The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_020272	Bacillus amyloliquefaciens IT-45, complete genome	3928857	249988	291878	3928857	holin,coat,lysis	Bacillus_phage(50.0%)	46	NA	NA
WP_003150905.1|249988_250669_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_003150907.1|250650_251037_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_003150908.1|251143_252052_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015387526.1|252054_252873_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_015387527.1|252869_253544_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_003150912.1|253947_255204_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_015387528.1|255291_255894_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_015387529.1|255914_256589_-	streptomycin biosynthesis protein StrF	NA	NA	NA	NA	NA
WP_003150915.1|256588_257269_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003150917.1|257486_257648_-	DNA-binding anti-repressor SinI	NA	NA	NA	NA	NA
WP_003150919.1|257983_258607_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032857211.1|258686_259073_+	GtrA family protein	NA	NA	NA	NA	NA
WP_003150925.1|259311_260853_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_003150926.1|260869_261115_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_014306059.1|261617_262583_+	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
WP_012118743.1|262610_264560_+	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003150930.1|264574_265189_+	cytochrome aa3 quinol oxidase subunit III	NA	NA	NA	NA	NA
WP_003150932.1|265190_265559_+	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_003150937.1|265602_265863_-	spore morphogenesis/germination protein YwcE	NA	NA	NA	NA	NA
WP_003150939.1|266117_266615_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015387531.1|266816_268004_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_003150944.1|268107_268857_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_015387532.1|269020_270022_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014306056.1|270063_272475_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	36.8	3.8e-19
WP_003150952.1|273000_273315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003150954.1|273338_274169_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_015387533.1|274386_275769_+	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_015387534.1|275765_277205_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.3	2.4e-21
WP_003150958.1|277304_277544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003150959.1|277574_278387_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003150960.1|278536_278875_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014306054.1|278867_279503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003150962.1|279547_280075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014306052.1|280159_280966_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_012118732.1|280980_281664_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	44.7	3.2e-48
WP_015387535.1|281722_282145_+	YwdI family protein	NA	NA	NA	NA	NA
WP_003150968.1|282163_283483_+	purine permease	NA	NA	NA	NA	NA
WP_003150969.1|283546_283918_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_015387536.1|283964_284483_-|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_015387537.1|284763_285534_+	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	26.3	4.4e-06
WP_015387538.1|285538_286963_+	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_003150976.1|286984_288154_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_015387539.1|288154_289018_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014306048.1|289017_290139_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014306047.1|290128_290872_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015387541.1|290873_291878_+|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 2
NC_020272	Bacillus amyloliquefaciens IT-45, complete genome	3928857	1292173	1383331	3928857	tRNA,head,integrase,protease,holin,capsid,terminase,portal,tail	Bacillus_phage(46.94%)	98	1325510:1325525	1341751:1341766
WP_007408194.1|1292173_1292617_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_015387900.1|1292643_1294206_-	SH3 domain-containing protein	NA	E5DV68	Deep-sea_thermophilic_phage	33.3	1.5e-13
WP_003152726.1|1294863_1296138_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015387901.1|1296152_1297931_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	29.1	8.7e-13
WP_003152728.1|1298257_1299022_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	A0A291ATS8	Pandoravirus	32.5	4.1e-20
WP_015387902.1|1299097_1300366_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	52.3	3.4e-112
WP_003152730.1|1300560_1300977_+	cysteine metabolism transcriptional regulator CymR	NA	NA	NA	NA	NA
WP_003152731.1|1300995_1302135_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_015387903.1|1302171_1303287_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_088005508.1|1303374_1303995_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_014305491.1|1304013_1306392_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.7	5.8e-81
WP_003152735.1|1306510_1306969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003152738.1|1306981_1307173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003152741.1|1307194_1307326_+	DUF3918 domain-containing protein	NA	NA	NA	NA	NA
