The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017656	Escherichia coli O55:H7 str. RM12579, complete sequence	5263980	199837	350082	5263980	head,tRNA,integrase,terminase,lysis,transposase,capsid,tail,protease,plate,holin	Enterobacteria_phage(33.78%)	146	278617:278631	350498:350512
WP_001295561.1|199837_201190_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|201219_203652_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|203773_204259_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|204262_205288_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|205392_205848_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|205851_206640_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139681.1|206639_207788_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569419.1|207784_208381_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
WP_001294783.1|208417_211900_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	1.7e-209
WP_000055741.1|211912_212872_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020954.1|212970_215112_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|215168_215558_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176547.1|215622_216918_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|216970_217231_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|217217_217418_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185305.1|217583_218129_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|218125_218548_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|218561_219272_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001359023.1|219471_220296_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|220348_222067_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094000.1|222177_222885_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|222881_223286_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|223403_224219_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|224258_224912_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|224904_225936_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|226123_226699_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|232445_233249_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|233245_234160_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|234400_235201_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211697.1|235278_236049_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|236096_237455_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|237526_238282_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001307587.1|238315_239038_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|239034_239502_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|239566_240298_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001086136.1|240834_241635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|242112_242562_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000964776.1|242564_243161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414527.1|243308_243461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284959.1|243481_243961_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|243926_245336_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001303798.1|245346_248781_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240517.1|248889_250302_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088854.1|250306_251050_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614382.1|251046_253818_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.8	3.6e-82
WP_000343294.1|253826_254588_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246448.1|254592_255924_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080154.1|255926_256451_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000348794.1|257751_258834_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|258797_260648_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611740.1|260651_261065_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000123970.1|262597_262822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037397.1|262856_263357_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|264053_264572_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103347.1|264781_266923_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	8.2e-26
WP_000509136.1|266998_271231_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_071529145.1|271436_272087_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001419315.1|273845_274355_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000420853.1|275100_276237_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000247943.1|278201_278465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|278379_278565_-	protein YncO	NA	NA	NA	NA	NA
278617:278631	attL	AATAACTAAAAAGAT	NA	NA	NA	NA
WP_000027429.1|278645_279818_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_001118031.1|279935_280706_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|280859_281333_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973088.1|281375_283820_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|284059_284638_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001301698.1|284742_285510_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|285480_286221_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615979.1|286376_286655_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729705.1|286657_286918_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543891.1|287103_287877_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000207556.1|289135_289921_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226186.1|289991_291047_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554757.1|291098_291392_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263495.1|291394_291793_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059871.1|291802_292255_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|293353_294811_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|295071_295530_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189550.1|295621_296866_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174701.1|296923_297325_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749889.1|297363_298419_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	2.9e-117
WP_001285288.1|298706_299810_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893281.1|299821_301075_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	4.4e-96
WP_000023577.1|301279_302440_-|integrase	site-specific integrase	integrase	K7P7R5	Enterobacteria_phage	99.5	7.2e-226
WP_001281200.1|302753_303098_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	99.1	5.9e-59
WP_000103020.1|303198_303963_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.5	4.5e-51
WP_001289865.1|303959_304466_-	ead/Ea22-like family protein	NA	K7P6T4	Enterobacteria_phage	86.7	3.1e-56
WP_000763359.1|304462_304684_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	94.5	4.6e-33
WP_000188870.1|304782_304998_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548536.1|305074_305266_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|305238_305421_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|305417_306098_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001418384.1|306094_306880_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
WP_000995449.1|306885_307182_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000372937.1|307255_307399_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|307367_307532_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000213973.1|307755_307956_-	antirestriction Ral family protein	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	9.3e-33
WP_000281856.1|308222_308705_+	super-infection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_000340011.1|308705_309029_-	antitermination protein	NA	A4KWR8	Enterobacteria_phage	99.1	1.0e-52
WP_000618044.1|309380_309785_-	hypothetical protein	NA	A0A088CQ79	Enterobacteria_phage	98.5	5.6e-69
WP_000028392.1|309781_310414_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_001194218.1|310517_310733_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000251069.1|310852_311146_+	lambda phage CII family protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000185433.1|311178_312078_+	replication protein	NA	K7P7F0	Enterobacteria_phage	99.7	2.5e-173
WP_000788868.1|312074_312776_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.1	2.9e-129
