The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_016783	Corynebacterium diphtheriae INCA 402, complete sequence	2449071	245650	289890	2449071	integrase,protease,holin,transposase	uncultured_Mediterranean_phage(15.38%)	41	239255:239271	291318:291334
239255:239271	attL	CGCGGCCTGCTGTACGT	NA	NA	NA	NA
WP_014301302.1|245650_246835_+|protease	MarP family serine protease	protease	NA	NA	NA	NA
WP_014302818.1|246831_247770_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003850430.1|247857_248358_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_010934200.1|248485_249139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003850437.1|249076_249934_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_014302819.1|250404_251442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014302820.1|251434_252532_+	TadA family conjugal transfer-associated ATPase	NA	NA	NA	NA	NA
WP_014302821.1|252528_253275_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_014301309.1|253274_253853_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_044026289.1|253876_254074_+	DUF4244 domain-containing protein	NA	NA	NA	NA	NA
WP_010934206.1|254070_254346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014302822.1|254342_254669_+	flp pilus-assembly TadE/G-like family protein	NA	NA	NA	NA	NA
WP_014302823.1|254658_256995_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	27.7	1.0e-08
WP_003850453.1|257264_257468_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	62.3	3.1e-15
WP_014302824.1|257641_258259_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.2	1.3e-08
WP_014302825.1|258255_258963_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	1.3e-12
WP_014302826.1|258959_260207_+	MFS transporter	NA	NA	NA	NA	NA
WP_014302827.1|260203_261691_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014302828.1|261691_263452_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014301318.1|263429_264923_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014302829.1|265063_267958_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	36.1	2.9e-98
WP_016830087.1|268107_268716_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_014301321.1|269144_271121_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_014302831.1|271207_273244_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_014302832.1|273350_274250_+	DUF4862 family protein	NA	NA	NA	NA	NA
WP_014302833.1|274266_275793_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	31.7	1.8e-19
WP_014301324.1|275791_277057_+	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	28.4	3.5e-08
WP_080563650.1|277509_277914_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_003850484.1|277953_278361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014302834.1|278364_279129_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1W6JRD7	Corynebacterium_phage	60.3	4.0e-76
WP_014302835.1|279354_279564_-	hypothetical protein	NA	A0A1W6JRD7	Corynebacterium_phage	66.7	4.7e-19
WP_014302836.1|279877_281227_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.4	8.0e-35
WP_014302837.1|281658_281904_-	virulence RhuM family protein	NA	NA	NA	NA	NA
WP_014302838.1|282167_282692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003850495.1|282698_283025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044026290.1|283564_284551_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	35.1	3.7e-13
WP_014306410.1|284589_285288_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	NA	NA	NA	NA
WP_014302842.1|285398_286151_-	S1 family peptidase	NA	NA	NA	NA	NA
WP_014302843.1|286757_287267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158307792.1|287749_287950_-|transposase	transposase	transposase	Q6H9S3	Enterobacteria_phage	44.0	1.8e-07
WP_014302848.1|289521_289890_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B3AZE5	Gordonia_phage	49.4	1.0e-13
291318:291334	attR	ACGTACAGCAGGCCGCG	NA	NA	NA	NA
>prophage 2
NC_016783	Corynebacterium diphtheriae INCA 402, complete sequence	2449071	646617	704953	2449071	integrase,protease,transposase,tRNA	Bacillus_phage(16.67%)	51	639908:639928	712776:712796
639908:639928	attL	GAATCGACGATTCCTTCCGAA	NA	NA	NA	NA
WP_014303067.1|646617_647121_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_010934497.1|647166_647790_+	sigma-70 family RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	28.5	1.7e-08
WP_044026306.1|647786_648038_+	mycothiol system anti-sigma-R factor	NA	NA	NA	NA	NA
WP_014303068.1|648042_648387_-	DUF4288 domain-containing protein	NA	NA	NA	NA	NA
WP_004567132.1|648725_648986_-	WhiB family transcriptional regulator	NA	A0A2P1N2X5	Mycobacterium_phage	45.1	2.0e-11
WP_050806154.1|649618_650080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004567135.1|650073_651336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014303070.1|651332_652643_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.0	1.3e-42
WP_004567139.1|652901_653129_+	DUF3107 domain-containing protein	NA	NA	NA	NA	NA
WP_014303071.1|653131_654010_+	DUF3152 domain-containing protein	NA	NA	NA	NA	NA
WP_014303072.1|654032_654890_+	TIGR02569 family protein	NA	NA	NA	NA	NA
WP_014303073.1|654893_658076_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_044026307.1|658069_661300_+	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	22.9	5.1e-19
WP_014301551.1|661344_662433_+	potassium channel family protein	NA	NA	NA	NA	NA
WP_014301552.1|662464_663148_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_014303075.1|663140_665192_+	ATP-dependent DNA helicase UvrD2	NA	S5MMD7	Bacillus_phage	27.5	1.7e-44
WP_014303076.1|665136_666030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010934510.1|666065_666587_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_014301554.1|666583_667975_-|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_044026308.1|668055_669108_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_014303078.1|669119_669818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014303079.1|669868_670372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014303080.1|670544_673508_+	UPF0182 family protein	NA	NA	NA	NA	NA
