The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017046	Salmonella enterica subsp. enterica serovar Typhimurium str. 798, complete sequence	4876219	975130	983862	4876219	protease,transposase	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|975130_976249_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|976245_978192_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|978321_978543_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|978866_979187_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|979217_981494_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|981685_982144_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_085983316.1|982606_983862_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 2
NC_017046	Salmonella enterica subsp. enterica serovar Typhimurium str. 798, complete sequence	4876219	1033955	1132807	4876219	protease,terminase,holin,lysis,tail,portal,tRNA	Salmonella_phage(43.64%)	98	NA	NA
WP_001154025.1|1033955_1034759_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1034751_1036074_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1036054_1036759_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1036758_1041225_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925872.1|1041569_1043411_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1043670_1044219_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1044246_1044894_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1044955_1046146_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1046330_1047422_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1048028_1049429_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1049629_1050091_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000893207.1|1051865_1053302_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1053379_1054582_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1054776_1056069_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1056113_1056362_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1056402_1056642_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1056684_1057842_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000017117.1|1057804_1060732_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	98.8	0.0e+00
WP_001668146.1|1060858_1061158_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1061179_1061338_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_014344008.1|1061330_1061591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1061640_1062051_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1062170_1062410_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1062375_1062750_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1062834_1063818_+	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1063820_1064570_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1064580_1064928_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1064924_1065236_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|1065313_1065604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1065895_1066129_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1066240_1066462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1066544_1067147_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001096552.1|1067355_1067967_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1067963_1068110_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1068099_1068897_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|1068963_1069281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1069454_1069580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1069715_1070165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1070525_1071212_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|1071487_1071817_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1071800_1072253_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1072270_1072750_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1072957_1073491_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1073447_1075586_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1075582_1075789_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009207.1|1075785_1077333_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_001107908.1|1079429_1079753_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1079745_1080045_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1080025_1080592_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1080588_1080990_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|1081001_1081751_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1081796_1082195_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1082191_1082521_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|1082600_1085588_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|1085584_1085917_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1086015_1086513_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1086629_1087163_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1087252_1087948_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1087957_1088695_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1088592_1089297_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000033415.1|1089368_1092719_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_000178849.1|1092757_1093000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144679.1|1093053_1095492_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000143167.1|1095491_1096073_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001533476.1|1096548_1097517_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000334547.1|1098164_1098791_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1098859_1099159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1099143_1099830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1100100_1100292_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1100718_1103331_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1103538_1104549_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1104714_1105257_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1105253_1106363_-	YcbX family protein	NA	NA	NA	NA	NA
WP_001086485.1|1106461_1108570_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1108582_1110490_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333148.1|1110504_1111758_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000759136.1|1113400_1113964_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1114219_1114387_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1114486_1115005_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156453.1|1115073_1116834_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1117019_1117472_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1117543_1118596_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1118952_1119462_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1119678_1120284_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1120270_1122424_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1122442_1122889_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1123012_1125067_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1125102_1125561_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1125655_1126318_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1126491_1126905_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1126949_1127267_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1127324_1128536_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1128750_1129299_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1129324_1130104_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072884.1|1130152_1130434_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1130430_1130760_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1130846_1131506_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1132126_1132807_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 3
NC_017046	Salmonella enterica subsp. enterica serovar Typhimurium str. 798, complete sequence	4876219	1920406	1927215	4876219	tail,integrase	Salmonella_phage(33.33%)	11	1915268:1915290	1924984:1925006
1915268:1915290	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|1920406_1921288_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1921760_1921949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1922013_1922181_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1922437_1922971_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1923024_1923255_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1923444_1923939_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_176731523.1|1924010_1924853_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.3e-71
WP_000722368.1|1925226_1925580_-	YebY family protein	NA	NA	NA	NA	NA
1924984:1925006	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1925596_1926472_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1926472_1926847_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1926984_1927215_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 4
NC_017046	Salmonella enterica subsp. enterica serovar Typhimurium str. 798, complete sequence	4876219	2031257	2082007	4876219	protease,terminase,integrase,holin,plate,lysis,capsid,tail,portal,head	Salmonella_phage(90.48%)	68	2032429:2032443	2079483:2079497
WP_001157322.1|2031257_2032688_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
2032429:2032443	attL	GGATGATGCGCTGGC	NA	NA	NA	NA
WP_000377041.1|2032761_2033457_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2033548_2033848_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2034497_2035694_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2035954_2036143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2036153_2036366_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2036820_2038089_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2038091_2038511_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2038637_2038799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526483.1|2039429_2039651_-	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000492926.1|2039863_2040871_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_015701331.1|2041155_2041755_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_000554736.1|2041724_2043287_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	99.8	7.5e-287
