The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_016605	Pediococcus claussenii ATCC BAA-344, complete sequence	1829111	524840	532540	1829111		Bacillus_phage(33.33%)	8	NA	NA
WP_081478597.1|524840_525923_+	peptide chain release factor 2	NA	B5LLF2	Mycobacterium_phage	43.2	8.2e-06
WP_014215020.1|525934_526633_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.8	2.1e-39
WP_014215021.1|526613_527996_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.8	2.1e-22
WP_014215022.1|528263_529142_+	phosphate ABC transporter substrate-binding protein PstS family protein	NA	H6WG65	Cyanophage	30.4	4.9e-09
WP_014215023.1|529148_530069_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_014215024.1|530065_530953_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_014215025.1|530966_531767_+	phosphate ABC transporter ATP-binding protein	NA	M1IC18	Acanthocystis_turfacea_Chlorella_virus	31.8	2.4e-07
WP_014215026.1|531784_532540_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.1	1.6e-16
>prophage 2
NC_016605	Pediococcus claussenii ATCC BAA-344, complete sequence	1829111	572639	603409	1829111	portal,terminase,capsid,head,tRNA,integrase	Lactobacillus_phage(17.65%)	34	590596:590616	604401:604421
WP_014215062.1|572639_573110_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_014215063.1|573102_573594_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014215064.1|573586_574123_-	exonuclease	NA	M1PFD8	Streptococcus_phage	43.3	3.9e-25
WP_014215065.1|574200_575112_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_014215066.1|575144_576044_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_014215067.1|576288_577140_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_014215068.1|577136_577934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014215069.1|577962_579324_+	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	27.4	8.1e-19
WP_014215070.1|579532_581347_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	36.8	1.2e-94
WP_014215071.1|581606_581921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014215072.1|581998_582379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148265539.1|582561_582906_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014215074.1|582917_584594_+	oleate hydratase	NA	NA	NA	NA	NA
WP_050899559.1|584725_585559_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_041534573.1|585887_587084_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.3	2.8e-15
WP_014215077.1|587067_587832_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_041534574.1|587898_588849_+	2-hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	33.1	3.8e-31
WP_014215079.1|589004_589817_-	LicD family protein	NA	A0A1V0SD50	Indivirus	39.2	1.5e-07
WP_014215080.1|589946_590096_+	hypothetical protein	NA	NA	NA	NA	NA
590596:590616	attL	ACTTAGTCAAAAACTTAGTCA	NA	NA	NA	NA
WP_014215081.1|590633_591785_-|integrase	site-specific integrase	integrase	A0A097PAS9	Streptococcus_pyogenes_phage	36.9	1.3e-54
WP_014215082.1|591984_592803_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014215083.1|593145_593415_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041534576.1|593654_593891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041534577.1|593880_594723_+	bifunctional DNA primase/polymerase	NA	A0A1P8BMS4	Lactococcus_phage	26.3	2.8e-09
WP_050899561.1|594679_596242_+	hypothetical protein	NA	V5US55	Enterococcus_phage	30.5	6.9e-30
WP_014215086.1|596755_597118_+	phage transcriptional regulator, ArpU family protein	NA	D6PSV8	Lactobacillus_phage	34.6	7.6e-09
WP_014215087.1|597133_597343_+	hypothetical protein	NA	D7RWL9	Brochothrix_phage	43.1	6.6e-05
WP_041534578.1|597332_597545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041534579.1|597544_597889_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	29.4	3.1e-07
WP_014215090.1|597888_598266_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	38.5	4.4e-15
WP_014215091.1|598491_598926_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JH50	uncultured_Caudovirales_phage	28.3	9.5e-06
WP_014215092.1|598922_600632_+|terminase	terminase large subunit	terminase	E9LUI0	Lactobacillus_phage	41.1	4.7e-117
WP_014215094.1|600786_601923_+|portal	phage portal protein	portal	A0A2H4J8V4	uncultured_Caudovirales_phage	35.9	2.8e-49
WP_014215095.1|601897_603409_+|capsid	phage major capsid protein	capsid	A0A060AI54	Enterococcus_phage	35.2	9.6e-37
604401:604421	attR	ACTTAGTCAAAAACTTAGTCA	NA	NA	NA	NA
>prophage 3
NC_016605	Pediococcus claussenii ATCC BAA-344, complete sequence	1829111	910171	922216	1829111	tRNA	Staphylococcus_phage(33.33%)	13	NA	NA
WP_014215377.1|910171_910648_+	nucleoside 2-deoxyribosyltransferase	NA	A0A1G5S9Z4	Enterococcus_phage	38.2	2.9e-16
WP_014215378.1|910728_911607_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	41.4	3.3e-58
WP_041534608.1|911718_912921_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	34.6	8.1e-47
WP_014215380.1|912922_914797_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.4	5.3e-53
WP_014215381.1|914809_915760_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	60.8	3.2e-115
WP_014215382.1|915772_916255_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	38.8	2.5e-23
WP_014215383.1|916327_917173_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	32.8	9.8e-15
WP_014215384.1|917241_917463_+	YozE family protein	NA	NA	NA	NA	NA
WP_014215385.1|917468_918881_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.3	9.0e-21
WP_014215386.1|919051_919954_+	lipase/acylhydrolase	NA	NA	NA	NA	NA
WP_014215387.1|919956_920568_+	YpmS family protein	NA	NA	NA	NA	NA
WP_014215388.1|920610_921477_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_014215389.1|921457_922216_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.2	9.4e-25
>prophage 4
NC_016605	Pediococcus claussenii ATCC BAA-344, complete sequence	1829111	1579607	1587708	1829111		Bacillus_phage(33.33%)	8	NA	NA
WP_014216054.1|1579607_1580939_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.4	1.3e-26
WP_014216055.1|1580995_1581328_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_014216056.1|1581347_1582133_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_014216057.1|1582252_1583554_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	27.8	7.8e-11
WP_014216058.1|1583700_1584825_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.7	8.4e-30
WP_014216059.1|1585072_1585762_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	8.2e-36
WP_014216060.1|1585847_1586345_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	H2EF51	Moumouvirus	34.0	1.2e-15
WP_014216061.1|1586565_1587708_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	34.5	3.1e-64
>prophage 1
NC_017018	Pediococcus claussenii ATCC BAA-344 plasmid pPECL-7, complete sequence	16067	0	7611	16067	transposase,integrase	Lactococcus_phage(33.33%)	8	876:887	3703:3714
WP_014386884.1|0_574_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	31.4	6.0e-24
WP_014386885.1|647_1385_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	50.0	2.1e-58
876:887	attL	TTCATCAATAAT	NA	NA	NA	NA
WP_003555353.1|1394_2618_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	51.7	1.9e-107
WP_014386886.1|2697_3273_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	34.3	7.3e-22
WP_003586674.1|3349_3628_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002834562.1|3627_3984_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
3703:3714	attR	ATTATTGATGAA	NA	NA	NA	NA
WP_014386887.1|4087_5341_+	MFS transporter	NA	A0A1B0RXG2	Streptococcus_phage	33.5	1.2e-56
WP_014386888.1|5415_7611_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	30.6	1.5e-59