WP_014303081.1|673967_676565_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	40.8	2.1e-92
WP_148263743.1|676557_677751_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_014303083.1|677760_680955_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.5	8.8e-24
WP_014303085.1|681713_682784_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_014303086.1|682786_683743_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_010934521.1|684373_685855_+	methylmalonyl-CoA carboxytransferase subunit 5S	NA	NA	NA	NA	NA
WP_014303088.1|685867_687424_+	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_003850577.1|687437_687701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014303089.1|687725_688094_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_014303090.1|688296_689388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014303091.1|689406_690195_-	histidinol-phosphatase	NA	NA	NA	NA	NA
WP_014303092.1|690250_691066_-	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_010934526.1|691245_692355_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_014303093.1|692351_693950_-	AbgT family transporter	NA	NA	NA	NA	NA
WP_014303094.1|694128_694818_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	38.2	9.1e-27
WP_003850598.1|694834_695737_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014303095.1|695843_696335_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	52.2	1.5e-36
WP_014303096.1|697165_697507_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_014303097.1|697540_698344_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_157892472.1|698710_698971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014303099.1|699119_699581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044026370.1|700168_700783_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_014301568.1|700783_701149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158307792.1|701211_701412_-|transposase	transposase	transposase	Q6H9S3	Enterobacteria_phage	44.0	1.8e-07
WP_014302848.1|702983_703352_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B3AZE5	Gordonia_phage	49.4	1.0e-13
WP_094078631.1|703946_704126_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_111936218.1|704150_704735_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_014303104.1|704737_704953_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	51.6	1.4e-13
712776:712796	attR	TTCGGAAGGAATCGTCGATTC	NA	NA	NA	NA
>prophage 3
NC_016783	Corynebacterium diphtheriae INCA 402, complete sequence	2449071	1822758	1884426	2449071	protease,transposase,tRNA	Agrobacterium_phage(18.18%)	49	NA	NA
WP_044026335.1|1822758_1825467_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	37.4	9.4e-136
WP_014303749.1|1825561_1826542_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_014303750.1|1827024_1827777_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014303751.1|1827813_1829106_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.2	1.5e-131
WP_014303752.1|1829252_1831778_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	30.2	2.8e-65
WP_003852475.1|1831872_1832502_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	44.0	3.6e-38
WP_014303753.1|1832519_1833119_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	46.7	2.5e-41
WP_014303754.1|1833284_1834631_-	trigger factor	NA	NA	NA	NA	NA
WP_003852480.1|1835458_1835695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014303755.1|1835841_1836597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003852484.1|1836673_1837147_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_014303756.1|1837178_1837799_-	DsbA family protein	NA	NA	NA	NA	NA
WP_014303757.1|1837920_1840539_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	27.5	1.8e-43
WP_010935342.1|1840794_1841811_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_010935343.1|1841822_1842215_+	globin	NA	NA	NA	NA	NA
WP_014303758.1|1842211_1842832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010935345.1|1842841_1843285_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003852495.1|1843411_1845082_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	28.2	1.7e-47
WP_003852496.1|1845179_1845668_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_014303759.1|1845851_1847888_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_014303760.1|1848114_1850400_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_003852501.1|1850420_1850621_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_014303761.1|1852092_1853298_-	MFS transporter	NA	NA	NA	NA	NA
WP_014303762.1|1853703_1854735_+	oxidoreductase	NA	NA	NA	NA	NA
WP_003852523.1|1854794_1855595_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014303763.1|1855613_1856243_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	38.6	4.3e-23
WP_014303764.1|1856423_1857254_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_014303765.1|1857254_1858508_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_014302249.1|1859429_1859879_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_003852591.1|1860199_1860475_-	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_010935369.1|1860563_1861037_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_003852595.1|1861037_1861682_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003852597.1|1861678_1862062_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_014303767.1|1862096_1871030_-	type I polyketide synthase	NA	NA	NA	NA	NA
WP_014303768.1|1871208_1871586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014303769.1|1871891_1872263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003852603.1|1872290_1872647_+	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_014303770.1|1872643_1873267_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	41.8	2.5e-07
