The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017492	Lactococcus lactis subsp. cremoris A76, complete genome	2452616	14040	72577	2452616	tRNA,transposase	Bacillus_phage(23.08%)	47	NA	NA
WP_011675087.1|14040_14607_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_014571757.1|14607_18096_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_075070295.1|18364_18682_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_011675090.1|18712_19087_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_011675091.1|19086_19410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014571759.1|19550_20888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675093.1|20884_22153_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011675094.1|22133_22685_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	29.7	1.4e-09
WP_011675095.1|22890_24978_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	G8DDJ2	Micromonas_pusilla_virus	49.2	1.6e-106
WP_014571762.1|27927_29862_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_014571763.1|29908_30340_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_032940659.1|32312_33050_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003138385.1|33218_34394_+|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_014571767.1|35106_35472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675105.1|36405_36759_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_011675106.1|36880_37039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101961446.1|37098_38210_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_011675108.1|38692_39145_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011675109.1|39229_39472_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_014571770.1|39565_41188_-	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_011675112.1|41397_41919_+	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	42.1	1.0e-30
WP_014571771.1|42380_43556_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_014571772.1|43653_44409_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_010905074.1|44560_45979_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.0	3.0e-40
WP_011675116.1|46197_47784_-	dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
WP_014571773.1|47776_48757_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_014571774.1|48759_49884_-	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_011675119.1|49972_50974_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_011675120.1|51166_52021_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	31.4	7.8e-12
WP_014571776.1|52099_52750_-	HD domain-containing protein	NA	A0A1S5XYU7	Kurlavirus	33.3	8.9e-16
WP_095586744.1|52873_54021_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	2.3e-46
WP_155114612.1|54092_55465_-|transposase	IS3-like element ISLla3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.4	3.2e-55
WP_011675122.1|55534_55861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014571779.1|55917_56808_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011834182.1|56960_57986_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011675125.1|58484_58922_+	OsmC family protein	NA	NA	NA	NA	NA
WP_014571781.1|59083_60397_+	APC family permease	NA	NA	NA	NA	NA
WP_011675127.1|60475_61471_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_014571782.1|61573_62386_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011675129.1|62611_64249_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.9	4.8e-50
WP_014571783.1|64748_65003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675131.1|65121_65946_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011675132.1|66105_66687_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041168159.1|67388_68564_+|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.7	6.5e-33
WP_014571786.1|68934_70239_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A2I2L687	Orpheovirus	26.5	1.9e-09
WP_014571787.1|70504_71338_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014571779.1|71686_72577_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_017492	Lactococcus lactis subsp. cremoris A76, complete genome	2452616	76242	135421	2452616	integrase,tRNA,transposase	Bacillus_phage(23.08%)	55	72652:72669	106803:106820
72652:72669	attL	AACTAGCAATTCGGGTAA	NA	NA	NA	NA
WP_014571790.1|76242_77508_-|integrase	site-specific integrase	integrase	Q9AZK8	Lactococcus_phage	35.0	2.7e-53
WP_023163579.1|77595_77847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014571792.1|77896_79198_-	Plasmid replication protein Rep	NA	NA	NA	NA	NA
WP_014571793.1|79488_79752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127093928.1|79848_80100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014571795.1|80449_81535_-	cell division protein FtsK	NA	NA	NA	NA	NA
WP_152023959.1|82623_83331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003138385.1|85308_86484_-|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_032944811.1|86636_86954_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014571799.1|86987_87755_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_014571800.1|87794_88574_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_014571801.1|88583_89279_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_014571802.1|89333_90098_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_155114613.1|90246_90387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155114614.1|90527_91247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014571805.1|92480_93932_+	sugar transferase	NA	NA	NA	NA	NA
WP_014571806.1|94107_95157_+	NAD-dependent epimerase/dehydratase family protein	NA	E3T4Y8	Cafeteria_roenbergensis_virus	30.5	9.9e-33
WP_014571807.1|95174_96425_+	nucleotide sugar dehydrogenase	NA	M1HHY3	Acanthocystis_turfacea_Chlorella_virus	48.4	1.2e-104
WP_014571809.1|96457_97504_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI8	Catovirus	33.7	1.6e-30
WP_014571810.1|97496_98063_+	lipid carrier--UDP-N-acetylgalactosaminyltransferase	NA	NA	NA	NA	NA
WP_014571811.1|98077_99295_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014571812.1|99287_100463_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	51.9	5.2e-107
WP_014571813.1|100464_101214_+	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_014571814.1|101210_102311_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_155114650.1|102312_102900_+	acetyltransferase	NA	NA	NA	NA	NA
WP_014571816.1|102907_104110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014571817.1|104096_104927_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_014571818.1|104975_105167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014571819.1|105234_106404_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_014571820.1|106822_107713_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
106803:106820	attR	TTACCCGAATTGCTAGTT	NA	NA	NA	NA
WP_080561970.1|107829_108006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014571822.1|108172_109612_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_014571824.1|110756_111044_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155114615.1|111114_112262_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	1.6e-47
WP_001048115.1|112423_113422_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_101961446.1|114216_115328_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_014571828.1|115364_115517_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014571829.1|115963_116866_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_014571830.1|116890_117793_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003132258.1|118509_118659_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_010905107.1|118688_118862_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_014571832.1|119223_121005_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	29.6	2.8e-64
WP_014571835.1|122048_122834_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_011675146.1|122888_124148_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	45.5	5.1e-92
WP_014571836.1|124191_124680_-	GNAT family N-acetyltransferase	NA	A0A1B2ICF0	Erwinia_phage	50.9	1.1e-05
WP_011675148.1|124852_125320_+	DUF3013 family protein	NA	NA	NA	NA	NA
WP_014571837.1|125349_126903_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	27.9	1.2e-45
WP_014571838.1|126977_127262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014571839.1|127295_128036_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014571840.1|128022_128511_+	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_014571841.1|128523_129477_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_011675154.1|129596_130349_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_014571842.1|130378_131335_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011675156.1|131535_133758_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	U5J9N6	Bacillus_phage	28.3	2.2e-13
WP_014571845.1|134965_135421_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
>prophage 3
NC_017492	Lactococcus lactis subsp. cremoris A76, complete genome	2452616	438651	450808	2452616	tRNA	uncultured_virus(30.0%)	14	NA	NA
WP_011675460.1|438651_438969_+	thioredoxin family protein	NA	A0A0K2FIM3	Achromobacter_phage	31.9	9.0e-06
WP_011675461.1|439074_439701_+|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_014572047.1|439862_441203_+	SidA/IucD/PvdA family monooxygenase	NA	NA	NA	NA	NA
WP_011675463.1|441293_441683_+	single-stranded DNA-binding protein	NA	A0A218MNB4	uncultured_virus	45.7	2.9e-22
WP_011675464.1|441801_442086_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	43.0	2.3e-13
WP_011675465.1|442172_443801_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.8	2.2e-156
WP_011675466.1|443852_444665_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	38.1	1.5e-33
WP_011675468.1|444854_446282_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	32.9	3.9e-32
WP_003131580.1|446274_446976_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.7	1.2e-42
WP_014572049.1|447153_447789_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	66.0	9.1e-74
WP_011675470.1|447921_448782_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	44.8	3.1e-64
WP_011834464.1|448831_449614_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_011675472.1|449606_449933_+	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_014572050.1|449932_450808_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	66.1	1.2e-100
>prophage 4