WP_015387904.1|1307361_1308018_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003152744.1|1308035_1308686_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003152745.1|1308742_1309570_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003152746.1|1309590_1310319_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	3.3e-35
WP_015387905.1|1310538_1311600_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003152748.1|1311931_1314568_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	34.1	3.1e-67
WP_003152749.1|1314652_1314919_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_003152750.1|1314927_1315344_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_003152751.1|1315356_1315638_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_014305487.1|1315748_1316840_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_015387906.1|1316991_1317645_+	O-methyltransferase	NA	NA	NA	NA	NA
WP_003152757.1|1317651_1318581_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_014305485.1|1318598_1319867_+	U32 family peptidase	NA	Q6DW11	Phage_TP	31.2	7.3e-38
WP_014418513.1|1319873_1320506_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.2	4.1e-34
WP_015387907.1|1320570_1321731_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	36.6	1.3e-65
WP_014418511.1|1322037_1323219_+	helix-turn-helix transcriptional regulator	NA	A0A288WGA2	Bacillus_phage	25.6	1.3e-09
WP_015387909.1|1323589_1323979_-	helix-turn-helix transcriptional regulator	NA	A0A0U4B088	Bacillus_phage	30.6	2.2e-06
WP_152514780.1|1324139_1324340_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015387911.1|1324380_1324698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015387912.1|1324711_1325584_+	DNA damage-inducible protein DnaD	NA	A0A0U3TZZ4	Bacillus_phage	50.2	6.5e-62
1325510:1325525	attL	AATGAAGGATTTTACA	NA	NA	NA	NA
WP_031306578.1|1325567_1326401_+	DNA replication protein	NA	Q2I8C8	Bacillus_phage	34.4	3.5e-33
WP_015387916.1|1326716_1327265_+	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	3.5e-05
WP_015387918.1|1327372_1327513_+	BH0509 family protein	NA	NA	NA	NA	NA
WP_014721584.1|1327760_1327964_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	56.9	9.8e-14
WP_015387921.1|1328484_1328715_+	hypothetical protein	NA	J9PL10	Bacillus_phage	42.9	3.0e-11
WP_015387922.1|1328711_1329113_+	hypothetical protein	NA	X2JNJ3	Bacillus_phage	45.6	1.3e-28
WP_015387923.1|1329125_1329383_+	hypothetical protein	NA	F8WQ54	Bacillus_phage	42.3	9.6e-06
WP_015387924.1|1329387_1330764_+	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	48.9	3.4e-142
WP_015387925.1|1330777_1331602_+	DNA adenine methylase	NA	Q8W5X3	Listeria_phage	48.4	1.1e-63
WP_015387927.1|1331711_1332035_+	hypothetical protein	NA	M5ABU9	Bacillus_phage	33.7	7.8e-05
WP_015387928.1|1332031_1332631_+	hypothetical protein	NA	A0A1L2JY27	Aeribacillus_phage	39.0	1.2e-27
WP_015387930.1|1333129_1333564_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	69.3	2.0e-48
WP_015387932.1|1333811_1334324_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J6J3	uncultured_Caudovirales_phage	38.8	8.5e-30
WP_015387933.1|1334335_1334788_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	56.6	2.6e-38
WP_014418494.1|1334784_1335327_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	60.0	1.1e-54
WP_015387934.1|1335887_1336622_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_015387935.1|1336756_1337038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015387936.1|1337034_1337349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015387937.1|1337396_1337765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015387938.1|1337754_1338120_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	54.2	7.9e-30
WP_015387939.1|1338347_1338863_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	44.6	1.7e-33
WP_014305147.1|1338859_1340569_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.6	2.1e-205
WP_015387940.1|1340757_1342038_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	63.3	3.4e-152
1341751:1341766	attR	AATGAAGGATTTTACA	NA	NA	NA	NA
WP_015387941.1|1342000_1342627_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	79.1	1.5e-84
WP_015387942.1|1342664_1343957_+|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	47.6	2.4e-89
WP_014305142.1|1343984_1344383_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	44.5	4.8e-12
WP_014305141.1|1344400_1344703_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	40.5	2.6e-10
WP_014418480.1|1344692_1345010_+|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	36.3	1.1e-11
WP_015387943.1|1345006_1345405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015387944.1|1345401_1345785_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_015387945.1|1345799_1346414_+|tail	tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	33.9	8.4e-24
WP_014305136.1|1346472_1346841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015387946.1|1347046_1351534_+|tail	phage tail tape measure protein	tail	A0A1Q1PVX7	Staphylococcus_phage	42.5	8.5e-65
WP_015387947.1|1351527_1352367_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	57.6	3.1e-93
WP_015387948.1|1352381_1354085_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	56.3	1.5e-179
