The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011025	Pseudoalteromonas arctica A 37-1-2 chromosome I, complete sequence	3840834	1489390	1523926	3840834	head,capsid,tail,terminase,integrase,portal	Pseudoalteromonas_phage(28.57%)	44	1485884:1485898	1506500:1506514
1485884:1485898	attL	TTTATTACTAATACA	NA	NA	NA	NA
WP_010553441.1|1489390_1490605_+|integrase	site-specific integrase	integrase	K7P7J2	Enterobacteria_phage	36.7	1.5e-64
WP_010553442.1|1490901_1491186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010553444.1|1491718_1493605_-	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	35.0	6.0e-81
WP_010553445.1|1493690_1494329_-	helix-turn-helix domain-containing protein	NA	U5P0T5	Shigella_phage	47.0	4.9e-35
WP_010553446.1|1494481_1494700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010553447.1|1494696_1494990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010553448.1|1495000_1495273_+	hypothetical protein	NA	A0A1L5C2B4	Pseudoalteromonas_phage	54.4	1.4e-15
WP_010553449.1|1495275_1495662_+	hypothetical protein	NA	A0A1L5C285	Pseudoalteromonas_phage	48.7	3.4e-23
WP_010553450.1|1495664_1496264_+	hypothetical protein	NA	A0A067ZG73	Vibrio_phage	42.2	2.0e-38
WP_010553451.1|1496263_1496578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010553452.1|1496598_1496877_+	hypothetical protein	NA	A0A1L5C2B9	Pseudoalteromonas_phage	51.6	1.3e-19
WP_010553453.1|1496879_1500011_+	replication endonuclease	NA	A0A1L5C2A7	Pseudoalteromonas_phage	81.5	0.0e+00
WP_010553454.1|1500019_1500286_+	hypothetical protein	NA	A0A1L5C294	Pseudoalteromonas_phage	92.9	8.6e-42
WP_010553455.1|1500282_1500570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010553456.1|1500556_1500955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021032028.1|1501169_1501532_+	hypothetical protein	NA	A0A2I7RHM8	Vibrio_phage	55.8	3.1e-18
WP_010553458.1|1501594_1501840_-	ogr/Delta-like zinc finger family protein	NA	A0A1L5C2B5	Pseudoalteromonas_phage	90.1	4.2e-35
WP_010553459.1|1502183_1502435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010553460.1|1502489_1502834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010553461.1|1502852_1503308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010553462.1|1503307_1503634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010553463.1|1503630_1504695_-|portal	phage portal protein	portal	A5X9H1	Aeromonas_virus	43.6	6.3e-59
WP_010553464.1|1504694_1506479_-|terminase	terminase	terminase	R4JDJ3	Burkholderia_phage	40.8	3.7e-120
WP_010553465.1|1506671_1507553_+|capsid	phage capsid scaffolding protein	capsid	Q94MZ5	Haemophilus_virus	29.4	3.9e-22
1506500:1506514	attR	TGTATTAGTAATAAA	NA	NA	NA	NA
WP_010553466.1|1507595_1508633_+|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	47.1	3.1e-71
WP_010553467.1|1508708_1509449_+|terminase	terminase	terminase	NA	NA	NA	NA
WP_010553468.1|1509557_1509995_+|head	head completion/stabilization protein	head	NA	NA	NA	NA
WP_010553469.1|1509991_1510465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010553470.1|1510457_1511090_+	hypothetical protein	NA	A0A1D9C9S1	Salinivibrio_phage	33.0	1.7e-16
WP_010553471.1|1511113_1512214_+	DUF2586 family protein	NA	A0A0U4KLE6	Pseudomonas_phage	39.8	6.0e-65
WP_010553472.1|1512222_1512672_+	DUF2597 family protein	NA	A0A1L5C2D0	Pseudoalteromonas_phage	42.1	2.8e-29
WP_010553473.1|1512671_1513292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010553474.1|1513294_1513582_+	hypothetical protein	NA	A0A0U4B0P2	Pseudomonas_phage	40.4	1.7e-11
WP_033012577.1|1513750_1516885_+|tail	phage tail tape measure protein	tail	R9TRA2	Vibrio_phage	38.3	5.5e-87
WP_010553476.1|1516884_1517211_+	DUF2590 family protein	NA	A5X9J0	Aeromonas_virus	38.5	1.5e-11
WP_010553477.1|1517200_1518349_+	hypothetical protein	NA	A0A1L5C2D1	Pseudoalteromonas_phage	36.6	4.2e-61
WP_010553478.1|1518341_1519052_+	hypothetical protein	NA	A0A0U4JVX3	Pseudomonas_phage	43.9	1.1e-27
WP_010553479.1|1519048_1519627_+|tail	tail fiber protein	tail	A0A0U4K5K2	Pseudomonas_phage	36.0	1.4e-20
WP_010553480.1|1519623_1520841_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	D4HTV7	Vibrio_phage	65.9	2.7e-135
WP_010553481.1|1520907_1521195_+	hypothetical protein	NA	Q8H9M8	Vibrio_phage	62.6	3.9e-24
WP_050576403.1|1521235_1521817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002960001.1|1521813_1522299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010553483.1|1522295_1523000_+	hypothetical protein	NA	A0A2I7RNK1	Vibrio_phage	30.8	1.3e-23