WP_000145894.1|312772_313063_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	97.9	3.1e-45
WP_000736913.1|313136_313577_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000153282.1|313573_314101_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	2.8e-100
WP_001254239.1|314097_314280_+	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	100.0	1.9e-29
WP_000566862.1|314276_314447_+	protein ninF	NA	K7PMD9	Enterobacterial_phage	96.4	9.3e-26
WP_001107957.1|314439_315045_+	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	98.0	8.1e-96
WP_001028867.1|315041_315713_+	serine/threonine protein phosphatase	NA	H6WZJ4	Escherichia_phage	95.0	1.1e-125
WP_000512795.1|315703_316228_+	DUF1133 family protein	NA	Q716B8	Shigella_phage	97.1	3.8e-94
WP_001419325.1|316723_316855_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000026511.1|317151_318993_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	77.9	3.6e-288
WP_024164617.1|319430_319646_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075122.1|319645_320143_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	1.3e-91
WP_072020783.1|320359_320542_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	1.4e-14
WP_001302690.1|321068_321383_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_013009113.1|321463_321688_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_000235440.1|322089_322599_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	7.2e-13
WP_100661945.1|322600_324106_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	69.1	3.3e-207
WP_001253897.1|324727_326233_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	6.1e-100
WP_000256840.1|326269_326617_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522651.1|326674_327703_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_000201530.1|327754_328129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204539.1|328121_328475_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	68.4	7.4e-41
WP_000155463.1|328486_329020_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	71.4	2.0e-61
WP_000683050.1|329016_329412_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	96.2	7.2e-69
WP_001419284.1|329419_330160_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	96.3	1.2e-128
WP_000479189.1|330175_330598_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	86.4	1.3e-60
WP_000459456.1|330579_331014_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840280.1|331006_333586_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	92.9	0.0e+00
WP_000847379.1|333582_333912_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152569.1|333911_334610_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	1.3e-129
WP_000140754.1|334615_335359_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	2.7e-149
WP_000090854.1|335295_335898_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.1	1.2e-88
WP_000515317.1|335958_339372_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.3	0.0e+00
WP_001233141.1|339442_340042_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741872.1|340101_341418_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	94.5	3.5e-67
WP_001024023.1|341419_341689_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	97.8	8.4e-45
WP_001117988.1|341800_342373_+	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	52.7	2.1e-45
WP_001144082.1|343112_343739_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.7e-25
WP_001132163.1|343921_344512_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_000950786.1|345511_346492_+	NleB family type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	50.5	5.9e-88
WP_001130496.1|348900_350082_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.6	1.1e-144
350498:350512	attR	AATAACTAAAAAGAT	NA	NA	NA	NA
>prophage 2
NC_017656	Escherichia coli O55:H7 str. RM12579, complete sequence	5263980	684163	749395	5263980	head,portal,tRNA,integrase,terminase,lysis,capsid,transposase,protease,tail,holin	Enterobacteria_phage(62.26%)	73	694324:694370	740872:740918
WP_000912351.1|684163_685549_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143558.1|685584_686106_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|686213_686426_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|686427_687294_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|687773_688316_+	type 1 fimbrial major subunit FimA	NA	NA	NA	NA	NA
WP_000988382.1|688535_689228_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001419152.1|689258_691868_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691070.1|691880_692888_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255114.1|692898_693414_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_001359679.1|693416_694049_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
694324:694370	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001359450.1|694383_695547_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.0	6.3e-198
WP_000488407.1|695745_696024_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|696071_696290_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000188870.1|696388_696604_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_001419148.1|696724_697237_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	64.2	4.6e-52
WP_000149536.1|697229_697391_-	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.0	1.3e-21
WP_000186801.1|697387_698068_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.9e-131
WP_000100847.1|698064_698850_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|698855_699152_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000233576.1|699227_699434_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_001417737.1|700022_701630_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000712399.1|701736_702429_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_000184665.1|702539_702767_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182879.1|702797_703337_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.7	6.8e-62
WP_000147923.1|703333_704353_+	replication protein	NA	M1FN81	Enterobacteria_phage	67.0	2.8e-109
WP_000788830.1|704349_705051_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.7	3.2e-128
WP_000145438.1|705047_705332_+	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	95.7	1.1e-42
WP_000390541.1|705800_706082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141214.1|706172_706274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053021.1|706270_706726_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_000224907.1|706725_706896_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|706888_707179_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|707175_707538_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|707534_707675_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097226.1|707671_708361_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	49.4	1.5e-58
WP_000544528.1|708682_708988_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|708974_709451_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_122993458.1|709667_709850_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.7	1.1e-16
WP_000738495.1|709940_710234_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_001417742.1|710525_710936_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	97.8	3.9e-70
WP_001031427.1|711221_711428_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|711592_711787_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001027277.1|712694_714620_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198149.1|714616_714823_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001359455.1|714819_716421_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	100.0	5.9e-312
WP_000123237.1|716401_717721_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	2.0e-232
WP_001299443.1|717730_718063_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000063260.1|718118_719144_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	3.4e-187
WP_000710708.1|719185_719581_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	91.7	1.3e-54
WP_000753019.1|719592_719946_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000975054.1|719957_720536_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
WP_000683105.1|720532_720928_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001349920.1|720935_721676_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479153.1|721691_722114_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459484.1|722095_722530_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	5.0e-63