WP_015387949.1|1354135_1356700_+	peptidase G2	NA	D6R401	Bacillus_phage	57.4	9.1e-290
WP_015387950.1|1356712_1357990_+	DUF2479 domain-containing protein	NA	D6R402	Bacillus_phage	81.9	2.1e-149
WP_014305128.1|1357986_1358349_+	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	90.8	7.1e-55
WP_015387951.1|1358345_1358534_+	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	100.0	3.7e-31
WP_015387952.1|1358585_1359008_+|holin	holin family protein	holin	D6R405	Bacillus_phage	98.5	3.3e-64
WP_015387953.1|1359056_1360070_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	96.7	4.9e-186
WP_015387954.1|1360125_1360320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015387955.1|1360337_1360847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015387956.1|1361102_1361762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003152766.1|1362375_1362849_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_015387957.1|1362901_1364656_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_015387958.1|1364719_1365436_+	YrrS family protein	NA	NA	NA	NA	NA
WP_015387959.1|1365475_1365679_-	DUF2536 family protein	NA	NA	NA	NA	NA
WP_015387960.1|1365862_1366504_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003152774.1|1366524_1367220_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_015387961.1|1367267_1368191_+	cysteine synthase family protein	NA	A0A1W6JHY1	Lactococcus_phage	43.4	8.4e-60
WP_003152778.1|1368192_1369335_+	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	A0A0B5JD48	Pandoravirus	29.2	2.8e-20
WP_003152779.1|1369418_1369649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015387962.1|1369688_1370180_-	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_094247929.1|1370197_1373140_-	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_003152783.1|1373446_1373815_+	DUF2294 domain-containing protein	NA	NA	NA	NA	NA
WP_007408225.1|1374078_1374879_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_003152787.1|1375267_1375408_+	YrzI family small protein	NA	NA	NA	NA	NA
WP_015387964.1|1375909_1376449_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003152789.1|1376658_1377225_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015387965.1|1377252_1380414_+	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	36.7	6.0e-73
WP_015387966.1|1380563_1381772_-	MFS transporter	NA	NA	NA	NA	NA
WP_003152795.1|1381896_1382781_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015387967.1|1382848_1383331_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
>prophage 3
NC_020272	Bacillus amyloliquefaciens IT-45, complete genome	3928857	1685698	1691951	3928857		Staphylococcus_phage(66.67%)	9	NA	NA
WP_015388054.1|1685698_1686814_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.9	1.2e-55
WP_003153370.1|1686794_1687442_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	1.5e-39
WP_003153371.1|1687456_1688653_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	2.1e-116
WP_003153372.1|1688685_1689150_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_003153373.1|1689266_1689641_+	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_012117889.1|1689706_1690228_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153376.1|1690315_1690405_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003153377.1|1690612_1691368_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.3	6.5e-10
WP_003153378.1|1691357_1691951_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
>prophage 4
NC_020272	Bacillus amyloliquefaciens IT-45, complete genome	3928857	2111874	2118089	3928857		Bacillus_phage(50.0%)	7	NA	NA
WP_015417523.1|2111874_2112843_-	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
WP_015388200.1|2112891_2113116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015388201.1|2113149_2113908_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.4	1.1e-52
WP_015388202.1|2113958_2114579_-	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.4	2.7e-46
WP_003154059.1|2114627_2115617_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.6	8.7e-156
WP_003154060.1|2115634_2117737_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.0	0.0e+00
WP_014305044.1|2117696_2118089_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	6.5e-30
>prophage 5
NC_020272	Bacillus amyloliquefaciens IT-45, complete genome	3928857	2667614	2699352	3928857	plate,holin,terminase,portal,tail	Bacillus_phage(33.33%)	42	NA	NA
WP_014304858.1|2667614_2668493_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.5	2.8e-81
WP_003154813.1|2668506_2668770_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_003154815.1|2668783_2669047_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_014304857.1|2669098_2669860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154819.1|2669916_2670114_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	61.8	4.3e-14
WP_014304856.1|2670119_2670491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014304855.1|2670503_2672126_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	39.3	5.3e-41
WP_014304854.1|2672128_2672401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154823.1|2672397_2672976_-	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	31.0	2.4e-12
WP_015388353.1|2672959_2674006_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.8	2.3e-69