WP_010553484.1|1522972_1523926_+	hypothetical protein	NA	A0A0U4IBV2	Pseudomonas_phage	28.4	3.7e-26
>prophage 2
NZ_CP011025	Pseudoalteromonas arctica A 37-1-2 chromosome I, complete sequence	3840834	1676391	1738851	3840834	protease,tRNA,integrase,transposase	Orpheovirus(20.0%)	50	1717148:1717164	1746475:1746491
WP_010552587.1|1676391_1677414_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_010552588.1|1677410_1678394_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_010552589.1|1678446_1678905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010552590.1|1679359_1681918_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
WP_010552591.1|1681994_1682198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010552592.1|1682369_1683857_-	bifunctional 2-methylcitrate dehydratase/aconitate hydratase	NA	NA	NA	NA	NA
WP_010552593.1|1683879_1692708_-	cyclic beta 1-2 glucan synthetase	NA	NA	NA	NA	NA
WP_010552594.1|1693356_1694094_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_010552595.1|1694234_1694426_-	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_010552597.1|1694966_1695692_+	haloacid dehalogenase	NA	NA	NA	NA	NA
WP_010552598.1|1695866_1696682_-	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_010552599.1|1697317_1698445_+	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_008168384.1|1698625_1698865_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_021032118.1|1698950_1701320_+	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_010552601.1|1701316_1702774_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_029880342.1|1702733_1703141_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_010552603.1|1703161_1703533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101163441.1|1703516_1703855_+	ATP synthase subunit I	NA	NA	NA	NA	NA
WP_010552605.1|1703838_1704528_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_010552606.1|1704562_1704844_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_010552607.1|1704847_1705648_+	ATP synthase subunit B	NA	NA	NA	NA	NA
WP_010552608.1|1705647_1707228_+	alternate F1F0 ATPase, F1 subunit alpha	NA	NA	NA	NA	NA
WP_010552609.1|1707224_1708112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084201284.1|1708959_1710006_-	DUF3080 family protein	NA	NA	NA	NA	NA
WP_010552611.1|1709986_1711357_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_007585130.1|1711485_1712112_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	40.0	1.8e-21
WP_008166246.1|1712113_1712317_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_010552612.1|1712420_1713293_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_010552613.1|1713416_1714109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007585117.1|1714388_1715174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010552614.1|1715274_1716657_+	amidohydrolase	NA	NA	NA	NA	NA
WP_010552615.1|1716669_1717911_+	amidohydrolase family protein	NA	NA	NA	NA	NA
1717148:1717164	attL	ACAGCGACATGCAAAAA	NA	NA	NA	NA
WP_010552616.1|1718025_1720248_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_002962500.1|1720773_1720992_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.2	7.3e-15
WP_010552617.1|1721192_1721510_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	38.3	1.5e-13
WP_007585108.1|1721578_1723840_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	40.8	6.8e-164
WP_002962494.1|1724054_1724273_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_010552618.1|1724363_1725068_-	arginyltransferase	NA	NA	NA	NA	NA
WP_010552619.1|1725060_1725777_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_008168643.1|1725874_1726825_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	41.7	3.0e-60
WP_010552620.1|1727123_1728449_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_010552621.1|1728568_1729690_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_007582985.1|1729832_1730312_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_010552622.1|1730485_1732981_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.6	4.2e-90
WP_007582981.1|1732980_1733607_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_010552623.1|1733599_1734943_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.7	9.3e-76
WP_021032117.1|1734935_1735316_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	38.5	2.1e-09