WP_000847379.1|725080_725410_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152525.1|725409_726108_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_000140753.1|726113_726857_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.9e-149
WP_000090855.1|726793_727402_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.6	2.2e-101
WP_000515299.1|727462_730861_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.6	0.0e+00
WP_001230405.1|730927_731527_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	8.8e-111
WP_000279124.1|731591_734498_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	4.2e-57
WP_000885620.1|734497_735082_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.1e-102
WP_000239881.1|735136_735805_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226369.1|736349_737834_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201812.1|738020_738974_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000361110.1|739472_740057_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001359465.1|740081_740519_-	acetyltransferase	NA	NA	NA	NA	NA
WP_001177464.1|740961_741723_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
740872:740918	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224578.1|741905_742796_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001301880.1|742796_745769_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383931.1|745755_747993_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420895.1|748258_749395_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_017656	Escherichia coli O55:H7 str. RM12579, complete sequence	5263980	974992	1019871	5263980	portal,integrase,terminase,lysis,protease,tail,holin	Enterobacteria_phage(50.0%)	63	963509:963524	982724:982739
963509:963524	attL	CGTTACGGATTTACAA	NA	NA	NA	NA
WP_000533643.1|974992_976063_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_001303849.1|976040_976259_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|976298_976466_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120060.1|976708_977311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763358.1|977521_977743_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
WP_000188870.1|977841_978057_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548536.1|978133_978325_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|978297_978480_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|978476_979157_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001418384.1|979153_979939_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
WP_000995449.1|979944_980241_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000372937.1|980314_980458_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|980426_980591_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000213973.1|980814_981015_-	antirestriction Ral family protein	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	9.3e-33
WP_000281856.1|981281_981764_+	super-infection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_000340011.1|981764_982088_-	antitermination protein	NA	A4KWR8	Enterobacteria_phage	99.1	1.0e-52
WP_000618044.1|982439_982844_-	hypothetical protein	NA	A0A088CQ79	Enterobacteria_phage	98.5	5.6e-69
982724:982739	attR	TTGTAAATCCGTAACG	NA	NA	NA	NA
WP_000028392.1|982840_983473_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_001194218.1|983576_983792_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000251069.1|983911_984205_+	lambda phage CII family protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000185433.1|984237_985137_+	replication protein	NA	K7P7F0	Enterobacteria_phage	99.7	2.5e-173
WP_000788868.1|985133_985835_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.1	2.9e-129
WP_000145894.1|985831_986122_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	97.9	3.1e-45
WP_000736913.1|986195_986636_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_001254218.1|986632_986815_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567000.1|986811_986982_+	protein ninF	NA	Q716C4	Shigella_phage	98.2	4.6e-25
WP_001108059.1|986974_987595_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.6	4.1e-95
WP_001028854.1|987591_988257_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_000750160.1|988468_989428_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|989765_989888_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|989902_990592_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|990776_991520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|991605_991764_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|991844_992243_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|992385_992601_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075144.1|992600_993098_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	1.9e-90
WP_000092264.1|993094_993562_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	98.1	2.5e-76
WP_001139679.1|993549_993702_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000349509.1|994376_994868_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934091.1|994867_996970_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_001072975.1|996966_997179_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985949.1|997178_998687_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.6	4.5e-289
WP_001097050.1|1000745_1001069_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|1001061_1001337_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677100.1|1001348_1001927_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	9.4e-102
WP_001079422.1|1001923_1002325_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|1002335_1003079_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|1003139_1003526_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_001161009.1|1003534_1003864_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371991.1|1003835_1006901_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.1	0.0e+00
WP_000447253.1|1006900_1007230_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152339.1|1007239_1007938_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_001419734.1|1007943_1008687_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	4.5e-149
WP_000090845.1|1008623_1009232_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.1e-100
WP_000515306.1|1009292_1012706_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.9	0.0e+00
WP_001230272.1|1012775_1013375_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	95.5	7.7e-107
WP_000279047.1|1013439_1014753_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	97.7	2.4e-76
WP_001101707.1|1014754_1015024_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	97.8	9.3e-44
WP_000950813.1|1015200_1016181_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|1016214_1017234_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|1017730_1017892_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|1018060_1018942_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_001247931.1|1019172_1019871_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 4
NC_017656	Escherichia coli O55:H7 str. RM12579, complete sequence	5263980	1568215	1635342	5263980	head,integrase,terminase,capsid,transposase,protease,tail,holin	Stx2-converting_phage(31.91%)	72	1561106:1561119	1577895:1577908
1561106:1561119	attL	TGGTATGCAGTAAC	NA	NA	NA	NA
WP_000113678.1|1568215_1569499_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	4.2e-102
WP_000113189.1|1569476_1569725_-	excisionase	NA	NA	NA	NA	NA
WP_000048548.1|1569789_1572240_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.4	3.5e-57
WP_001090200.1|1572332_1572524_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1572520_1572709_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000920491.1|1573267_1573501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1573478_1573886_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|1573908_1574127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1574199_1574499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1574763_1575171_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|1575247_1575475_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705622.1|1575458_1576010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|1575981_1577022_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_158000104.1|1576933_1577476_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.0	2.2e-84
WP_000450692.1|1577509_1578244_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
1577895:1577908	attR	GTTACTGCATACCA	NA	NA	NA	NA