WP_003154825.1|2673998_2674424_-	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	1.5e-11
WP_003154827.1|2674527_2674794_-	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	37.5	3.4e-06
WP_015388354.1|2674793_2675771_-	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	30.9	2.2e-34
WP_007610816.1|2675784_2676444_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	45.3	1.8e-08
WP_015388355.1|2676436_2681401_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	46.6	3.2e-41
WP_015239684.1|2681388_2681541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154836.1|2681582_2682029_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_003154837.1|2682105_2682549_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_015388356.1|2682550_2683948_-|portal	phage portal protein	portal	A0A0A7RTT5	Clostridium_phage	40.4	9.0e-82
WP_003154839.1|2683947_2684157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014304848.1|2684153_2684600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014304847.1|2684596_2685100_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_003154844.1|2685096_2685453_-	DUF3599 family protein	NA	NA	NA	NA	NA
WP_015388357.1|2685449_2685833_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_007407274.1|2685849_2686785_-|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
WP_015388358.1|2686811_2687657_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	57.1	2.2e-54
WP_088005490.1|2687676_2689068_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.6	3.0e-138
WP_003154853.1|2689116_2690415_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.6	8.5e-151
WP_003154855.1|2690411_2691209_-|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	50.6	9.4e-60
WP_003154857.1|2691321_2691834_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	43.9	5.0e-22
WP_003154859.1|2691946_2692150_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	5.4e-12
WP_003154861.1|2692139_2692481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154865.1|2692745_2693546_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.1	3.6e-59
WP_003154867.1|2693445_2694273_-|portal	phage portal protein	portal	S6BFM4	Thermus_phage	27.9	6.4e-19
WP_003154869.1|2694262_2694442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154871.1|2694633_2694972_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
WP_003154873.1|2695120_2695711_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_003154876.1|2695865_2696471_-	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	46.8	7.4e-41
WP_003154878.1|2696580_2696958_+	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	40.6	1.1e-15
WP_003154880.1|2696995_2697949_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
WP_003154881.1|2698091_2698226_-	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_087920760.1|2698215_2699352_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
>prophage 6
NC_020272	Bacillus amyloliquefaciens IT-45, complete genome	3928857	2762033	2813885	3928857	head,integrase,coat,holin,capsid,terminase,portal,tail	uncultured_Caudovirales_phage(38.24%)	70	2757850:2757909	2798957:2799040
2757850:2757909	attL	AAAGTAAAAAACCCTTGCTACGCAAGGGTTTTGGCTATGATTCCGACTGGGCTCGAACCA	NA	NA	NA	NA
WP_015239640.1|2762033_2762456_-|holin	holin	holin	D6R405	Bacillus_phage	89.5	3.8e-60
WP_015388395.1|2762723_2762891_-	XkdX family protein	NA	NA	NA	NA	NA
WP_015388396.1|2763029_2763419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015388397.1|2763432_2766816_-	hypothetical protein	NA	Q5YA57	Bacillus_phage	46.1	2.1e-132
WP_015388398.1|2766828_2767593_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_015388399.1|2767589_2772404_-	hypothetical protein	NA	M9NRJ5	Staphylococcus_phage	24.3	4.7e-37
WP_003155844.1|2772408_2772717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003155845.1|2772764_2773271_-	hypothetical protein	NA	I6T7F0	Staphylococcus_virus	33.3	6.7e-11
WP_076983191.1|2773327_2773570_-	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_076983182.1|2773583_2773898_-	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	77.8	4.6e-26
WP_015388401.1|2773839_2774352_-|tail	phage major tail protein, TP901-1 family	tail	Q0PDK9	Bacillus_phage	42.4	1.2e-26
WP_015239630.1|2774365_2774764_-	DUF3168 domain-containing protein	NA	W8EK61	Geobacillus_phage	44.6	4.9e-25
WP_007408589.1|2774782_2775199_-	HK97 gp10 family phage protein	NA	O48447	Bacillus_phage	54.2	7.4e-32
WP_015388402.1|2775191_2775530_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_015388403.1|2775526_2775826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015388404.1|2775834_2776086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015388405.1|2776087_2776429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015388406.1|2776433_2777351_-|capsid	phage major capsid protein	capsid	A0A2H4JCG0	uncultured_Caudovirales_phage	67.9	2.9e-113
WP_015388407.1|2777366_2777948_-	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	56.3	1.5e-54
WP_015388408.1|2778050_2778977_-|head	head protein	head	A0A1Q1PVS0	Bacillus_phage	51.5	3.9e-81
WP_014304497.1|2778963_2780367_-|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	59.8	1.8e-154
WP_032865737.1|2780372_2781581_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J8B0	uncultured_Caudovirales_phage	84.5	1.8e-203
