043204880.1|1617978_1618557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144417383.1|1618642_1620571_+|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	47.1	2.4e-141
WP_052739282.1|1620612_1620849_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_043204878.1|1620845_1622501_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.1	1.9e-91
WP_006495264.1|1622522_1623419_+	S49 family peptidase	NA	G8DCP1	Silicibacter_phage	54.7	3.7e-44
WP_006495263.1|1623440_1624028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043204876.1|1624055_1624469_+|head	head decoration protein	head	NA	NA	NA	NA
WP_006495261.1|1624541_1625588_+|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	28.6	3.2e-31
WP_006495260.1|1625596_1625833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006495259.1|1625836_1626181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006495258.1|1626173_1626776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006495257.1|1626788_1626968_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_006495256.1|1626964_1628455_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	U5P0H3	Shigella_phage	43.9	4.0e-104
WP_006495255.1|1628524_1628899_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_006495254.1|1628902_1629463_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_144417364.1|1629522_1629630_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_006495253.1|1629626_1631051_+	DNA circularization N-terminal domain-containing protein	NA	U5P4I0	Shigella_phage	26.9	5.5e-26
WP_006495252.1|1631067_1632717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043204874.1|1632716_1633859_+	hypothetical protein	NA	M1FN92	Enterobacteria_phage	29.1	6.8e-27
WP_006495251.1|1633903_1634422_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	40.5	6.8e-27
WP_006495250.1|1634425_1634872_+	phage GP46 family protein	NA	A0A2P9JZK5	Alteromonadaceae_phage	39.1	3.7e-21
WP_006495249.1|1634873_1636037_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	28.6	2.1e-23
WP_043204872.1|1636043_1636640_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_043204920.1|1637488_1638190_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	55.1	2.1e-55
WP_043204919.1|1638422_1639283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006495243.1|1639433_1639616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029227429.1|1639608_1640106_+	lysozyme	NA	Q3HQU9	Burkholderia_phage	93.3	1.3e-83
WP_006495240.1|1640102_1640648_+	hypothetical protein	NA	NA	NA	NA	NA
1640542:1640557	attL	GGCACGAGGAAAGCGA	NA	NA	NA	NA
WP_043204868.1|1640644_1641124_+	DUF2514 family protein	NA	Q6J1Q4	Burkholderia_virus	71.6	4.1e-50
WP_080346052.1|1641235_1641613_-	reverse transcriptase N-terminal domain-containing protein	NA	A0A0U4J920	Pseudomonas_phage	59.3	1.3e-19
WP_043204867.1|1642256_1643336_-|integrase	tyrosine-type recombinase/integrase	integrase	I6NSG1	Burkholderia_phage	55.2	2.7e-110
WP_080346053.1|1643456_1644497_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_158380835.1|1644822_1645197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006495234.1|1645617_1646133_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_006484172.1|1646216_1646681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006495233.1|1646982_1647378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080346054.1|1647406_1647757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043204865.1|1648151_1648895_-	DUF695 domain-containing protein	NA	NA	NA	NA	NA
1647998:1648013	attR	TCGCTTTCCTCGTGCC	NA	NA	NA	NA
WP_006484174.1|1649078_1649387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052739275.1|1649715_1649913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006484195.1|1650073_1650547_+	VOC family protein	NA	A0A2K9L1J4	Tupanvirus	37.6	2.4e-18
WP_006495229.1|1650628_1651600_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.2	2.3e-12
WP_006484186.1|1651867_1652086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034201824.1|1652246_1652870_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.0	2.4e-18
WP_006495227.1|1653213_1653702_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006484216.1|1653889_1654327_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_006495225.1|1654475_1655528_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_006495224.1|1655605_1656892_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	43.4	1.5e-86
WP_006495223.1|1656927_1658349_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_006495222.1|1658511_1659465_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006495221.1|1659529_1660660_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
>prophage 6
NZ_HG938370	Burkholderia cenocepacia H111 chromosome 1	3572953	2597753	2651772	3572953	plate,protease,head,tail,capsid,portal,terminase	uncultured_Caudovirales_phage(33.33%)	61	NA	NA
WP_144417375.1|2597753_2598284_+	hypothetical protein	NA	Q8W6R9	Burkholderia_virus	45.1	1.0e-30
WP_144417376.1|2598314_2599031_-	immunity 52 family protein	NA	A4PE26	Ralstonia_virus	36.1	1.8e-22