WP_001207832.1|2043273_2043861_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_001738350.1|2043863_2044385_-|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	99.4	1.5e-93
WP_014343856.1|2044419_2044965_-|plate	baseplate J/gp47 family protein	plate	Q8HAB7	Salmonella_phage	100.0	9.2e-99
WP_000605050.1|2044936_2045350_-	phage GP46 family protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001273649.1|2045354_2045888_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066636.1|2045887_2046946_-	hypothetical protein	NA	Q8HAC0	Salmonella_phage	100.0	1.3e-202
WP_000863818.1|2046942_2048283_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_000785385.1|2048316_2050245_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000588852.1|2050329_2050656_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2050652_2051009_-|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007991.1|2051008_2052505_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000497739.1|2052494_2052659_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779218.1|2052662_2053223_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_001135697.1|2053219_2053732_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000702408.1|2053703_2054108_-|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_000927378.1|2054104_2054428_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601353.1|2054430_2054631_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000257528.1|2054681_2055887_-|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_001193639.1|2055901_2056552_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000466254.1|2056529_2057771_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_000605609.1|2057770_2057953_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088182.1|2057964_2059698_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
WP_000929191.1|2059694_2060189_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135225.1|2060314_2060665_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_001292890.1|2060725_2061028_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_000877027.1|2061247_2061667_-	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001050825.1|2061879_2062365_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_001005901.1|2062361_2062976_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001527046.1|2062978_2063323_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_014343859.1|2063484_2063919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001527054.1|2063848_2064106_-	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_000188927.1|2064238_2064862_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_001202277.1|2064872_2065862_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	4.9e-191
WP_001061456.1|2065869_2066730_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.7	1.4e-162
WP_001241579.1|2066746_2067136_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2067132_2068026_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2068025_2068508_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061485.1|2068509_2069328_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	99.6	7.0e-135
WP_000620702.1|2069324_2069549_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2069545_2070703_-	Rha family phage regulatory protein	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2070699_2071254_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2071282_2071507_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|2071604_2072300_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_000997190.1|2073114_2073486_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000080415.1|2073543_2074371_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
WP_000008351.1|2074507_2075047_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000764235.1|2075117_2075348_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000071070.1|2075344_2075860_+	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000065095.1|2075856_2076474_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000208068.1|2076470_2077304_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_001061334.1|2077307_2077877_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_001527041.1|2077916_2078144_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_000532847.1|2078145_2079135_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2079426_2080224_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
2079483:2079497	attR	GGATGATGCGCTGGC	NA	NA	NA	NA
WP_001219015.1|2081533_2082007_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
>prophage 5
NC_017046	Salmonella enterica subsp. enterica serovar Typhimurium str. 798, complete sequence	4876219	2168003	2178509	4876219		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2168003_2169317_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2169343_2170423_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2170427_2171201_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2171197_2172190_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2172195_2172747_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2172747_2173626_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2173673_2174573_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2174572_2175658_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2176034_2176928_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2177105_2178509_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 6
NC_017046	Salmonella enterica subsp. enterica serovar Typhimurium str. 798, complete sequence	4876219	2246817	2255988	4876219	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195329.1|2246817_2248851_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2249091_2249550_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2249721_2250252_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2250308_2250776_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2250822_2251542_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2251538_2253224_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2253446_2254178_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2254237_2254345_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2254325_2255057_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2255040_2255988_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 7
NC_017046	Salmonella enterica subsp. enterica serovar Typhimurium str. 798, complete sequence	4876219	2275395	2341791	4876219	tail,lysis,holin	Salmonella_phage(25.0%)	59	NA	NA
WP_000989296.1|2275395_2276091_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2276244_2277129_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2277305_2278025_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2278021_2278267_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2278471_2279713_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|2279706_2280942_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2281016_2282027_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535905.1|2282042_2283563_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2283696_2284695_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2285193_2286216_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2286365_2287508_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2287522_2288191_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2288520_2289378_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2289366_2289756_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2289760_2291128_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2291344_2292232_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2292264_2293587_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2293630_2295622_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535005.1|2295966_2297436_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2297625_2298489_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2298609_2299659_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2299737_2300595_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2300659_2302348_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2302364_2303303_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2303302_2304433_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2304801_2305983_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2306047_2306713_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2306714_2306837_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2307224_2307479_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2307802_2308375_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2308587_2309574_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2309603_2310323_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2310736_2311309_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2311634_2313191_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2313297_2315103_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2315112_2316207_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2316206_2317232_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2317233_2318823_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2318826_2319171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001234836.1|2320780_2321476_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2321627_2323388_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2323512_2323797_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2323905_2324526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2324553_2325561_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2325740_2325968_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2325999_2327760_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2328040_2328544_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2328571_2328862_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2329209_2331039_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2331092_2331536_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2331913_2332441_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2332443_2333685_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2334277_2334607_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2334903_2336235_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2336263_2336632_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2336646_2337636_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2337964_2340331_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2340499_2340703_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2340999_2341791_-|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 8