WP_001505071.1|1578240_1578405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1579103_1579862_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|1580140_1580353_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_000975564.1|1580571_1580832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|1580901_1581180_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001265289.1|1581181_1582237_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_000140002.1|1582237_1582603_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001059384.1|1582599_1583289_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000023143.1|1584807_1586658_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_024164617.1|1587096_1587312_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075122.1|1587311_1587809_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	1.3e-91
WP_001208681.1|1588025_1588211_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_001303878.1|1588738_1589053_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|1589134_1589359_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001359494.1|1589400_1589931_+	HNH endonuclease	NA	H6WZK7	Escherichia_phage	92.6	2.6e-90
WP_001419048.1|1590046_1590610_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	9.2e-86
WP_001417827.1|1590606_1592268_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000173049.1|1592331_1594269_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	97.4	0.0e+00
WP_001063105.1|1594313_1594535_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	93.2	4.6e-33
WP_000125996.1|1597061_1597388_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	1.6e-53
WP_001007889.1|1597398_1597749_+|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000573390.1|1597745_1598192_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_000141141.1|1598188_1598533_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	98.2	3.6e-56
WP_001275473.1|1598599_1599316_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	3.3e-128
WP_001030057.1|1599321_1599696_+|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001453698.1|1599791_1600001_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212946.1|1600052_1603319_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	78.7	0.0e+00
WP_000807954.1|1603311_1603653_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001419047.1|1603652_1604351_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	96.6	1.3e-129
WP_014640511.1|1604361_1605105_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	3.8e-148
WP_064761467.1|1605050_1605680_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	1.2e-102
WP_000514957.1|1605920_1609397_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	98.4	0.0e+00
WP_085959019.1|1609478_1610692_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_029783341.1|1610710_1611349_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.7	5.2e-69
WP_000279199.1|1611413_1612574_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	97.9	6.3e-81
WP_001023357.1|1612575_1612845_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
WP_000767050.1|1613065_1613608_+	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_106423857.1|1613552_1613747_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	87.2	1.1e-09
WP_106409364.1|1615756_1615879_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|1615985_1616897_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|1616962_1617532_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_001079491.1|1619991_1620498_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|1620543_1621044_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1621129_1621309_-	general stress protein	NA	NA	NA	NA	NA
WP_000443044.1|1621689_1622496_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|1622495_1623689_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983857.1|1623700_1625062_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763520.1|1625062_1626658_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194629.1|1626657_1628220_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1628311_1628356_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|1628493_1629375_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1629371_1629992_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001419072.1|1630019_1631603_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|1631815_1632688_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278896.1|1632727_1633318_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|1633314_1634073_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|1634292_1635342_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 5
NC_017656	Escherichia coli O55:H7 str. RM12579, complete sequence	5263980	1718981	1773401	5263980	portal,tRNA,terminase,protease,tail,holin	Escherichia_phage(33.87%)	68	NA	NA
WP_000628061.1|1718981_1720214_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1720468_1721452_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001625136.1|1721726_1721897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123746.1|1721929_1723303_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000662472.1|1723431_1724367_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.7e-145
WP_000040839.1|1724418_1725654_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|1725655_1725871_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|1725970_1726159_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|1726196_1726346_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|1726401_1727211_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000102126.1|1727203_1729876_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	96.1	6.2e-172
WP_000199475.1|1729968_1730157_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|1730153_1730342_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000379610.1|1730831_1730984_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
WP_000362153.1|1731249_1731669_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|1731769_1732051_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693888.1|1732034_1732460_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095674.1|1732482_1733451_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	52.7	1.8e-73
WP_000790459.1|1733457_1734198_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	6.2e-114
WP_000450861.1|1734227_1734998_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.8	1.2e-80
WP_001141104.1|1735013_1735406_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	5.9e-39
WP_001266130.1|1735402_1735699_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001209468.1|1735695_1736304_+	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	68.9	8.2e-72
WP_000137945.1|1736401_1736878_+	hypothetical protein	NA	O64352	Escherichia_phage	44.4	1.1e-07
WP_000128514.1|1737112_1737325_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	9.6e-28
WP_001219082.1|1737569_1737929_+	helix-turn-helix transcriptional regulator	NA	L7TKV7	Pseudomonas_virus	50.9	7.1e-23
WP_000284536.1|1737931_1738408_+	ImmA/IrrE family metallo-endopeptidase	NA	L7THB5	Pseudomonas_virus	33.3	1.7e-16
WP_032207160.1|1738840_1739119_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
WP_001265237.1|1739120_1740170_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	8.5e-109
WP_001217425.1|1740182_1740542_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	4.6e-38
WP_001064874.1|1740538_1741207_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	8.7e-59
WP_000874523.1|1742468_1744415_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.5	0.0e+00
WP_014640514.1|1744552_1744732_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	98.3	1.1e-24
WP_001290217.1|1744772_1745045_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000284510.1|1745121_1745337_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000087714.1|1745341_1745875_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_001056883.1|1746149_1746719_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
WP_000455406.1|1746718_1746868_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_123005736.1|1747095_1747302_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	94.1	2.9e-29
WP_001139680.1|1747330_1747483_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_000343114.1|1747561_1747849_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	60.0	3.1e-29
WP_171815854.1|1747925_1748102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373409.1|1748362_1748839_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	99.4	9.5e-84