NC_017492	Lactococcus lactis subsp. cremoris A76, complete genome	2452616	498174	503905	2452616	transposase	Lactococcus_phage(33.33%)	6	NA	NA
WP_155114618.1|498174_498321_+	hypothetical protein	NA	A0A1B1IMU6	Lactococcus_phage	94.6	1.9e-11
WP_014572082.1|498357_499038_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.5	5.0e-110
WP_014572083.1|499118_499532_+	C40 family peptidase	NA	A0A1P8BKR7	Lactococcus_phage	97.1	5.2e-54
WP_155114619.1|499605_500436_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.5	7.8e-57
WP_041168177.1|500597_501773_-|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_080561976.1|502972_503905_+	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	51.5	1.0e-81
>prophage 5
NC_017492	Lactococcus lactis subsp. cremoris A76, complete genome	2452616	590193	697926	2452616	terminase,portal,transposase,holin,capsid,integrase,tail,head	Lactococcus_phage(73.53%)	111	622605:622626	659567:659588
WP_155114620.1|590193_591304_+|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.8	1.5e-50
WP_011676818.1|591511_591694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041168177.1|591986_593162_-|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_014572140.1|593394_595176_-	DNA helicase RecQ	NA	A0A0G2Y8K9	Acanthamoeba_polyphaga_mimivirus	36.3	3.1e-71
WP_011676816.1|595405_596428_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.5	5.9e-30
WP_014572141.1|596448_596709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011676813.1|596790_598242_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_014572142.1|598452_600126_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_011676811.1|600195_600501_+	MGMT family protein	NA	NA	NA	NA	NA
WP_014572145.1|602547_603222_-	helix-turn-helix transcriptional regulator	NA	S4TZZ1	uncultured_phage	43.1	1.0e-06
WP_011676808.1|603457_604057_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_011676807.1|604325_607916_+	DNA-directed RNA polymerase subunit beta	NA	A0A2P0VMZ3	Tetraselmis_virus	24.5	8.3e-39
WP_080561995.1|608050_611647_+	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.3	2.8e-71
WP_014572147.1|611770_612679_+	diacylglycerol kinase family lipid kinase	NA	NA	NA	NA	NA
WP_014572148.1|612824_613511_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014572149.1|613510_614245_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	3.0e-36
WP_011676802.1|614373_615075_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_014572150.1|615077_616403_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_011676800.1|616578_617349_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	25.7	4.7e-08
WP_011676799.1|617488_618745_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_014572151.1|618744_619962_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.8	7.1e-107
WP_031286519.1|619963_620446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011676796.1|620579_621038_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A218MM29	uncultured_virus	32.1	4.5e-06
WP_004255207.1|621133_622546_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
622605:622626	attL	AAAGGGGCACTAAAGGGGCATA	NA	NA	NA	NA
WP_014572152.1|622748_623888_-|integrase	site-specific integrase	integrase	A0A1X9IGD8	Lactococcus_phage	73.6	1.9e-154
WP_014572153.1|624007_624382_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	98.4	3.6e-62
WP_014572154.1|624424_625012_-	hypothetical protein	NA	A5GYQ1	Lactococcus_phage	34.0	9.2e-12
WP_014572155.1|625070_625508_-	ImmA/IrrE family metallo-endopeptidase	NA	Q38182	Lactococcus_phage	99.3	6.3e-82
WP_010905682.1|625504_626047_-	helix-turn-helix domain-containing protein	NA	Q9B013	Lactococcus_phage	100.0	3.1e-91
WP_010905683.1|626215_626434_+	DUF739 family protein	NA	O48504	Lactococcus_phage	100.0	2.9e-35
WP_014572158.1|626470_627214_+	hypothetical protein	NA	O48505	Lactococcus_phage	100.0	2.8e-138
WP_014572159.1|627227_627488_+	hypothetical protein	NA	Q9AZF3	Lactococcus_phage	93.0	3.1e-44
WP_014572160.1|627644_627893_+	hypothetical protein	NA	Q77K30	Lactococcus_phage	67.1	1.6e-18
WP_080561996.1|627896_628067_+	hypothetical protein	NA	A0A059NT92	Lactococcus_phage	94.5	1.3e-22
WP_014572161.1|628169_629006_+	hypothetical protein	NA	A0A1P8BKZ1	Lactococcus_phage	83.0	6.3e-107
WP_014572166.1|630027_630804_+	DNA replication protein, phage-associated	NA	A0A1P8BKV2	Lactococcus_phage	98.8	2.9e-130
WP_014572167.1|630813_631698_+	ATP-binding protein	NA	A0A1P8BKV8	Lactococcus_phage	99.7	3.5e-164
WP_014572168.1|631694_631859_+	hypothetical protein	NA	Q8LTN0	Lactococcus_phage	96.3	1.6e-22
WP_011676027.1|631848_632238_+	RusA family crossover junction endodeoxyribonuclease	NA	R9QLL1	Lactococcus_phage	99.2	9.2e-69
WP_032950022.1|632241_632478_+	DUF1031 domain-containing protein	NA	A0A1B1IMV7	Lactococcus_phage	89.9	7.1e-32
WP_014572169.1|632592_632772_+	DUF1497 domain-containing protein	NA	Q9AYU3	Lactococcus_phage	98.3	4.6e-23
WP_014572170.1|632761_633328_+	DUF658 domain-containing protein	NA	Q38104	Lactococcus_phage	94.7	3.8e-87
WP_014572171.1|633338_633728_+	hypothetical protein	NA	A0A1P8BKW8	Lactococcus_phage	99.2	2.6e-71
WP_011676933.1|633724_633931_+	DUF1125 domain-containing protein	NA	A0A1P8BL00	Lactococcus_phage	100.0	2.4e-31
WP_014572172.1|633923_634424_+	DUF1642 domain-containing protein	NA	Q9AYU5	Lactococcus_phage	55.6	1.5e-42
WP_014572173.1|634420_634840_+	dUTP diphosphatase	NA	A5GYP0	Lactococcus_phage	97.8	2.1e-71
WP_010905946.1|634892_635036_+	hypothetical protein	NA	A0A1P8BMD9	Lactococcus_phage	100.0	2.1e-18
WP_032950027.1|635032_635206_+	DUF1660 domain-containing protein	NA	A0A1P8BLJ5	Lactococcus_phage	96.4	1.7e-27
WP_014572177.1|635932_636355_+	DUF722 domain-containing protein	NA	Q9AZ68	Lactococcus_phage	97.9	4.7e-50
WP_011676523.1|636782_637193_+|terminase	terminase	terminase	Q9AZ67	Lactococcus_phage	100.0	1.4e-67
WP_041168187.1|637185_638574_+|terminase	phage terminase large subunit	terminase	Q8LTR4	Lactococcus_phage	97.8	5.0e-266
WP_014572179.1|638588_639977_+|portal	phage portal protein	portal	Q9AZ65	Lactococcus_phage	92.8	2.0e-238
WP_041168188.1|639963_640152_+	hypothetical protein	NA	A0A1P8BM11	Lactococcus_phage	91.9	2.4e-22
WP_014572180.1|640155_641850_+	hypothetical protein	NA	Q9AZ64	Lactococcus_phage	98.8	0.0e+00
WP_014572181.1|641864_642092_+	hypothetical protein	NA	Q9AZ63	Lactococcus_phage	97.3	5.4e-37
WP_014572182.1|642206_642869_+	DUF4355 domain-containing protein	NA	B5SP30	Lactococcus_phage	98.2	1.0e-75
WP_014572183.1|642870_643689_+|capsid	N4-gp56 family major capsid protein	capsid	B5SP31	Lactococcus_phage	100.0	1.8e-143
WP_014570729.1|643688_643886_+	hypothetical protein	NA	B5SP32	Lactococcus_phage	100.0	2.8e-29
WP_014572184.1|643872_644205_+|head,tail	phage head-tail connector protein	head,tail	B5SP33	Lactococcus_phage	98.2	3.9e-52
WP_014572185.1|644201_644513_+	hypothetical protein	NA	B5SP34	Lactococcus_phage	97.1	1.3e-54
WP_014572186.1|644509_644836_+	HK97 gp10 family phage protein	NA	A0A1P8BKS5	Lactococcus_phage	96.3	5.0e-52
WP_014572187.1|644832_645222_+	hypothetical protein	NA	Q77K20	Lactococcus_phage	98.4	1.6e-65
WP_014572188.1|645232_645742_+|tail	phage major tail protein, TP901-1 family	tail	Q77K19	Lactococcus_phage	98.2	4.0e-88
WP_014572189.1|645857_646208_+	hypothetical protein	NA	B5SP38	Lactococcus_phage	100.0	5.0e-58
WP_014572190.1|646291_646561_+	hypothetical protein	NA	A0A1P8BKT4	Lactococcus_phage	97.8	4.3e-41
WP_014572191.1|646576_648790_+	tape measure protein	NA	B5SP40	Lactococcus_phage	97.0	3.5e-298
WP_014572192.1|648799_649561_+	hypothetical protein	NA	Q9AZ58	Lactococcus_phage	98.0	3.0e-140
WP_003331415.1|649657_650881_+|transposase	IS21-like element IS712 family transposase	transposase	A0A059NT83	Lactococcus_phage	100.0	4.9e-233
WP_003331414.1|650892_651651_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	100.0	5.3e-137
WP_155114652.1|651756_654609_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1P8BKJ9	Lactococcus_phage	92.0	0.0e+00
WP_014572195.1|654621_656673_+	DUF2479 domain-containing protein	NA	A0A1L2JXK8	Streptococcus_phage	72.8	6.5e-137
WP_041168189.1|657088_657394_+	hypothetical protein	NA	Q8LTP6	Lactococcus_phage	93.9	3.2e-48
WP_014572197.1|657380_657653_+|holin	phage holin	holin	A0A1P8BKR5	Lactococcus_phage	89.7	4.2e-36
WP_014572198.1|657649_658996_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A1P8BMS7	Lactococcus_phage	95.8	5.9e-248
WP_041168304.1|659029_659224_-	hypothetical protein	NA	A5GYL5	Lactococcus_phage	60.6	7.4e-11
WP_011676794.1|660067_660358_+	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
659567:659588	attR	AAAGGGGCACTAAAGGGGCATA	NA	NA	NA	NA
WP_014572199.1|660465_660936_+	type VII secretion protein EssA	NA	NA	NA	NA	NA
WP_155114621.1|660998_662110_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	4.2e-50
WP_011835701.1|662308_662965_+	thiaminase II	NA	NA	NA	NA	NA
WP_011676777.1|663351_664530_+	cation transporter	NA	NA	NA	NA	NA
WP_014572201.1|664702_665263_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_014572202.1|665883_666816_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	3.1e-22
WP_014572203.1|666812_668174_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_080561977.1|668866_670201_+	ComEC family DNA internalization-related competence protein	NA	NA	NA	NA	NA
WP_014572207.1|670205_671096_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014572209.1|671841_672732_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014572211.1|673341_674118_+	esterase family protein	NA	NA	NA	NA	NA
WP_014572212.1|674300_674516_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_004255255.1|674562_675276_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_010906128.1|675290_675797_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_014572213.1|675798_676326_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_014572214.1|676513_678016_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_011676766.1|678031_678901_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_011676765.1|679072_680482_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_011676764.1|680666_681092_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_014572215.1|681207_681855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014572216.1|681855_682557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014572217.1|683751_684000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032950478.1|684122_684656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011676756.1|684712_685456_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.0	4.1e-33