WP_043205582.1|2599043_2599655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158380837.1|2599716_2600028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043205584.1|2600002_2600500_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_158380839.1|2600506_2600938_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_006497086.1|2601109_2601895_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	82.4	1.4e-132
WP_046337628.1|2602172_2602814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006497088.1|2602816_2603383_-	N-acetylmuramidase	NA	A0A0E3JI96	Rhodoferax_phage	53.7	2.0e-51
WP_006497089.1|2603379_2603829_-	hypothetical protein	NA	A0A0S0N2E7	Pseudomonas_phage	35.9	4.2e-17
WP_006497090.1|2603905_2604955_-	phage late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	47.2	4.7e-83
WP_006497091.1|2604964_2605171_-|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	61.2	2.4e-15
WP_006497092.1|2605145_2606024_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.9	3.0e-35
WP_006497093.1|2606034_2608476_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	37.6	5.1e-56
WP_006497094.1|2608556_2608859_-|tail	phage tail assembly protein	tail	A0A1B2LRV6	Wolbachia_phage	37.7	3.9e-06
WP_006497095.1|2608956_2609460_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	53.1	1.1e-42
WP_006497096.1|2609470_2610640_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	71.6	2.1e-156
WP_006497097.1|2610724_2611504_-|tail	tail assembly chaperone	tail	E5E3Q6	Burkholderia_phage	56.5	7.3e-57
WP_006497098.1|2611519_2613538_-|tail	tail fiber protein	tail	A4JWS9	Burkholderia_virus	51.8	1.1e-104
WP_006497099.1|2613525_2614104_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	45.4	2.5e-30
WP_043205585.1|2614093_2614990_-|plate	baseplate J/gp47 family protein	plate	A0A1J0I2M3	Salmonella_phage	40.8	1.4e-48
WP_006497102.1|2614986_2615322_-	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	48.1	2.5e-22
WP_006497103.1|2615321_2615522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043205587.1|2615581_2616262_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	29.1	3.8e-17
WP_006497106.1|2616265_2616790_-	hypothetical protein	NA	Q75QM3	Wolbachia_phage	42.0	8.4e-25
WP_043205589.1|2616779_2617310_-|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	31.0	5.4e-11
WP_006497108.1|2617312_2617600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006497110.1|2617601_2618597_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	62.7	9.5e-118
WP_006497111.1|2618670_2619015_-|head	head decoration protein	head	NA	NA	NA	NA
WP_006497112.1|2619045_2620113_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	37.6	1.4e-50
WP_043205590.1|2620109_2621603_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.6	2.9e-134
WP_006497114.1|2621599_2621806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006497115.1|2621819_2623805_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.8	1.9e-178
WP_006497116.1|2623767_2624337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006497118.1|2624869_2625643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006497119.1|2625863_2628371_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	40.2	3.4e-95
WP_043205594.1|2628631_2629015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006497122.1|2629001_2629544_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.2	2.2e-28
WP_043205599.1|2629932_2630361_+	transcriptional regulator	NA	A0A0P0J076	Acinetobacter_phage	64.4	4.5e-16
WP_006497124.1|2630817_2631036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043205601.1|2631085_2631448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006497126.1|2631447_2632746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043205638.1|2632847_2633207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043205602.1|2633199_2633577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043205604.1|2633573_2633807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043205606.1|2633859_2634813_+	DNA (cytosine-5-)-methyltransferase	NA	Q7Y4B5	Escherichia_virus	66.1	7.9e-122
WP_043205607.1|2634858_2635869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043205609.1|2635858_2636998_-	ParB N-terminal domain-containing protein	NA	Q858T2	Yersinia_virus	56.0	4.2e-93
WP_144417377.1|2639968_2641168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043205612.1|2642134_2642974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043205614.1|2643125_2643716_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	40.7	3.3e-25
WP_043205615.1|2643916_2645011_-	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_006497137.1|2645382_2646372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006497138.1|2646885_2647602_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_006487655.1|2647708_2648005_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_006487637.1|2648007_2648316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006487651.1|2648328_2648910_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_006487649.1|2649385_2649718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006497140.1|2649770_2650511_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006487662.1|2650626_2651250_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006497142.1|2651271_2651772_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