WP_001077625.1|1748835_1750959_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102415.1|1750955_1751168_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974568.1|1751167_1752670_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_001114423.1|1752614_1754639_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_001097065.1|1754726_1755053_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281346.1|1755045_1755327_+	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	97.8	7.9e-46
WP_000974951.1|1755329_1755953_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	93.7	3.1e-98
WP_000682718.1|1755965_1756364_+	hypothetical protein	NA	Q9EYD7	Enterobacteria_phage	99.2	1.7e-70
WP_000235130.1|1756371_1757121_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	95.2	8.7e-132
WP_000479056.1|1757136_1757559_+|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	98.6	4.3e-72
WP_000532075.1|1757585_1757894_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_000918244.1|1757937_1760583_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000847298.1|1760579_1760909_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001419068.1|1760908_1761607_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_014640516.1|1761617_1762361_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.0e-145
WP_139003283.1|1762306_1762942_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.4	1.3e-99
WP_000515151.1|1763188_1766680_+	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	98.3	0.0e+00
WP_001230550.1|1766750_1767350_+	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000268808.1|1767414_1768728_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.6	1.4e-76
WP_001023994.1|1768729_1768999_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	96.6	1.9e-44
WP_001131659.1|1769111_1769687_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001359536.1|1769759_1770389_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	5.1e-77
WP_001143784.1|1770470_1771112_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001295593.1|1771692_1772127_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837948.1|1772267_1773401_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	1.1e-117
>prophage 6
NC_017656	Escherichia coli O55:H7 str. RM12579, complete sequence	5263980	1954562	2012243	5263980	head,portal,terminase,integrase,capsid,transposase,tail,holin	Enterobacteria_phage(37.93%)	72	1988162:1988177	2020410:2020425
WP_000214712.1|1954562_1954766_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|1954801_1956262_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_001120551.1|1957765_1958008_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000343700.1|1958057_1959266_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	1.6e-47
WP_001121226.1|1959415_1960066_-	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001131642.1|1960776_1961352_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023432.1|1961464_1961734_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	97.8	5.4e-44
WP_014640517.1|1961735_1963049_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.6	2.6e-75
WP_001230346.1|1963113_1963713_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	97.5	7.5e-110
WP_000515300.1|1963779_1967178_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	87.7	0.0e+00
WP_000090855.1|1967238_1967847_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.6	2.2e-101
WP_000140753.1|1967783_1968527_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.9e-149
WP_001152525.1|1968532_1969231_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_000847379.1|1969230_1969560_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000082476.1|1969556_1972136_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.7	0.0e+00
WP_000533426.1|1972116_1972530_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	1.3e-41
WP_000479105.1|1972556_1972988_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000235113.1|1973001_1973754_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	2.7e-133
WP_000683079.1|1973761_1974157_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974984.1|1974153_1974687_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.9e-56
WP_001204554.1|1974702_1975056_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201512.1|1975048_1975432_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522655.1|1975483_1976512_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.5e-113
WP_000256821.1|1976569_1976917_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.6e-22
WP_001253995.1|1976953_1978459_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000831776.1|1978448_1980041_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_000259002.1|1980037_1980244_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001418004.1|1980227_1982156_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	3.9e-261
WP_000235436.1|1982127_1982637_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000105085.1|1983031_1983259_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	98.7	1.1e-34
WP_012816791.1|1983683_1983869_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|1984096_1984243_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|1984242_1984812_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992167.1|1985082_1985616_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_000731256.1|1985666_1986011_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	98.2	2.9e-58
WP_000284518.1|1986015_1986231_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|1986306_1986576_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|1986613_1986796_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|1986943_1988881_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
1988162:1988177	attL	CAGCACATTTTTCGGG	NA	NA	NA	NA
WP_000762928.1|1989959_1990781_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217410.1|1990777_1991152_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_001265028.1|1991164_1992211_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
WP_001417850.1|1992212_1992491_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001302544.1|1992431_1992617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018421.1|1992658_1992871_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001278454.1|1993060_1993165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001278454.1|1993167_1993272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207995.1|1993387_1994257_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	77.2	1.0e-120
WP_000224233.1|1994267_1994531_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000256993.1|1994532_1994751_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	86.1	1.1e-26
WP_000935420.1|1994783_1994996_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_001151256.1|1995422_1995848_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.7	1.8e-62
WP_000770544.1|1995888_1996854_-	hypothetical protein	NA	U5P0A0	Shigella_phage	65.0	4.3e-59
WP_000693859.1|1996878_1997304_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471546.1|1997300_1997516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000104592.1|1997565_1998282_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	40.8	6.7e-49
WP_001414141.1|1998547_1998700_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|1998814_1999330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449178.1|1999878_2000067_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090185.1|2000063_2000267_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048562.1|2000346_2002818_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	57.4	1.4e-53
WP_000005551.1|2002889_2003141_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
WP_001206152.1|2003160_2004456_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	7.4e-155
WP_001531709.1|2004481_2004586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836042.1|2004643_2005663_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.5	1.1e-17
WP_001358608.1|2005674_2006889_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	3.1e-46
WP_001358609.1|2007094_2007421_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705189.1|2007555_2007897_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|2007931_2008492_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001303515.1|2008494_2009205_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_000778147.1|2009312_2009618_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041706.1|2009816_2012243_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	5.5e-212