WP_014572219.1|685478_687623_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014572220.1|687990_688647_+	DedA family protein	NA	NA	NA	NA	NA
WP_011676753.1|688824_689685_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_014572221.1|689681_690752_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_014572222.1|690865_691789_+	DMT family transporter	NA	NA	NA	NA	NA
WP_014572223.1|692160_692760_+	DUF1054 family protein	NA	NA	NA	NA	NA
WP_014572224.1|692764_693361_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_014572225.1|693391_694558_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	34.7	4.8e-36
WP_011676747.1|694679_695036_+	YxeA family protein	NA	NA	NA	NA	NA
WP_088792927.1|695588_696699_+|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_155114622.1|696815_697926_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.1	3.6e-49
>prophage 7
NC_017492	Lactococcus lactis subsp. cremoris A76, complete genome	2452616	854180	862230	2452616	transposase	Enterobacteria_phage(14.29%)	7	NA	NA
WP_014572319.1|854180_855473_+	uracil-xanthine permease	NA	Q9KX94	Enterobacteria_phage	35.9	4.8e-61
WP_014572320.1|855628_856561_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	30.2	3.7e-23
WP_011676639.1|856648_857722_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.1	1.5e-60
WP_155114623.1|857856_859228_+|transposase	IS3-like element ISLla3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.4	3.2e-55
WP_095586744.1|859301_860448_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	2.3e-46
WP_014572323.1|860617_861388_-	hypothetical protein	NA	Q38326	Lactococcus_phage	75.6	9.7e-70
WP_041168192.1|861825_862230_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	47.4	1.7e-28
>prophage 8
NC_017492	Lactococcus lactis subsp. cremoris A76, complete genome	2452616	940129	1065048	2452616	transposase	Bacillus_phage(20.59%)	108	NA	NA
WP_014572384.1|940129_942733_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	32.7	8.0e-124
WP_014572385.1|942922_943939_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.5	1.1e-60
WP_014572386.1|943967_944516_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	32.0	8.6e-20
WP_041168198.1|944706_946296_+	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	34.1	5.0e-12
WP_014572388.1|946311_946878_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014572391.1|948086_948767_+|transposase	IS6-like element ISS1S family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	5.5e-109
WP_011676466.1|948966_949509_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	30.6	4.7e-10
WP_014572393.1|949685_951242_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.5	1.6e-71
WP_011676464.1|951361_952054_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_011676462.1|953590_954217_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080513962.1|954607_955852_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_011676460.1|955923_956652_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_011676459.1|956648_957134_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.4	1.4e-21
WP_014572396.1|957189_958296_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_014572399.1|959495_960815_+	xylose isomerase	NA	NA	NA	NA	NA
WP_014572400.1|960921_961746_+	glycoside hydrolase family 11 protein	NA	NA	NA	NA	NA
WP_014572401.1|961821_963327_+	xylulokinase	NA	NA	NA	NA	NA
WP_014572402.1|963329_964379_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_014572403.1|964402_965878_+	MFS transporter	NA	NA	NA	NA	NA
WP_014572406.1|969094_970132_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_011669063.1|970212_970464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014572407.1|970592_970787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011669046.1|970887_971469_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	41.4	3.1e-36
WP_011669047.1|971473_973399_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	36.6	5.7e-34
WP_021166320.1|973831_974242_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021214628.1|975009_975432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014572414.1|976251_976752_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_101961446.1|977216_978327_+|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_014572418.1|979265_979967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041168199.1|980001_980298_-	DNA polymerase	NA	NA	NA	NA	NA
WP_014572420.1|980436_981174_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014572421.1|981166_982069_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.9	5.7e-21
WP_031559158.1|982114_982513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153017358.1|982509_982863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050800243.1|983278_983611_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155114624.1|984877_986003_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	43.3	1.3e-54
WP_014572428.1|986198_986453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011676451.1|986455_987151_+	peptidase E	NA	NA	NA	NA	NA
WP_014572429.1|987241_987421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014572430.1|987453_988062_+	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_014572431.1|988095_989535_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_011676447.1|989576_990446_+	ROK family protein	NA	NA	NA	NA	NA
WP_014572432.1|990519_991395_+	ROK family protein	NA	NA	NA	NA	NA
WP_014572433.1|991604_993146_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.3	7.0e-19
WP_014572434.1|993479_994370_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_014572435.1|994380_995244_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_014572436.1|995315_996950_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_014572437.1|997069_997768_+	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_014572438.1|997790_1000205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127005270.1|1004070_1005181_+|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	2.1e-49
WP_014572444.1|1005357_1005777_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014572445.1|1006038_1007784_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_155114626.1|1009114_1010261_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	2.3e-46
WP_155114628.1|1010318_1011691_-|transposase	IS3-like element ISLla3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.4	7.1e-55
WP_014572448.1|1011984_1012716_-	SDR family oxidoreductase	NA	A0A2P0VP75	Tetraselmis_virus	28.8	7.2e-06
WP_014572291.1|1014266_1015157_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014572452.1|1015337_1015724_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_014572453.1|1015850_1016540_+	VIT family protein	NA	NA	NA	NA	NA
WP_014572454.1|1016539_1017220_+	VIT family protein	NA	NA	NA	NA	NA
WP_014572455.1|1017295_1018039_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011834955.1|1018148_1018568_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041168322.1|1018579_1019218_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_014572457.1|1019232_1019592_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_014572460.1|1021468_1022050_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.1	3.2e-33
WP_011834959.1|1022054_1023062_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	35.9	6.6e-50
WP_021212238.1|1023259_1023754_+	DUF2806 domain-containing protein	NA	NA	NA	NA	NA
WP_011676422.1|1023807_1024062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155114653.1|1024406_1024691_+	DUF3977 family protein	NA	NA	NA	NA	NA
WP_011676419.1|1024683_1025052_+	VOC family protein	NA	NA	NA	NA	NA
WP_011676418.1|1025058_1025853_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	35.5	1.7e-29
WP_014572463.1|1025842_1026901_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_014572464.1|1026890_1027409_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014572465.1|1027507_1028713_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_011676414.1|1028712_1029474_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_014572468.1|1030592_1032503_+	PTS beta-glucoside transporter subunit EIIBCA	NA	NA	NA	NA	NA
WP_014572469.1|1032550_1033987_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_011676410.1|1034152_1034773_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011676409.1|1034984_1036208_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.9	5.0e-28
WP_014572470.1|1036200_1037922_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014572471.1|1038112_1038283_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_011676405.1|1039179_1040502_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	46.1	3.0e-111
WP_014572475.1|1040483_1041026_+	ParB-like nuclease domain-containing protein	NA	A0A220GKT8	Streptococcus_phage	66.1	5.8e-61
WP_011676403.1|1041055_1041358_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SAD3	Streptococcus_phage	51.7	6.0e-07
WP_014572476.1|1041639_1042584_+	cation transporter	NA	NA	NA	NA	NA
WP_011676401.1|1042637_1043069_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_014572477.1|1043139_1044060_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	37.7	1.9e-32
WP_011834977.1|1044248_1044845_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014572479.1|1044879_1046172_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	53.3	2.3e-116
WP_011676397.1|1046173_1046362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011676396.1|1046374_1047037_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_011676395.1|1047023_1047416_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_014572480.1|1047683_1048739_+	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	41.5	5.1e-61
WP_014572481.1|1048925_1049633_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041168202.1|1049640_1050081_-	DUF4395 domain-containing protein	NA	NA	NA	NA	NA
WP_011676391.1|1050178_1051732_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	37.3	1.0e-33
WP_014572484.1|1051721_1052432_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011676389.1|1052615_1052951_+	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_014572485.1|1053794_1054685_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011676387.1|1054744_1055275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095586744.1|1055428_1056575_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	2.3e-46
WP_155114616.1|1056631_1057555_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.8	1.2e-55