WP_003852605.1|1873263_1873989_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_044026337.1|1873999_1874767_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_014303772.1|1874819_1875617_-	glutamate racemase	NA	NA	NA	NA	NA
WP_014303773.1|1875613_1876186_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_014303774.1|1876182_1877115_-	P1 family peptidase	NA	NA	NA	NA	NA
WP_014303775.1|1877114_1877651_-	DUF2017 domain-containing protein	NA	NA	NA	NA	NA
WP_014303776.1|1877667_1878009_-|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_003852615.1|1878070_1879384_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_014303777.1|1879415_1881383_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	29.8	6.8e-67
WP_003852618.1|1881384_1881912_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014302836.1|1883076_1884426_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.4	8.0e-35
>prophage 4
NC_016783	Corynebacterium diphtheriae INCA 402, complete sequence	2449071	2053206	2098103	2449071	transposase	Bacillus_phage(14.29%)	44	NA	NA
WP_014303899.1|2053206_2054586_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.7	6.0e-38
WP_014303902.1|2056276_2056426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014303904.1|2057022_2058396_+	dipeptidase	NA	NA	NA	NA	NA
WP_014303905.1|2058562_2059723_+	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_014303906.1|2059665_2060745_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_014303907.1|2060741_2061296_-	LytR C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_016830141.1|2061298_2061502_-	DUF3263 domain-containing protein	NA	NA	NA	NA	NA
WP_014303908.1|2061500_2062064_+	peptide deformylase	NA	A0A2I7R224	Vibrio_phage	38.2	1.0e-12
WP_014303909.1|2062080_2062968_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014303910.1|2062972_2063680_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_014303911.1|2063676_2065110_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_003852994.1|2065813_2066551_-	multidrug ABC transporter permease	NA	NA	NA	NA	NA
WP_014303914.1|2066534_2067464_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.7	2.4e-30
WP_014303915.1|2067465_2068722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014303916.1|2068718_2069666_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014303917.1|2069662_2071825_+	serine/threonine protein kinase	NA	A0A1V0SBL0	Catovirus	24.0	4.6e-08
WP_003853004.1|2071844_2073044_-	acetate kinase	NA	NA	NA	NA	NA
WP_014303918.1|2073044_2074412_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_014303919.1|2074674_2076033_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014303920.1|2076044_2076941_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_003853372.1|2076972_2077473_+	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_014303921.1|2077504_2078392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014303922.1|2078388_2079819_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_003853379.1|2079819_2079987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014303923.1|2080201_2081491_-	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	35.4	1.5e-67
WP_016830150.1|2081673_2081826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_193345910.1|2082130_2082967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014303926.1|2082963_2084091_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_014303927.1|2084204_2085338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014303928.1|2085429_2086554_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_014303929.1|2086582_2086756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014303930.1|2087023_2087935_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_014302413.1|2088223_2089336_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_094078774.1|2089665_2090109_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016830156.1|2090899_2091427_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_080563661.1|2091837_2092095_-|transposase	transposase	transposase	A0A2P1JR32	Mycobacterium_phage	54.7	1.9e-14
WP_016830159.1|2092770_2093487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016830160.1|2093707_2093857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094078637.1|2093945_2094188_-	recombinase family protein	NA	NA	NA	NA	NA
WP_016830164.1|2096490_2096694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014303942.1|2096841_2097063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080563662.1|2097366_2097546_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014303944.1|2097499_2097646_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	62.9	1.6e-05
WP_029589643.1|2097926_2098103_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_016783	Corynebacterium diphtheriae INCA 402, complete sequence	2449071	2174338	2180706	2449071		Staphylococcus_phage(33.33%)	10	NA	NA
WP_014304000.1|2174338_2175544_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	36.3	2.1e-50
WP_014304001.1|2175549_2176113_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	72.6	6.6e-76
WP_010935613.1|2176407_2177187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014304002.1|2177183_2178017_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	9.3e-26
WP_010935615.1|2178013_2178346_-	PLDc N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_014304003.1|2178345_2179038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044026344.1|2179037_2179364_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014304004.1|2179684_2180062_-	HNH endonuclease	NA	A0A2H4PHY5	Pseudomonas_phage	46.5	5.5e-10
WP_158307794.1|2179943_2180390_-	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVZ8	Staphylococcus_phage	51.2	2.7e-16
WP_014304006.1|2180460_2180706_-	Bro-N domain-containing protein	NA	E7DUM4	Liberibacter_phage	59.5	1.1e-19