2020410:2020425	attR	CAGCACATTTTTCGGG	NA	NA	NA	NA
>prophage 7
NC_017656	Escherichia coli O55:H7 str. RM12579, complete sequence	5263980	2399363	2445712	5263980	head,portal,terminase,integrase,capsid,protease,tail,holin	Enterobacteria_phage(36.59%)	56	2422569:2422583	2454614:2454628
WP_001023480.1|2399363_2399633_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	98.9	7.1e-44
WP_000279045.1|2399634_2400948_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	97.5	6.9e-76
WP_001230271.1|2401012_2401612_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	96.0	2.0e-107
WP_000515116.1|2401679_2405156_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	94.0	0.0e+00
WP_000649829.1|2405289_2405817_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_050546863.1|2406008_2406641_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_014640521.1|2406586_2407330_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	5.6e-147
WP_001357740.1|2407335_2408034_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847304.1|2408033_2408363_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082477.1|2408359_2410939_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	85.8	0.0e+00
WP_000533426.1|2410919_2411333_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	1.3e-41
WP_000479105.1|2411359_2411791_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000235113.1|2411804_2412557_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	2.7e-133
WP_000683079.1|2412564_2412960_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974984.1|2412956_2413490_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.9e-56
WP_001204554.1|2413505_2413859_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201512.1|2413851_2414235_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522655.1|2414286_2415315_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.5e-113
WP_000256821.1|2415372_2415720_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.6e-22
WP_001253995.1|2415756_2417262_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000831776.1|2417251_2418844_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_000259002.1|2418840_2419047_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001418004.1|2419030_2420959_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	3.9e-261
WP_000235436.1|2420930_2421440_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001329960.1|2421841_2422027_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000347012.1|2422163_2422301_-	hypothetical protein	NA	NA	NA	NA	NA
2422569:2422583	attL	CACTCGCGCAGAAGA	NA	NA	NA	NA
WP_033557025.1|2422898_2422991_-	endopeptidase	NA	Q9ZXB6	Enterobacteria_phage	89.3	2.3e-07
WP_122991286.1|2422987_2423173_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	6.0e-18
WP_032140280.1|2423394_2423481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092850.1|2424035_2424569_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.7	3.9e-102
WP_000731214.1|2424611_2425601_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	64.4	6.8e-108
WP_000411813.1|2425605_2425812_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	1.2e-30
WP_000874327.1|2426104_2427955_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000261911.1|2428722_2429436_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265268.1|2430056_2430875_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090265.1|2431027_2431399_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_001217436.1|2431388_2431760_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265288.1|2431772_2432822_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	2.0e-110
WP_010917803.1|2432823_2433102_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_000975564.1|2433171_2433432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000401168.1|2433586_2434690_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001004959.1|2434670_2435321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2435486_2435642_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000101550.1|2436013_2436973_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_001151172.1|2437413_2437821_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.5	1.8e-62
WP_000054513.1|2437861_2438827_-	hypothetical protein	NA	U5P0A0	Shigella_phage	59.6	2.2e-55
WP_000705361.1|2438807_2439329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476994.1|2439312_2439540_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|2439617_2440025_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379559.1|2440218_2440371_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_000559929.1|2440484_2441000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449169.1|2441541_2441730_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199480.1|2441726_2441915_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000990641.1|2442007_2444425_+	exonuclease	NA	V5UQJ3	Shigella_phage	60.1	6.0e-174
WP_000094838.1|2444483_2444687_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533608.1|2444686_2445712_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	56.7	2.9e-101
2454614:2454628	attR	CACTCGCGCAGAAGA	NA	NA	NA	NA
>prophage 8
NC_017656	Escherichia coli O55:H7 str. RM12579, complete sequence	5263980	2581002	2697186	5263980	head,portal,tRNA,terminase,capsid,tail,holin	Enterobacteria_phage(46.38%)	114	NA	NA
WP_000476027.1|2581002_2582364_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	5.5e-217
WP_001418632.1|2582693_2583011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807374.1|2583416_2584316_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000481298.1|2584388_2585036_-	HAD-IA family hydrolase	NA	A0A1D8KNV9	Synechococcus_phage	24.2	5.4e-05
WP_000056159.1|2585080_2586358_-	MFS transporter	NA	NA	NA	NA	NA
WP_000280581.1|2586426_2587890_-	xylulokinase	NA	NA	NA	NA	NA
WP_001003646.1|2587903_2589271_-	mannitol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001030848.1|2589478_2590420_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000179020.1|2590421_2591453_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000127507.1|2592372_2593977_+	FGGY family pentulose kinase	NA	NA	NA	NA	NA
WP_000178552.1|2594037_2594817_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844213.1|2594916_2595957_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490669.1|2596004_2597360_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000823282.1|2597363_2597648_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182893.1|2597678_2598131_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853864.1|2598140_2599403_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001359336.1|2599431_2600286_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|2600592_2601645_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858518.1|2601901_2603179_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846235.1|2603175_2604180_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	6.4e-13
WP_000011986.1|2604176_2605142_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|2605115_2605862_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001359337.1|2605913_2606732_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_000822289.1|2606796_2607597_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195579.1|2607593_2608382_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000141034.1|2608715_2608955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836936.1|2610006_2610354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735648.1|2610363_2610678_+	outer membrane protein	NA	NA	NA	NA	NA
WP_000019943.1|2610787_2611060_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134613.1|2611180_2612005_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|2612223_2612562_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000702206.1|2612643_2613678_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000830490.1|2616943_2617486_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001307891.1|2617779_2618061_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|2618322_2619432_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001301615.1|2619563_2621597_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_000860779.1|2625550_2628583_+	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000356844.1|2628592_2632225_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636923.1|2632285_2632603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|2633233_2634322_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294379.1|2634332_2636612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001359338.1|2636604_2637741_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|2637737_2639741_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001359339.1|2639865_2640327_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	2.4e-76