WP_014571872.1|1057446_1058016_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014572486.1|1058573_1059368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003331414.1|1059525_1060284_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	100.0	5.3e-137
WP_080561981.1|1061726_1062206_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_041168204.1|1062316_1063462_+|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.4e-32
WP_153927135.1|1063740_1063917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155114630.1|1063937_1065048_+|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	2.1e-49
>prophage 9
NC_017492	Lactococcus lactis subsp. cremoris A76, complete genome	2452616	1085186	1134347	2452616	protease,tRNA,transposase	Bacillus_phage(16.67%)	43	NA	NA
WP_014572502.1|1085186_1086077_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_041168206.1|1086434_1087610_-|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	31.9	2.1e-31
WP_014572505.1|1087724_1088285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155114632.1|1088321_1089432_+|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.1	4.7e-49
WP_014572507.1|1089545_1090151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041168325.1|1090707_1093110_+	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_011676080.1|1093374_1094043_+	DnaD domain-containing protein	NA	C5J987	Streptococcus_phage	31.4	1.1e-05
WP_011676081.1|1094064_1094721_+	endonuclease III	NA	NA	NA	NA	NA
WP_014572509.1|1094713_1095403_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_014572510.1|1095399_1096173_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_014572511.1|1096207_1096573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011835342.1|1096711_1097527_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_014572512.1|1097591_1098935_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.4	8.0e-27
WP_011676087.1|1099107_1099506_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_011676088.1|1099498_1100674_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_003130644.1|1100843_1101158_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_011676089.1|1101160_1101496_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003130646.1|1101497_1101782_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_021212212.1|1103660_1104629_+	phosphate starvation-inducible protein PhoH	NA	H6X2N1	Pseudomonas_phage	48.4	2.0e-48
WP_014572516.1|1104698_1105193_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011835335.1|1105283_1105772_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011676094.1|1105755_1106211_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_011676095.1|1106227_1106806_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_014572517.1|1106930_1107785_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011676097.1|1109870_1110506_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	54.5	6.6e-56
WP_014572521.1|1110547_1111048_+	glycopeptide antibiotics resistance protein	NA	NA	NA	NA	NA
WP_011676098.1|1111113_1112133_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	43.4	5.2e-55
WP_011676100.1|1113244_1113892_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_011676101.1|1113891_1114845_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_014572524.1|1114844_1116866_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_011676103.1|1116973_1117216_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_014572526.1|1118846_1119440_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_021165242.1|1120007_1121495_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	42.8	3.6e-97
WP_021165243.1|1121491_1121980_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011676109.1|1122036_1122861_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	55.3	6.5e-72
WP_011676110.1|1123062_1123764_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	2.9e-36
WP_014572527.1|1123767_1126374_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014572528.1|1126447_1127233_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_014572529.1|1127233_1128583_-	Mur ligase family protein	NA	NA	NA	NA	NA
WP_014572530.1|1128678_1129344_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_014572531.1|1129616_1131440_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	38.8	7.5e-20
WP_011676116.1|1131506_1132142_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_101961446.1|1133236_1134347_+|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
>prophage 10
NC_017492	Lactococcus lactis subsp. cremoris A76, complete genome	2452616	1204081	1273546	2452616	tRNA,transposase	Staphylococcus_phage(30.0%)	54	NA	NA
WP_041168177.1|1204081_1205257_+|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_014572590.1|1205391_1206573_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_014572591.1|1206605_1208267_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_155114636.1|1208760_1209872_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.1	3.6e-49
WP_011676291.1|1210531_1211599_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	41.5	1.2e-54
WP_011676292.1|1211761_1212094_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014572594.1|1212769_1213687_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_014572597.1|1214940_1215087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014572598.1|1215265_1215973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014572599.1|1216599_1217670_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_014572600.1|1217719_1219066_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_014572601.1|1219137_1221264_-	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.6	5.5e-99
WP_014572602.1|1221529_1222378_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_014572603.1|1222526_1222907_-	RidA family protein	NA	NA	NA	NA	NA
WP_011676302.1|1222946_1223657_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_041168215.1|1223799_1224975_-|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_014572605.1|1225112_1226363_-	threonine ammonia-lyase IlvA	NA	NA	NA	NA	NA
WP_014572608.1|1227491_1227968_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_014572609.1|1227955_1229689_-	acetolactate synthase large subunit	NA	A9YVT5	Ostreococcus_tauri_virus	27.6	1.7e-42
WP_014572612.1|1231531_1232314_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	1.0e-13
WP_014572613.1|1232327_1232903_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_014572614.1|1232945_1233479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014572615.1|1233478_1234855_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_014572616.1|1234911_1235364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014572617.1|1235406_1235874_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011676139.1|1235875_1236907_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_021215491.1|1237047_1237839_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_011676141.1|1237865_1238351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011835164.1|1240350_1241310_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_014572622.1|1241342_1242128_-	histidinol-phosphatase HisJ family protein	NA	NA	NA	NA	NA
WP_014572623.1|1242128_1242779_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_014572624.1|1242775_1243555_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_014572625.1|1243523_1244264_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_011676148.1|1244263_1244872_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_031286436.1|1244916_1245687_-	aminoglycoside 3'-phosphotransferase	NA	A0A193CJY5	Infectious_laryngotracheitis_virus	26.1	5.6e-09
WP_014572626.1|1245698_1246307_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_014572632.1|1248335_1249292_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_014572633.1|1249291_1250362_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_014572634.1|1250882_1251674_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_014572637.1|1253400_1254291_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011676158.1|1254956_1255436_-	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_011676161.1|1257964_1258297_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014572637.1|1259418_1260309_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014572641.1|1260625_1261024_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014572642.1|1261131_1262277_+	MFS transporter	NA	NA	NA	NA	NA
WP_011835185.1|1262383_1264048_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_014572643.1|1264202_1265459_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011676167.1|1265486_1266659_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_014572645.1|1266724_1267345_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014572646.1|1267346_1268954_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014572647.1|1268998_1270369_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	56.0	4.9e-141
WP_014572648.1|1270431_1271253_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014572649.1|1271390_1272095_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_101961446.1|1272434_1273546_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
>prophage 11
NC_017492	Lactococcus lactis subsp. cremoris A76, complete genome	2452616	1334059	1404920	2452616	transposase	Bacillus_phage(33.33%)	57	NA	NA
WP_155114630.1|1334059_1335171_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	2.1e-49
WP_014572694.1|1335383_1336274_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011676219.1|1336507_1337284_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	41.9	3.3e-25
WP_014572695.1|1337396_1338245_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_014572696.1|1338474_1338993_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_080562007.1|1339091_1339244_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_014572699.1|1340358_1341306_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041168222.1|1341910_1343086_-|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_014572703.1|1343472_1344186_-	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.9	1.5e-16
WP_011676315.1|1344966_1345197_-	DUF4176 domain-containing protein	NA	NA	NA	NA	NA
WP_014572706.1|1345448_1348589_-	SMC family ATPase	NA	NA	NA	NA	NA
WP_014572707.1|1348591_1349764_-	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_014572708.1|1349909_1350848_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_014572709.1|1351045_1351420_-	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_014572710.1|1352166_1355226_-	LPXTG cell wall anchor domain-containing protein	NA	Q9MCC0	Lactococcus_phage	48.2	2.7e-06