WP_008168632.1|1735325_1736630_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.0	1.1e-92
WP_010552625.1|1737059_1737899_+|integrase	site-specific integrase	integrase	I3ULU8	Synechococcus_phage	28.6	8.8e-08
WP_010552626.1|1737909_1738851_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
1746475:1746491	attR	TTTTTGCATGTCGCTGT	NA	NA	NA	NA
>prophage 3
NZ_CP011025	Pseudoalteromonas arctica A 37-1-2 chromosome I, complete sequence	3840834	2983674	2991830	3840834		uncultured_Mediterranean_phage(28.57%)	8	NA	NA
WP_007584792.1|2983674_2984718_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.5	3.8e-117
WP_010554445.1|2984786_2985275_-	nicotinamide-nucleotide amidohydrolase family protein	NA	B5TK85	Pseudomonas_phage	41.8	3.5e-25
WP_010554444.1|2985296_2987882_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	26.0	2.1e-36
WP_010554443.1|2987973_2988948_-	RNA polymerase sigma factor RpoS	NA	A0A2I7SAT0	Vibrio_phage	30.1	7.8e-32
WP_010554442.1|2988983_2989808_-	peptidoglycan DD-metalloendopeptidase family protein	NA	G3MBP9	Bacillus_virus	36.0	6.9e-05
WP_007584782.1|2989849_2990428_-	DedA family protein	NA	NA	NA	NA	NA
WP_007584780.1|2990437_2991076_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.5	1.5e-36
WP_007584778.1|2991065_2991830_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.1	2.5e-70
>prophage 1
NZ_CP011027	Pseudoalteromonas arctica A 37-1-2 plasmid unnamed, complete sequence	97261	22916	61903	97261	integrase,transposase	Bacillus_phage(28.57%)	30	28442:28501	66690:67060
WP_096058044.1|22916_24462_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	26.6	7.8e-10
WP_010555469.1|24677_25037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010555470.1|25008_28311_+	hypothetical protein	NA	NA	NA	NA	NA
28442:28501	attL	GGGGTTTTGCGCCCATCCCCTCGAAATTAACCTTAGTCTAAATTTTTAAGCTTTTTTCTA	NA	NA	NA	NA
WP_096058083.1|28802_28931_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_010555472.1|28927_29233_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_010555473.1|30095_30329_-	replication initiation protein	NA	NA	NA	NA	NA
WP_010555474.1|30731_31145_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	42.2	3.0e-25
WP_010555477.1|32701_33697_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	34.3	1.1e-44
WP_010555478.1|33705_34197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010555479.1|34593_35070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010555480.1|35156_35573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010555481.1|35836_36277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010555482.1|36539_38696_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_158522947.1|39281_39422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010555485.1|39768_40320_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	40.2	9.5e-19
WP_010555486.1|40794_41520_+	NYN domain-containing protein	NA	A0A2P0VNQ4	Tetraselmis_virus	29.4	6.0e-05
WP_010555537.1|41894_42728_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	28.7	7.7e-12
WP_096058057.1|42724_43816_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_021031995.1|44204_44639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010554777.1|44687_45203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010554776.1|45562_46336_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_010554775.1|46710_48579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010554774.1|49161_49995_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_010554773.1|50020_50584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010554772.1|50821_51862_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_010554771.1|51861_53061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010554769.1|53674_54241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010554768.1|54369_54759_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_010554767.1|54838_55456_+	cation transporter	NA	NA	NA	NA	NA
WP_084201255.1|58903_61903_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	20.6	4.7e-35
66690:67060	attR	TAGAAAAAAGCTTAAAAATTTAGACTAAGGTTAATTTCGAGGGGATGGGCGCAAAACCCCTAATTGGTGTTGGCAGCTCCATGCGCTGACGGTATGTAAGGCACTTTTTCTATCTTTGGTTGTAAATGAACGACGTGCTGTTTTTCCATCAATGGCAATGATATCAGCACCAGTGGTTTCAATAAGTGATGATATCCAAGATTGAAATGAATGCTCTATTTCATCTGATTTTAACCGACAAATGACACGGGCAATGGTGTCGTGTCTTGGGATACCCTCTTTGAAAGCGCCATATTTTTTTAACCAATCAAGTTTTAGATGCCCAAAATCTTCAATATCCTCCCATCCTTCTGCGCCGGAGAGTACAGCAC	NA	NA	NA	NA