WP_001295430.1|2640368_2640839_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2640885_2641605_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001359340.1|2641601_2643287_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.8	5.1e-305
WP_001143622.1|2644095_2647482_+	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	87.9	0.0e+00
WP_001131651.1|2647659_2648229_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	87.8	1.1e-86
WP_001101701.1|2648342_2648612_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	96.6	7.1e-44
WP_000268938.1|2648613_2649927_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	98.4	9.7e-78
WP_001233161.1|2649991_2650591_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	99.5	6.7e-111
WP_000514818.1|2650661_2654075_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	86.4	0.0e+00
WP_148264168.1|2654310_2654943_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.2	3.5e-102
WP_014640521.1|2654888_2655632_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	5.6e-147
WP_001357740.1|2655637_2656336_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847304.1|2656335_2656665_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082477.1|2656661_2659241_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	85.8	0.0e+00
WP_000533426.1|2659221_2659635_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	1.3e-41
WP_000479105.1|2659661_2660093_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000235113.1|2660106_2660859_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	2.7e-133
WP_000683079.1|2660866_2661262_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974984.1|2661258_2661792_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.9e-56
WP_001204554.1|2661807_2662161_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201512.1|2662153_2662537_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522655.1|2662588_2663617_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.5e-113
WP_000256821.1|2663674_2664022_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.6e-22
WP_001253995.1|2664058_2665564_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000831776.1|2665553_2667146_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_000259002.1|2667142_2667349_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001418004.1|2667332_2669261_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	3.9e-261
WP_000235436.1|2669232_2669742_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001300236.1|2670144_2670369_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001303878.1|2670450_2670765_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|2671293_2671479_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|2671700_2671814_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|2672034_2672568_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|2672727_2673000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053897820.1|2673255_2673471_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
WP_000874404.1|2673909_2675760_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000611207.1|2676548_2677598_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	89.1	2.8e-184
WP_000917767.1|2677748_2677946_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000640020.1|2678177_2678720_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.9	1.9e-72
WP_001217422.1|2678728_2679088_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.7	1.5e-36
WP_001436039.1|2679100_2680090_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	93.9	3.4e-184
WP_001064926.1|2680141_2680399_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	70.1	4.7e-21
WP_000203849.1|2680395_2681796_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.0	1.4e-244
WP_000988266.1|2681792_2682692_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	94.8	2.3e-139
WP_000092415.1|2682702_2683695_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	95.5	1.8e-55
WP_000995581.1|2683691_2683991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000618007.1|2683987_2684212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000626792.1|2684208_2684403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000587265.1|2684399_2685248_-	Rha family transcriptional regulator	NA	A5LH69	Enterobacteria_phage	65.1	5.5e-90
WP_001090259.1|2685356_2686064_-	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	86.0	9.1e-107
WP_000398850.1|2686060_2686351_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	89.7	1.7e-35
WP_000800136.1|2686484_2687174_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	88.2	6.1e-116
WP_000854063.1|2687320_2687869_+	helix-turn-helix transcriptional regulator	NA	A0A1B5FPB8	Escherichia_phage	71.9	8.0e-42
WP_000141093.1|2688156_2688363_+	hypothetical protein	NA	Q8W651	Enterobacteria_phage	94.1	1.3e-29
WP_000553969.1|2688557_2688746_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	49.1	1.5e-08
WP_001199104.1|2688751_2689333_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	65.1	1.9e-70
WP_000179800.1|2689581_2689899_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	82.6	5.2e-38
WP_001378249.1|2689852_2690167_+	hypothetical protein	NA	B1GS43	Salmonella_phage	84.9	6.1e-39
WP_001300192.1|2690153_2690339_+	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_000027851.1|2690335_2690842_+	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	68.2	3.8e-38
WP_001289973.1|2690838_2691324_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.1e-42
WP_000628775.1|2691837_2692596_+	phage protein	NA	A0A1U9AJ59	Stx1_converting_phage	82.4	1.2e-109
WP_000457723.1|2692680_2692923_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_001030157.1|2692926_2693061_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.5	1.9e-21
WP_001193437.1|2693079_2693334_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063640.1|2693367_2694654_+	DUF3596 domain-containing protein	NA	H6WZF6	Escherichia_phage	99.8	1.3e-252
WP_029208472.1|2694674_2695376_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.9e-102
WP_001216963.1|2695435_2695543_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2695523_2696255_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|2696259_2697186_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 9
NC_017656	Escherichia coli O55:H7 str. RM12579, complete sequence	5263980	2943204	2948630	5263980	integrase	Enterobacteria_phage(50.0%)	6	2933655:2933671	2945619:2945635
2933655:2933671	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000368131.1|2943204_2944137_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958698.1|2944448_2945606_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	99.7	1.4e-221
WP_000257010.1|2945780_2946917_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
2945619:2945635	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|2946926_2947607_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403518.1|2947593_2948061_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.0	1.8e-63
WP_000950857.1|2948060_2948630_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
>prophage 1
NC_017653	Escherichia coli O55:H7 str. RM12579 plasmid p12579_1, complete sequence	94015	435	93617	94015	transposase,head,terminase,tail,integrase,plate,holin	Escherichia_phage(63.92%)	101	350:362	45167:45179
350:362	attL	CTGGCGTTTCTAT	NA	NA	NA	NA
WP_000067534.1|435_1467_+|integrase	site-specific integrase	integrase	Q71TG5	Escherichia_phage	99.7	2.2e-194
WP_001224250.1|1517_1829_+	hypothetical protein	NA	Q71TG4	Escherichia_phage	95.1	7.4e-45
WP_071595431.1|2021_2129_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	1.5e-05
WP_000104482.1|3333_4323_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000691857.1|4338_5115_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_001276786.1|5333_5720_+	Ref family protein	NA	Q71TG3	Escherichia_phage	95.5	9.5e-58
WP_001376241.1|5909_6551_+	hypothetical protein	NA	A0A077SK30	Escherichia_phage	99.1	1.8e-114
WP_000747846.1|7952_8201_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_000224043.1|8197_8638_-	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_001038184.1|8671_15439_-	N-6 DNA methylase	NA	A0A077SK04	Escherichia_phage	98.4	0.0e+00