WP_011676322.1|1355568_1356012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014572712.1|1356316_1357939_+	fibronectin/fibrinogen-binding protein	NA	Q84500	Paramecium_bursaria_Chlorella_virus	32.1	5.5e-06
WP_014572713.1|1357980_1358796_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_014572714.1|1358977_1360498_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.5	4.8e-20
WP_014572715.1|1360490_1361585_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011676327.1|1361581_1362535_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003131075.1|1362651_1363629_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_011676328.1|1363746_1365255_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_003131080.1|1365342_1366365_-	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
WP_014572716.1|1366752_1367901_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_011676330.1|1368071_1369250_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.8	1.5e-37
WP_011835023.1|1369391_1370018_-	XpaC-like protein	NA	NA	NA	NA	NA
WP_011676332.1|1370208_1371237_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_014572717.1|1371278_1372220_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.2	4.8e-79
WP_011676334.1|1372290_1372698_+	NusG domain II-containing protein	NA	NA	NA	NA	NA
WP_011676335.1|1372694_1373225_+	heptaprenyl diphosphate synthase subunit I	NA	NA	NA	NA	NA
WP_014572719.1|1373215_1374175_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_014572720.1|1374171_1374888_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_014572721.1|1374896_1375355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011676339.1|1375356_1376070_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_014572722.1|1376199_1377135_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_014572723.1|1377365_1378154_-	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_014572724.1|1378403_1379780_-	MFS transporter	NA	NA	NA	NA	NA
WP_014572725.1|1379976_1380693_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011676344.1|1380763_1382191_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_014572726.1|1382200_1382941_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011676346.1|1382941_1383487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011676347.1|1383483_1384320_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_014572727.1|1384319_1385273_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_011676350.1|1386742_1387672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014572730.1|1387772_1388711_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_011676351.1|1388877_1390089_+	virion core protein	NA	NA	NA	NA	NA
WP_011676352.1|1390302_1391454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014572734.1|1392271_1392805_-	rRNA large subunit pseudouridine synthase E	NA	NA	NA	NA	NA
WP_014572735.1|1393104_1394622_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_014572736.1|1394674_1396252_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_014572741.1|1399615_1400428_-	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_095586744.1|1400684_1401832_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	2.3e-46
WP_155114616.1|1401905_1402829_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.8	1.2e-55
WP_014571872.1|1402720_1403290_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014572742.1|1403352_1403493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155114630.1|1403808_1404920_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	2.1e-49
>prophage 12
NC_017492	Lactococcus lactis subsp. cremoris A76, complete genome	2452616	1423927	1437645	2452616		Bacillus_virus(25.0%)	11	NA	NA
WP_014572755.1|1423927_1426402_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.9	4.6e-97
WP_014572756.1|1426674_1427124_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011675992.1|1427120_1427954_-	3'-5' exonuclease	NA	A0A0K2SUJ2	Clostridium_phage	40.0	5.3e-21
WP_014572759.1|1428557_1430492_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	43.2	4.1e-125
WP_011675988.1|1430770_1431412_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_011675987.1|1431585_1431804_+	redoxin NrdH	NA	C3U2K9	Lactococcus_phage	47.6	5.8e-12
WP_011675986.1|1431805_1432228_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	36.4	1.7e-12
WP_011675985.1|1432364_1434533_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.7	3.3e-256
WP_011675984.1|1434937_1435915_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	65.7	6.0e-117
WP_014572761.1|1436024_1436960_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011675982.1|1436952_1437645_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.8	1.6e-31
>prophage 13
NC_017492	Lactococcus lactis subsp. cremoris A76, complete genome	2452616	1442917	1507320	2452616	integrase,transposase	Streptococcus_phage(33.33%)	55	1445553:1445612	1488577:1488770
WP_155114626.1|1442917_1444064_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	2.3e-46
WP_155114638.1|1444121_1445497_-|transposase	IS3-like element ISLla3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.3	1.0e-53
1445553:1445612	attL	AAAAGAAGGTTCTTTTTCCTAACGAGGAGGCTCTGGAACGTTACTTAGTTACTTTGTTTG	NA	NA	NA	NA
WP_014572765.1|1445827_1447330_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014572766.1|1447429_1448338_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	3.4e-21
WP_011675975.1|1448626_1449184_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011675974.1|1449216_1450134_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	43.9	2.2e-60
WP_011675973.1|1450229_1451213_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	65.2	1.0e-119
WP_011675972.1|1451209_1452097_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_014572767.1|1452161_1453607_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_014572768.1|1453721_1454975_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4M3	Streptococcus_phage	23.5	4.2e-14
WP_031559593.1|1455085_1455301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014572770.1|1455326_1455572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014572771.1|1455956_1457741_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1X9I6C7	Streptococcus_phage	31.3	3.6e-75
WP_014572772.1|1457786_1458827_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	44.1	8.2e-72
WP_014572773.1|1458816_1459221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021212409.1|1460676_1461453_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_014572777.1|1461791_1463006_-	MFS transporter	NA	NA	NA	NA	NA
WP_080562010.1|1463091_1463922_-	nucleotide sugar dehydrogenase	NA	M1HIV9	Acanthocystis_turfacea_Chlorella_virus	52.2	2.4e-74
WP_010890648.1|1463979_1464660_-|transposase	IS6-like element ISS1S family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.5	8.5e-110
WP_014572779.1|1464691_1466494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011675956.1|1466656_1468480_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	45.8	3.4e-129
WP_014572780.1|1468551_1469091_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_011675904.1|1469120_1470164_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_011675903.1|1470311_1470716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014572781.1|1470730_1471477_-	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_011675901.1|1471473_1472169_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_014572782.1|1472239_1472719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011675899.1|1472814_1474152_-	PFL family protein	NA	NA	NA	NA	NA
WP_011675898.1|1474268_1474532_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_014572784.1|1474685_1475627_+	prenyltransferase	NA	NA	NA	NA	NA
WP_041168225.1|1475650_1476709_-	endonuclease	NA	NA	NA	NA	NA
WP_041168338.1|1476786_1477374_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_041168226.1|1477392_1479846_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	44.2	1.7e-104
WP_011675893.1|1480087_1480336_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_014572788.1|1480476_1481403_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	51.1	2.0e-85
WP_075070694.1|1481600_1481825_-	DUF4059 family protein	NA	NA	NA	NA	NA
WP_014572789.1|1481829_1482582_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	1.8e-28
WP_014572790.1|1482593_1483481_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014572792.1|1483749_1484598_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021211092.1|1484740_1485334_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	43.5	2.4e-15
WP_011675886.1|1485442_1487110_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_011675885.1|1487270_1487597_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011675884.1|1487680_1488127_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_014572795.1|1490704_1491412_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
1488577:1488770	attR	CAAACAAAGTAACTAAGTAACGTTCCAGAGCCTCCTCGTTAGGAAAAAGAACCTTCTTTTTCGTTTGACGTTTGATTTCTTTGTTAAGAGACTCAATGAGGTTTGTCGAATAAATGCTGTGCCAAATCTGGTAGGGAAACTGATAAAAAGTTAAAAGATTATCCGTATTCTCCAGACTTTCCATGACTTTCCTA	NA	NA	NA	NA
WP_021165163.1|1491482_1491752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011675881.1|1491809_1493045_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_014572797.1|1493238_1494159_-	LCP family protein	NA	NA	NA	NA	NA
WP_014572798.1|1494169_1495285_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_014572800.1|1495523_1496414_-|transposase	IS982-like element IS982B family transposase	transposase	NA	NA	NA	NA
WP_155114654.1|1496514_1499526_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_014572802.1|1500943_1501750_-	Teichoic acid translocation permease TagG	NA	NA	NA	NA	NA
WP_014572803.1|1501762_1503139_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_050800251.1|1503182_1503626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011675875.1|1505357_1506266_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_014572807.1|1506429_1507320_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NC_017492	Lactococcus lactis subsp. cremoris A76, complete genome	2452616	1535277	1577145	2452616	transposase	Staphylococcus_phage(28.57%)	38	NA	NA