WP_015388410.1|2781567_2782323_-	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	54.2	1.2e-61
WP_015388411.1|2782482_2782695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015388412.1|2783071_2783935_-	C1 family peptidase	NA	A0A1V0SLQ7	Klosneuvirus	28.5	3.0e-19
WP_015388413.1|2784045_2784261_-	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	48.6	7.5e-12
WP_015239615.1|2784794_2785310_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	43.2	4.0e-27
WP_152514779.1|2785540_2786293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015388416.1|2786463_2787288_-	DNA adenine methylase	NA	Q8W5X3	Listeria_phage	48.4	2.9e-64
WP_015388417.1|2787291_2787549_-	hypothetical protein	NA	F8WQ54	Bacillus_phage	40.0	6.6e-07
WP_015388418.1|2787545_2787830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003155894.1|2787861_2788065_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	75.4	3.4e-22
WP_015388419.1|2788355_2788784_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	63.5	7.3e-43
WP_152514781.1|2789018_2789966_-	AAA family ATPase	NA	A0A0K2CPA5	Brevibacillus_phage	50.7	2.0e-56
WP_015388423.1|2789850_2790552_-	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	33.3	1.2e-05
WP_021734186.1|2790749_2791487_-	hypothetical protein	NA	A0A0A7RUC1	Clostridium_phage	44.9	1.5e-51
WP_015388425.1|2791506_2792424_-	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	62.5	1.1e-88
WP_015388426.1|2792420_2792612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015388427.1|2792611_2792962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015388428.1|2793064_2793268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015388429.1|2793264_2793522_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	38.0	3.9e-07
WP_015388430.1|2793518_2794091_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	56.1	2.0e-59
WP_015388431.1|2794148_2794877_-	phage regulatory protein	NA	A0A2H4J4N4	uncultured_Caudovirales_phage	63.3	1.4e-86
WP_007408621.1|2794873_2795068_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015388432.1|2795078_2795303_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J4N8	uncultured_Caudovirales_phage	81.1	7.2e-26
WP_015239592.1|2795461_2795836_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	65.9	1.2e-33
WP_015388433.1|2796057_2797035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015388434.1|2797107_2797629_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	63.9	2.7e-55
WP_015388435.1|2797633_2798863_+|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	49.5	1.2e-106
WP_003154961.1|2799203_2800379_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
2798957:2799040	attR	AAAGTAAAAAACCCTTGCTACGCAAGGGTTTTGGCTATGATTCCGACTGGGCTCGAACCAGCGACCTCTACCCTGTCAAGGTAG	NA	NA	NA	NA
WP_015388436.1|2800371_2801493_-	methionine biosynthesis PLP-dependent protein	NA	NA	NA	NA	NA
WP_015388437.1|2801862_2802585_+	esterase family protein	NA	NA	NA	NA	NA
WP_003154969.1|2802610_2803126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154971.1|2803130_2803562_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003154973.1|2803722_2803956_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014304807.1|2803956_2804694_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.3	5.2e-28
WP_003154977.1|2804686_2805409_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015388438.1|2805449_2806199_-	subclass B1 metallo-beta-lactamase	NA	NA	NA	NA	NA
WP_003154980.1|2806267_2806522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015388439.1|2806642_2808928_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	33.2	1.9e-84
WP_003154986.1|2808996_2809251_-	sporulation protein	NA	NA	NA	NA	NA
WP_003154988.1|2809413_2809581_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003154990.1|2809673_2809871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015388440.1|2810158_2810515_-	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_003154992.1|2810685_2811072_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154993.1|2811109_2811424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154994.1|2811516_2812017_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154995.1|2812167_2812650_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154997.1|2812795_2813239_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015388441.1|2813297_2813885_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 7
NC_020272	Bacillus amyloliquefaciens IT-45, complete genome	3928857	3286386	3296277	3928857		Synechococcus_phage(50.0%)	9	NA	NA
WP_015388587.1|3286386_3287925_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	5.1e-78
WP_003155752.1|3287921_3288509_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.3	1.0e-26
WP_015388588.1|3288505_3289546_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.1	1.4e-63
WP_015388589.1|3289637_3291068_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	1.6e-54
WP_015388590.1|3291043_3293272_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.5	3.2e-158
WP_015388591.1|3293255_3293939_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003155758.1|3293935_3294190_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_015388592.1|3294189_3294909_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.7	3.4e-48
WP_007408896.1|3294984_3296277_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