WP_000774696.1|15514_17224_+	hypothetical protein	NA	Q1MVN6	Enterobacteria_phage	99.8	0.0e+00
WP_000132938.1|17216_18236_+|head	head processing protein	head	Q71TR6	Escherichia_phage	96.5	9.9e-179
WP_001345478.1|18527_19085_-	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_000068865.1|19254_19743_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	100.0	5.0e-88
WP_001376650.1|19940_20618_+	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	99.6	1.2e-127
WP_000432105.1|20624_21407_+	hypothetical protein	NA	A0A1B0VDP8	Salmonella_phage	100.0	1.9e-145
WP_001165933.1|21435_21747_-	hypothetical protein	NA	A0A077SLG5	Escherichia_phage	100.0	1.8e-46
WP_000058811.1|21736_24724_-	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.4	0.0e+00
WP_000175482.1|24736_25102_-	hypothetical protein	NA	Q1MVM8	Enterobacteria_phage	99.2	2.3e-45
WP_000434678.1|25098_27018_-	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	98.7	0.0e+00
WP_001345482.1|27019_27622_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_000580776.1|27608_28052_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_000887652.1|28048_28378_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000145199.1|28452_28716_-	hypothetical protein	NA	Q71TD9	Escherichia_phage	67.1	1.1e-22
WP_001165547.1|29151_29724_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.0	4.4e-83
WP_023156928.1|29795_30263_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	64.6	8.8e-50
WP_014640494.1|30273_30780_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	65.9	1.7e-54
WP_014640495.1|30820_31294_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	50.9	4.5e-33
WP_001376654.1|31304_31763_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	58.0	2.2e-45
WP_000367943.1|31762_32374_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	79.6	5.5e-84
WP_001000782.1|32379_34530_-|tail	tail fiber protein	tail	A0A077SK37	Escherichia_phage	98.2	5.6e-115
WP_001286325.1|34541_34976_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	99.3	7.4e-75
WP_001189832.1|35054_35891_-	hypothetical protein	NA	A0A1B0V7F2	Salmonella_phage	100.0	1.4e-154
WP_000047918.1|35890_37324_-	bleomycin hydrolase	NA	A0A1B0VAD6	Salmonella_phage	99.8	5.3e-271
WP_000002800.1|37320_37677_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_000440170.1|37676_41069_-	lytic transglycosylase domain-containing protein	NA	Q1MVL3	Enterobacteria_phage	96.5	0.0e+00
WP_000926345.1|41150_42032_-	hypothetical protein	NA	A0A1B0VBL3	Salmonella_phage	99.7	3.7e-174
WP_000523980.1|42046_42658_-	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_000188918.1|42668_43235_-	hypothetical protein	NA	Q71TN7	Escherichia_phage	98.4	9.5e-99
WP_000765490.1|43443_44223_-	hypothetical protein	NA	Q71TC6	Escherichia_phage	99.6	3.6e-149
WP_000908460.1|44230_44548_-	hypothetical protein	NA	Q71TC5	Escherichia_phage	100.0	2.9e-28
WP_000245703.1|45128_45350_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	97.3	3.6e-38
45167:45179	attR	CTGGCGTTTCTAT	NA	NA	NA	NA
WP_000743159.1|45346_46390_+	phage antirepressor Ant	NA	Q71TN2	Escherichia_phage	92.8	5.4e-172
WP_001187874.1|46553_47354_+	phage antirepressor KilAC domain-containing protein	NA	Q1MVK4	Enterobacteria_phage	99.6	5.4e-148
WP_001376803.1|47383_48229_+	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	97.9	1.6e-150
WP_001426344.1|48279_48525_+	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
WP_001313475.1|48706_48862_+	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.0e-15
WP_000509939.1|48978_49488_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_000035301.1|49499_50081_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	97.4	7.3e-102
WP_000041760.1|50116_50932_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.5	1.4e-111
WP_000085145.1|50941_52531_-	hypothetical protein	NA	A0A077SLN8	Escherichia_phage	100.0	2.5e-306
WP_000067710.1|52591_54298_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	100.0	0.0e+00
WP_000038866.1|54523_55525_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_001285362.1|55541_56738_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_001154683.1|56906_57716_-	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	98.5	1.9e-156
WP_001113742.1|58008_58893_-	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
WP_001281116.1|59227_59620_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	99.2	2.0e-71
WP_000336812.1|59631_59772_-	hypothetical protein	NA	Q71TL6	Escherichia_phage	100.0	6.3e-20
WP_000007769.1|59797_60220_-	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
WP_000890198.1|60259_61048_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	99.6	7.3e-121
WP_161403143.1|61061_61214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001177860.1|61510_61795_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
WP_000472529.1|61787_62693_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
WP_000660985.1|62689_64708_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	Q1MVI4	Enterobacteria_phage	95.4	0.0e+00
WP_000751808.1|66682_67510_+	hypothetical protein	NA	A0A077SLJ6	Escherichia_phage	100.0	1.6e-131
WP_001276604.1|67899_69264_+	replicative DNA helicase	NA	O80281	Escherichia_phage	99.6	3.6e-253
WP_001198662.1|69263_70262_+	hypothetical protein	NA	Q71TK3	Escherichia_phage	97.0	6.4e-191
WP_000535202.1|70308_70941_-|plate	baseplate protein	plate	Q71TK2	Escherichia_phage	100.0	6.9e-90
WP_000212018.1|70933_71950_-	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	100.0	3.5e-192
WP_000602711.1|71951_72737_-	hypothetical protein	NA	A0A1B0V7N6	Salmonella_phage	99.6	2.7e-144
WP_000896801.1|72723_73452_-	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_001141915.1|73455_74673_-	hypothetical protein	NA	Q71T88	Escherichia_phage	100.0	1.4e-224
WP_000235786.1|74682_75060_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_000840931.1|75206_75452_+	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_000943608.1|75454_76033_+	VRR-NUC domain-containing protein	NA	Q71T85	Escherichia_phage	99.0	1.7e-106
WP_000096174.1|76099_76255_+	hypothetical protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
WP_000484110.1|76756_77383_+	norphogenetic protein	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
WP_024174695.1|77379_78057_+	metallophosphoesterase	NA	Q71TJ1	Escherichia_phage	99.1	2.4e-133
WP_000684868.1|78053_78755_+	hypothetical protein	NA	Q71TJ0	Escherichia_phage	99.6	2.1e-143
WP_000633036.1|79056_80319_+	hypothetical protein	NA	Q71TI8	Escherichia_phage	99.8	1.2e-234
WP_000021767.1|80391_80898_+	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	99.4	2.4e-93
WP_000154832.1|81936_82635_+	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	55.0	7.0e-51
WP_001018057.1|82631_82922_+	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	82.3	1.2e-36
WP_000672529.1|82918_83632_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	73.7	4.8e-39
WP_000215167.1|83628_83928_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	99.0	1.3e-57
WP_000161573.1|83929_84616_+	ead/Ea22-like family protein	NA	K7P6J7	Enterobacteria_phage	57.2	5.4e-56
WP_001151811.1|84617_84767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000208040.1|84770_85787_+	hypothetical protein	NA	A0A222YWE8	Escherichia_phage	95.3	1.1e-126
WP_001142394.1|85770_86055_+	hypothetical protein	NA	A0A222YXZ5	Escherichia_phage	100.0	2.4e-05
WP_001344848.1|86039_86249_-	hypothetical protein	NA	A0A222YY00	Escherichia_phage	98.6	1.1e-31
WP_001283837.1|86422_86674_+	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	100.0	1.4e-38
WP_000506726.1|86797_87187_+	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	1.4e-69
WP_001190712.1|87259_87481_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216047.1|87480_87861_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	99.2	2.5e-63
WP_000113019.1|87865_88045_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	2.7e-23
WP_000644102.1|88072_89116_+	DUF968 domain-containing protein	NA	A0A1B0VBU2	Salmonella_phage	99.4	3.0e-207
WP_001312282.1|89204_89657_+	late promoter-activating protein (Gp10)	NA	Q71T63	Escherichia_phage	99.3	6.7e-79
WP_000219608.1|89743_90937_+	hypothetical protein	NA	Q5QBP3	Enterobacteria_phage	96.5	1.4e-200
WP_000124150.1|90936_92421_+|terminase	terminase	terminase	Q71T61	Escherichia_phage	100.0	1.5e-292
WP_000611656.1|92445_93297_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
WP_000874154.1|93407_93617_-	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