WP_041168177.1|1535277_1536453_+|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_003131392.1|1536733_1537066_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_014572832.1|1537254_1539126_-	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_014572833.1|1539260_1540151_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014572835.1|1540822_1541356_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011675848.1|1541417_1541780_-	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_014572836.1|1541947_1542373_-	universal stress protein	NA	NA	NA	NA	NA
WP_011675845.1|1542925_1543651_-	nicotinamide mononucleotide transporter	NA	A0A2P0ZKW0	Lactobacillus_phage	28.7	1.4e-14
WP_011675844.1|1543923_1544169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014572837.1|1544231_1544789_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_014572838.1|1545019_1546348_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_041168344.1|1546340_1546850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011675840.1|1547103_1547565_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014572840.1|1547902_1548319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675838.1|1548494_1548839_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_014572843.1|1549691_1550582_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_003138385.1|1550883_1552059_+|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_011675836.1|1552161_1553049_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011835483.1|1553408_1554071_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	1.4e-21
WP_011675833.1|1555841_1556126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011835486.1|1556324_1557314_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_041168228.1|1557388_1559686_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_011675830.1|1559682_1560063_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_011835489.1|1560218_1561172_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_014572848.1|1561403_1562330_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_014572849.1|1562351_1562873_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_011675826.1|1562967_1563534_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_011675824.1|1564235_1565903_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_011675823.1|1566082_1566529_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_014572851.1|1566525_1567332_-	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_014572852.1|1567407_1567908_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014572853.1|1567908_1568766_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_014572854.1|1568990_1570136_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.8	1.0e-46
WP_014572855.1|1570194_1571085_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011675817.1|1571311_1571551_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_031286477.1|1571553_1572807_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	32.3	1.2e-45
WP_014572856.1|1572977_1573865_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.3	9.2e-40
WP_014572314.1|1576254_1577145_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NC_017492	Lactococcus lactis subsp. cremoris A76, complete genome	2452616	1589366	1654357	2452616	tRNA,transposase	Staphylococcus_phage(21.05%)	48	NA	NA
WP_041168177.1|1589366_1590542_-|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_041168229.1|1590626_1590959_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SAD3	Streptococcus_phage	48.4	7.7e-08
WP_014572864.1|1591933_1593094_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_041168230.1|1593191_1595201_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011675796.1|1595296_1596010_-	nicotinamide mononucleotide transporter	NA	A0A1S6UAV8	Serratia_phage	23.6	5.5e-11
WP_041168231.1|1596027_1596714_-	nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_087942906.1|1596662_1598035_-|transposase	IS3-like element ISLla3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.4	7.1e-55
WP_014572868.1|1598369_1599518_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.4	5.8e-18
WP_014572869.1|1599666_1600335_-	response regulator transcription factor	NA	Q6XLV6	Feldmannia_irregularis_virus	31.2	5.0e-06
WP_041168177.1|1600464_1601640_+|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_014572871.1|1601774_1602806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003132594.1|1603001_1604228_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_031286465.1|1604481_1605612_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_011675790.1|1605926_1606712_+	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
WP_014572872.1|1606782_1609434_+	YfhO family protein	NA	NA	NA	NA	NA
WP_011675787.1|1609635_1611798_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.0	4.3e-99
WP_011675786.1|1611983_1612184_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_011835521.1|1612202_1612658_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_014572873.1|1612778_1613642_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_011675783.1|1613661_1614333_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	NA	NA	NA	NA	NA
WP_041168177.1|1614447_1615623_+|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_014572874.1|1615766_1617770_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014572875.1|1617910_1619170_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_095586744.1|1619390_1620537_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	2.3e-46
WP_155114612.1|1620593_1621966_-|transposase	IS3-like element ISLla3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.4	3.2e-55
WP_011675954.1|1622037_1622400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041168232.1|1622536_1623340_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014572877.1|1623486_1624851_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_011675950.1|1627421_1629911_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.1	0.0e+00
WP_014572880.1|1629981_1630653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014572881.1|1630776_1631751_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	36.6	2.2e-42
WP_014572882.1|1631931_1633326_-	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	36.3	1.9e-15
WP_011675947.1|1633387_1633939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014572883.1|1633948_1634758_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_014572884.1|1635123_1636464_+	amino acid permease	NA	NA	NA	NA	NA
WP_014572885.1|1636513_1637275_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_050800256.1|1637271_1638390_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_011675941.1|1638482_1638893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011675940.1|1638987_1641156_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	43.2	3.5e-141
WP_014572889.1|1641398_1644923_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_011675938.1|1644912_1645608_-	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	33.0	1.5e-21
WP_014572890.1|1645786_1646359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014572895.1|1648271_1649405_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.3	6.3e-25
WP_014572896.1|1649422_1650610_-	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_014572897.1|1650621_1651644_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_155114639.1|1651822_1652969_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	1.7e-46
WP_011677176.1|1653023_1653605_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155114640.1|1653496_1654357_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	1.3e-51
>prophage 16
NC_017492	Lactococcus lactis subsp. cremoris A76, complete genome	2452616	1760815	1797200	2452616	bacteriocin,protease,transposase	Bacillus_phage(40.0%)	27	NA	NA
WP_011675663.1|1760815_1761514_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011675662.1|1761533_1761683_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_011675661.1|1761782_1762040_-	helix-turn-helix transcriptional regulator	NA	S5MAC0	Brevibacillus_phage	42.4	1.6e-05
WP_014572977.1|1764147_1766550_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.9e-10
WP_014572980.1|1768160_1769300_-	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_014572981.1|1769289_1770432_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_021166183.1|1772757_1773735_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_011675653.1|1773727_1774129_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_011675652.1|1774275_1774833_-	elongation factor P	NA	NA	NA	NA	NA
WP_014572985.1|1774964_1776023_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_011675650.1|1776130_1777015_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_014572986.1|1777144_1777705_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_011675648.1|1777682_1778216_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_041168357.1|1778249_1779023_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011675646.1|1779479_1779749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675645.1|1779752_1780025_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_080562011.1|1781677_1782499_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_014572991.1|1782587_1783478_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155114641.1|1783898_1785010_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	2.1e-49
WP_014572995.1|1787064_1788213_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003129597.1|1788594_1788993_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_075070705.1|1789161_1789668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011834647.1|1789887_1790487_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	52.6	7.1e-52
WP_014572998.1|1790526_1791765_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_014573001.1|1794326_1795652_-	citrate/2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_014571872.1|1795815_1796385_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155114616.1|1796276_1797200_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.8	1.2e-55
>prophage 17
NC_017492	Lactococcus lactis subsp. cremoris A76, complete genome	2452616	1945373	2014239	2452616	terminase,portal,transposase,holin,integrase,tRNA,tail,protease,head	Lactococcus_phage(83.02%)	83	1957437:1957453	2018540:2018556
WP_014573102.1|1945373_1948586_-	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	28.7	5.4e-122
WP_014573103.1|1948728_1949913_-	cell wall surface anchor protein	NA	A0A1P8BMN5	Lactococcus_phage	51.1	2.0e-05
WP_014573104.1|1949965_1951000_-	cell wall surface anchor protein	NA	NA	NA	NA	NA
WP_041168177.1|1951182_1952358_+|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_011675533.1|1952883_1953537_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	46.8	1.2e-52
WP_014573105.1|1953536_1954091_+	TIGR00730 family Rossman fold protein	NA	A0A1D3SNB7	Enterococcus_phage	47.1	1.1e-27
WP_014573106.1|1954074_1954554_+	nucleoside deoxyribosyltransferase	NA	A0A1D3SPR3	Enterococcus_phage	49.4	9.1e-34
WP_011834518.1|1954643_1954844_+	YjzD family protein	NA	NA	NA	NA	NA
WP_011675530.1|1955200_1956082_+	DUF1003 domain-containing protein	NA	NA	NA	NA	NA
WP_011675529.1|1956116_1957031_-	L-2-hydroxyisocaproate dehydrogenase	NA	NA	NA	NA	NA
1957437:1957453	attL	ATTTTTCATCACAAATT	NA	NA	NA	NA
WP_011675527.1|1957512_1957770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014573110.1|1957763_1957946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014573111.1|1958001_1958493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011675524.1|1958464_1959025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011675523.1|1959035_1959608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014573114.1|1959614_1960136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011675520.1|1961261_1961819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014573117.1|1961815_1962304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011675518.1|1962306_1962705_-	DUF4288 domain-containing protein	NA	NA	NA	NA	NA
WP_011675517.1|1962685_1963543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014573118.1|1963754_1965362_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	44.9	9.3e-131
WP_014573119.1|1965638_1966775_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_041168241.1|1966775_1967312_-	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_014573121.1|1967307_1967787_-	thiamine precursor transporter HmpT	NA	NA	NA	NA	NA
WP_011675511.1|1968658_1969420_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_032951100.1|1970016_1970220_+	hypothetical protein	NA	A5GYL5	Lactococcus_phage	92.5	8.3e-29
WP_014573125.1|1970529_1970820_-	STAS-like domain-containing protein	NA	J7KJ12	Streptococcus_phage	48.0	2.7e-12
WP_155114643.1|1971121_1971676_-	hypothetical protein	NA	J7KH07	Streptococcus_phage	31.8	1.5e-11
WP_041168177.1|1971797_1972973_+|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_014573127.1|1973108_1973288_-	hypothetical protein	NA	Q9AZD7	Lactococcus_phage	96.6	3.0e-22
WP_014573128.1|1973374_1974232_-	lysozyme	NA	Q8LTJ6	Lactococcus_phage	88.6	1.3e-102
WP_014573129.1|1974233_1974686_-|holin	phage holin	holin	Q8LTJ7	Lactococcus_phage	88.8	4.4e-46
WP_041168243.1|1974701_1975049_-	hypothetical protein	NA	Q38132	Lactococcus_phage	96.5	3.1e-52
WP_041168244.1|1975060_1975300_-	hypothetical protein	NA	A5GYN1	Lactococcus_phage	98.7	3.5e-34
WP_014573132.1|1975296_1978869_-|tail	Phage tail assembly	tail	Q8LTK0	Lactococcus_phage	29.9	4.9e-15
WP_003331415.1|1980564_1981788_+|transposase	IS21-like element IS712 family transposase	transposase	A0A059NT83	Lactococcus_phage	100.0	4.9e-233
WP_003331414.1|1981799_1982558_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	100.0	5.3e-137
WP_021166226.1|1986428_1986599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014573137.1|1986616_1986952_-	hypothetical protein	NA	Q9AZL6	Lactococcus_phage	92.1	3.7e-26
WP_014573138.1|1987022_1987628_-|tail	phage major tail protein	tail	Q9AZL7	Lactococcus_phage	94.5	1.4e-103
WP_014573139.1|1987629_1988025_-	DUF806 family protein	NA	Q9AZL8	Lactococcus_phage	98.5	2.6e-66
WP_041168246.1|1988021_1988507_-	hypothetical protein	NA	Q9AZL9	Lactococcus_phage	91.3	1.3e-75
WP_014573141.1|1988503_1988839_-|head	phage head closure protein	head	Q9AZM0	Lactococcus_phage	98.2	8.5e-55
WP_014573142.1|1988825_1989131_-	hypothetical protein	NA	Q9AZM1	Lactococcus_phage	98.0	2.2e-49
WP_014573145.1|1990443_1991031_-|head,protease	HK97 family phage prohead protease	head,protease	Q9AZM3	Lactococcus_phage	97.9	7.1e-105
WP_014573146.1|1991030_1992110_-|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	99.2	1.7e-197
WP_014573147.1|1992106_1992271_-	hypothetical protein	NA	Q9AZM5	Lactococcus_phage	94.4	2.8e-19
WP_014573148.1|1992279_1994094_-|terminase	terminase large subunit	terminase	Q9AZM6	Lactococcus_phage	98.8	0.0e+00
WP_014573149.1|1994093_1994546_-|terminase	phage terminase small subunit P27 family	terminase	Q9AZM7	Lactococcus_phage	99.3	6.5e-82
WP_014573150.1|1994661_1995165_-	HNH endonuclease	NA	Q9AZM8	Lactococcus_phage	99.4	1.2e-92
WP_014573151.1|1995398_1995821_-	DUF722 domain-containing protein	NA	Q9AYX5	Lactococcus_phage	100.0	5.5e-75
WP_011676525.1|1997116_1997323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041168250.1|1997557_1997719_-	DUF1660 domain-containing protein	NA	A0A1P8BKU8	Lactococcus_phage	66.7	5.0e-13
WP_014573154.1|1997715_1997946_-	hypothetical protein	NA	A0A1P8BMS6	Lactococcus_phage	41.8	1.6e-07
WP_041168252.1|1997964_1998360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014573156.1|1998779_1999412_-	DUF1642 domain-containing protein	NA	A0A1P8BL33	Lactococcus_phage	63.7	7.3e-39
WP_041168253.1|1999404_1999584_-	hypothetical protein	NA	A0A1P8BKQ8	Lactococcus_phage	96.6	4.4e-26
WP_014573157.1|1999580_1999778_-	DUF1125 domain-containing protein	NA	NA	NA	NA	NA
WP_014573158.1|1999786_2000296_-	hypothetical protein	NA	Q9AZU7	Lactococcus_phage	100.0	6.7e-11
WP_014573159.1|2000310_2000676_-	DUF658 domain-containing protein	NA	A0A1P8BLY8	Lactococcus_phage	96.7	6.2e-59
WP_014573160.1|2000650_2000815_-	hypothetical protein	NA	A0A1P8BM01	Lactococcus_phage	96.3	1.4e-23
WP_014573161.1|2000922_2001162_-	DUF1031 domain-containing protein	NA	A0A059NT75	Lactococcus_phage	98.7	5.2e-38
WP_014573162.1|2001158_2001533_-	DUF1064 domain-containing protein	NA	Q9AZV2	Lactococcus_phage	98.4	1.4e-61
WP_014573163.1|2001513_2001795_-	hypothetical protein	NA	A0A1B1IM06	Lactococcus_phage	96.7	4.3e-44
WP_014573164.1|2001778_2002585_-	helix-turn-helix domain-containing protein	NA	A0A1B1IMQ7	Lactococcus_phage	79.5	3.1e-103
WP_014573165.1|2003131_2004205_-	DUF1351 domain-containing protein	NA	A5GYR2	Lactococcus_phage	94.9	1.3e-157
WP_014573166.1|2004206_2004944_-	phage recombination protein Bet	NA	A5GYR1	Lactococcus_phage	98.8	5.7e-136
WP_014573167.1|2005049_2005223_-	hypothetical protein	NA	A0A1B1IMG1	Lactococcus_phage	98.2	3.1e-24
WP_014573168.1|2005253_2005490_-	DUF1408 domain-containing protein	NA	A5GYQ9	Lactococcus_phage	98.7	1.0e-38
WP_014573169.1|2005592_2005871_+	hypothetical protein	NA	A0A059NT68	Lactococcus_phage	97.8	4.2e-47
WP_014573170.1|2005825_2006059_-	hypothetical protein	NA	A0A059NT46	Lactococcus_phage	97.4	5.8e-34
WP_021212293.1|2006152_2006422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014573172.1|2006434_2007184_-	phage repressor protein/antirepressor Ant	NA	A0A1B1IMQ3	Lactococcus_phage	70.9	1.5e-86
WP_014573173.1|2007211_2007436_-	DUF739 family protein	NA	Q779I0	Lactococcus_phage	98.6	2.5e-34
WP_155114645.1|2008588_2009155_+	helix-turn-helix domain-containing protein	NA	A5GYQ3	Lactococcus_phage	72.2	3.9e-60
WP_014573176.1|2009160_2009595_+	zinc peptidase	NA	NA	NA	NA	NA
WP_014573177.1|2009608_2009944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014573178.1|2010010_2011192_+|integrase	site-specific integrase	integrase	Q9AZK8	Lactococcus_phage	47.2	4.5e-90
WP_011676957.1|2011486_2011993_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_011676958.1|2012002_2012191_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_014573179.1|2012201_2012762_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_011676960.1|2012789_2013032_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_014573180.1|2013267_2014239_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
2018540:2018556	attR	AATTTGTGATGAAAAAT	NA	NA	NA	NA
>prophage 18
NC_017492	Lactococcus lactis subsp. cremoris A76, complete genome	2452616	2111919	2120171	2452616	terminase	Lactococcus_phage(100.0%)	16	NA	NA
WP_011677045.1|2111919_2112330_-	DUF722 domain-containing protein	NA	Q9AZI2	Lactococcus_phage	90.4	3.2e-64
WP_011677046.1|2112326_2112770_-|terminase	terminase small subunit	terminase	Q9AZI3	Lactococcus_phage	83.0	1.3e-58
WP_011677047.1|2112902_2113445_-	hypothetical protein	NA	Q9AZI4	Lactococcus_phage	82.2	9.3e-51
WP_014573237.1|2113661_2115290_-	DNA primase	NA	Q9AZI5	Lactococcus_phage	92.3	6.4e-297
WP_014573238.1|2115300_2116095_-	hypothetical protein	NA	Q9AZI6	Lactococcus_phage	95.1	6.8e-151
WP_014573239.1|2116091_2116427_-	hypothetical protein	NA	Q9AZI7	Lactococcus_phage	96.3	1.1e-54
WP_014573240.1|2116496_2116736_-	hypothetical protein	NA	Q9AZJ0	Lactococcus_phage	86.1	4.1e-35
WP_014573241.1|2116772_2117054_-	hypothetical protein	NA	Q9AZJ1	Lactococcus_phage	91.4	4.8e-43
WP_014573242.1|2117046_2117283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014573243.1|2117275_2117479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014573245.1|2118085_2118280_-	DUF1655 domain-containing protein	NA	Q9AZJ4	Lactococcus_phage	95.3	4.3e-27
WP_014573246.1|2118411_2118558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080562017.1|2118561_2118738_-	hypothetical protein	NA	Q9AZJ6	Lactococcus_phage	80.7	4.8e-17
WP_014573248.1|2119016_2119400_+	helix-turn-helix transcriptional regulator	NA	Q9AZJ7	Lactococcus_phage	70.9	6.3e-46
WP_011677060.1|2119411_2119963_+	hypothetical protein	NA	Q9AZJ8	Lactococcus_phage	79.9	6.2e-87
WP_011677061.1|2119976_2120171_+	hypothetical protein	NA	Q9AZK1	Lactococcus_phage	96.9	3.9e-28
>prophage 19
NC_017492	Lactococcus lactis subsp. cremoris A76, complete genome	2452616	2124743	2181130	2452616	integrase,tRNA,transposase	Lactococcus_phage(14.29%)	49	2122408:2122425	2166671:2166688
2122408:2122425	attL	TAATTTAGAAAATAAAGA	NA	NA	NA	NA
WP_011677065.1|2124743_2125925_+|integrase	site-specific integrase	integrase	Q9AZK8	Lactococcus_phage	45.2	4.9e-89
WP_011677066.1|2126137_2126764_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_011677067.1|2126796_2127816_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011677068.1|2127808_2128579_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.8	4.9e-29
WP_014572485.1|2130534_2131425_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011677070.1|2131680_2132079_+	HIT family protein	NA	NA	NA	NA	NA
WP_014573251.1|2132093_2132315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014573252.1|2132326_2132671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011677073.1|2132748_2133438_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_011677074.1|2133824_2134250_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_011677075.1|2134385_2135150_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011677077.1|2136094_2136304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011677078.1|2136337_2136859_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_011677079.1|2137033_2137891_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011677081.1|2138478_2139036_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_004254608.1|2139191_2139908_-	UMP kinase	NA	NA	NA	NA	NA
WP_011677082.1|2139992_2140445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014573258.1|2140574_2141762_-	acetate kinase	NA	NA	NA	NA	NA
WP_011677084.1|2141920_2143108_-	acetate kinase	NA	NA	NA	NA	NA
WP_011677085.1|2143299_2144238_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011677086.1|2144325_2144577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011677087.1|2144677_2146519_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	35.4	1.2e-17
WP_155114647.1|2146829_2147941_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_014573263.1|2148655_2149114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014573264.1|2149128_2149743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014573266.1|2150082_2150811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011677095.1|2151003_2151225_+	YqgQ family protein	NA	NA	NA	NA	NA
WP_014573267.1|2151258_2152230_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_011677097.1|2152232_2152619_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_011677098.1|2152734_2153181_-	DNA starvation/stationary phase protection protein	NA	A0A2K9VCK5	Lactobacillus_phage	33.6	2.5e-17
WP_014573269.1|2153346_2154012_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_041168260.1|2153962_2155057_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_014573271.1|2155132_2155624_-|tRNA	prolyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_011677103.1|2155699_2157193_-	amino acid permease	NA	NA	NA	NA	NA
WP_014573272.1|2157401_2158292_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014573275.1|2159784_2160729_-	carbamate kinase	NA	NA	NA	NA	NA
WP_014573276.1|2160761_2161706_-	carbamate kinase	NA	NA	NA	NA	NA
WP_014573277.1|2161723_2163304_-	amino acid permease	NA	NA	NA	NA	NA
WP_011677108.1|2163435_2164500_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_014573278.1|2164665_2165898_-	arginine deiminase	NA	NA	NA	NA	NA
WP_011677109.1|2166198_2167893_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	34.2	7.8e-80
2166671:2166688	attR	TCTTTATTTTCTAAATTA	NA	NA	NA	NA
WP_004254487.1|2167960_2168419_+	arginine repressor	NA	NA	NA	NA	NA
WP_014573279.1|2168578_2169910_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_011677112.1|2170110_2170710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011677113.1|2170926_2174031_-	helicase	NA	A0A2L1IWL4	Gordonia_phage	30.1	2.4e-42
WP_014573283.1|2174791_2175682_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014573284.1|2175866_2176484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014573285.1|2176461_2179695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014573287.1|2180239_2181130_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NC_017492	Lactococcus lactis subsp. cremoris A76, complete genome	2452616	2252554	2304193	2452616	protease,tRNA,transposase	Bacillus_phage(33.33%)	35	NA	NA
WP_155114648.1|2252554_2253942_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.3	4.2e-55
WP_011677177.1|2254014_2254824_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_011677178.1|2254816_2255554_-	metal ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.7	7.0e-17
WP_011677179.1|2255732_2256575_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011677180.1|2256571_2257009_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_011677181.1|2257088_2257388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011836043.1|2257411_2257858_-	competence protein ComGF	NA	NA	NA	NA	NA
WP_015082931.1|2257820_2258207_-	Competence protein comGE	NA	NA	NA	NA	NA
WP_011677184.1|2258478_2258856_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_021216261.1|2258873_2259947_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_014573340.1|2260722_2261613_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014573342.1|2261900_2266808_-	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	37.2	9.1e-20
WP_011677186.1|2266981_2267284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014573343.1|2267442_2268774_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014573344.1|2268789_2270640_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011677189.1|2270709_2271996_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_011677190.1|2272014_2272818_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_014573345.1|2272817_2273552_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	37.0	2.6e-16
WP_011677192.1|2273901_2274234_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_014573347.1|2274884_2275775_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014573348.1|2275851_2276034_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_011677194.1|2276051_2276531_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_011836058.1|2276906_2278130_+|protease	serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	25.8	2.4e-06
WP_014573349.1|2278251_2279250_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_014573350.1|2279387_2280728_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011677198.1|2280835_2281060_+	YkuJ family protein	NA	NA	NA	NA	NA
WP_014573351.1|2281203_2282208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014573352.1|2282264_2283017_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_014573354.1|2286122_2286932_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_014573355.1|2286931_2287537_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014573356.1|2293231_2293723_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_014573357.1|2293986_2295717_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_011677206.1|2295921_2296950_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_011677208.1|2298232_2299258_+	lactonase family protein	NA	NA	NA	NA	NA
WP_155114649.1|2303082_2304193_+|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.1	2.8e-49
>prophage 21
NC_017492	Lactococcus lactis subsp. cremoris A76, complete genome	2452616	2354727	2373241	2452616	protease,transposase,head	Lactococcus_phage(86.36%)	29	NA	NA
WP_041168272.1|2354727_2354892_-	hypothetical protein	NA	Q9AZK6	Lactococcus_phage	94.4	7.4e-20
WP_014573398.1|2356775_2356970_-	hypothetical protein	NA	Q9AZK1	Lactococcus_phage	98.4	1.8e-28
WP_011834155.1|2357042_2357273_-	hypothetical protein	NA	Q9AZK0	Lactococcus_phage	85.5	1.2e-15
WP_014573399.1|2357376_2357931_-	hypothetical protein	NA	Q9AZJ8	Lactococcus_phage	91.3	2.4e-102
WP_014573400.1|2357940_2358327_-	helix-turn-helix transcriptional regulator	NA	Q9AZJ7	Lactococcus_phage	78.1	1.6e-49
WP_014573402.1|2358603_2358810_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041168274.1|2358811_2359060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014573404.1|2359309_2359999_+	Rha family transcriptional regulator	NA	R9QNB1	Lactococcus_phage	81.3	1.7e-94
WP_014573405.1|2360069_2360264_+	DUF1655 domain-containing protein	NA	Q9AZF2	Lactococcus_phage	92.2	3.3e-27
WP_014573406.1|2360267_2360798_+	hypothetical protein	NA	Q9AZJ3	Lactococcus_phage	56.3	2.0e-45
WP_014573407.1|2360794_2361013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014573408.1|2361009_2361291_+	hypothetical protein	NA	Q9AZJ1	Lactococcus_phage	93.5	7.4e-44
WP_041168276.1|2361333_2361573_+	hypothetical protein	NA	Q9AZJ0	Lactococcus_phage	98.7	1.0e-38
WP_041168277.1|2361569_2361824_+	hypothetical protein	NA	Q9AZE9	Lactococcus_phage	85.5	8.8e-36
WP_014573410.1|2361820_2362135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014573411.1|2362131_2362467_+	hypothetical protein	NA	Q9AZI7	Lactococcus_phage	93.5	4.7e-53
WP_014573412.1|2362463_2363258_+	hypothetical protein	NA	Q9AZI6	Lactococcus_phage	92.4	4.3e-145
WP_014573413.1|2363268_2364903_+	DNA primase	NA	Q9AZI5	Lactococcus_phage	88.6	1.1e-280
WP_014573414.1|2365113_2365296_+	hypothetical protein	NA	Q9AZE3	Lactococcus_phage	87.9	5.7e-21
WP_014573415.1|2365322_2365931_+	hypothetical protein	NA	Q9AZE2	Lactococcus_phage	94.1	6.2e-96
WP_014573416.1|2365939_2366530_+|head,protease	HK97 family phage prohead protease	head,protease	Q9AZE1	Lactococcus_phage	94.9	6.7e-103
WP_041168278.1|2366743_2367073_+	hypothetical protein	NA	Q9AZE0	Lactococcus_phage	94.5	3.3e-51
WP_041168280.1|2367173_2367494_+	sigma-70 family RNA polymerase sigma factor	NA	Q9AZD9	Lactococcus_phage	93.4	8.7e-49
WP_011836112.1|2368209_2368410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014573417.1|2368470_2369811_-	type I glutamate--ammonia ligase	NA	A0A2P1EM84	Moumouvirus	23.7	3.0e-10
WP_011836114.1|2369872_2370238_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050800270.1|2370338_2370728_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_003138385.1|2370817_2371993_-|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_014573419.1|2372239_2373241_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	29.2	1.8e-07
>prophage 1
NC_017496	Lactococcus lactis subsp. cremoris A76 plasmid pQA554, complete sequence	53630	32765	42082	53630	transposase	Lactococcus_phage(62.5%)	9	NA	NA
WP_014573524.1|32765_33446_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	82.3	6.1e-108
WP_003331415.1|35152_36376_+|transposase	IS21-like element IS712 family transposase	transposase	A0A059NT83	Lactococcus_phage	100.0	4.9e-233
WP_003331414.1|36387_37146_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	100.0	5.3e-137
WP_014573528.1|37194_37413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155114655.1|37621_38993_+|transposase	IS3-like element ISLla3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.4	3.2e-55
WP_011669084.1|39414_39615_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	97.0	9.6e-30
WP_003132324.1|39891_40092_-	cold shock domain-containing protein	NA	A0A1X9IGI9	Lactococcus_phage	54.7	1.6e-13
WP_014573531.1|40222_40423_-	hypothetical protein	NA	Q9AZK6	Lactococcus_phage	51.9	2.8e-05
WP_014573532.1|41401_42082_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	82.3	4.6e-108