NC_017046	Salmonella enterica subsp. enterica serovar Typhimurium str. 798, complete sequence	4876219	2680667	2890011	4876219	terminase,protease,integrase,holin,transposase,plate,lysis,capsid,tail,portal,tRNA,head	Salmonella_phage(49.21%)	210	2705212:2705228	2892998:2893019
WP_000940032.1|2680667_2681399_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2681517_2682321_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2682465_2683344_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2683525_2684569_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2684572_2685391_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2685401_2686415_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2686415_2687402_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2687392_2688031_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2688156_2689434_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2689428_2690568_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2690763_2692017_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2692341_2693532_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2693713_2695258_+	lysine decarboxylation/transport transcriptional activator CadC	NA	NA	NA	NA	NA
WP_000100008.1|2695618_2696950_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2697032_2699177_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2699232_2700693_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2700741_2701080_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2701156_2702494_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2702490_2703255_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2703256_2704687_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
2705212:2705228	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970045.1|2705336_2709224_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
2705212:2705228	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_001747289.1|2709245_2709479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2709479_2711024_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2711074_2711626_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2711650_2712286_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2712289_2713651_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2713661_2714555_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2714670_2715519_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684027.1|2715557_2716475_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276370.1|2716496_2717693_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2717809_2718736_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2718773_2719034_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2719145_2719526_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2719525_2720257_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2720268_2720997_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2721008_2721914_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2721910_2722591_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2722864_2723839_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2723855_2725655_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2726059_2727553_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2728037_2728175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001526383.1|2728887_2729007_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001738443.1|2729759_2729972_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2730078_2730306_+	phage virulence factor PagK family protein	NA	NA	NA	NA	NA
WP_000143154.1|2730402_2730981_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2730970_2731795_-	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144687.1|2731791_2734164_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	65.3	1.1e-90
WP_000178853.1|2734217_2734460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2734498_2737861_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2737922_2738570_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_015701343.1|2738467_2739205_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	3.0e-129
WP_001152689.1|2739211_2739910_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2739919_2740249_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372065.1|2740251_2743347_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_010989052.1|2743318_2743657_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2743653_2744049_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2744099_2744846_-	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2744853_2745255_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2745363_2746494_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2746542_2747121_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2747148_2747532_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2747542_2747902_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522566.1|2747959_2748988_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2749042_2749390_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2749402_2750899_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_001738454.1|2750888_2752376_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	63.3	5.8e-180
WP_000201415.1|2752464_2752668_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2752651_2754583_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2754554_2755100_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2755386_2755788_+	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_001533543.1|2756023_2756476_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_015701345.1|2756493_2756946_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001574216.1|2756929_2757259_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110784.1|2757534_2758221_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	99.6	1.0e-131
WP_000657897.1|2758435_2758624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2759130_2759694_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|2759966_2760644_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2760640_2760781_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096551.1|2760777_2761389_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.5	6.1e-91
WP_000929791.1|2761597_2762200_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_014343878.1|2762234_2762483_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2762599_2762833_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000877757.1|2763075_2763708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000664368.1|2763815_2764514_-	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000801764.1|2764527_2765223_-	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000024044.1|2765219_2766104_-	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_010835408.1|2766195_2766570_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000643689.1|2766529_2766772_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_000660736.1|2766871_2767267_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_001111772.1|2767325_2768165_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000356948.1|2768157_2768544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000950426.1|2768543_2769206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917562.1|2769663_2769822_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_077905149.1|2769843_2770194_+	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000017140.1|2770320_2773248_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	98.3	0.0e+00
WP_014344386.1|2773210_2774368_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|2774410_2774650_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2774690_2774975_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|2774952_2776182_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|2776679_2777159_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2777155_2778112_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|2778111_2778762_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2778793_2779369_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2779365_2779530_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989177.1|2779793_2781416_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2781400_2782138_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2782268_2783603_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|2783620_2784520_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2784622_2785210_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2785271_2785655_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2785973_2786663_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2786778_2787816_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098732.1|2788019_2788439_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000183639.1|2788511_2789192_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_000082639.1|2789245_2791906_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949286.1|2792020_2793376_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264473.1|2793420_2793744_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807809.1|2793740_2795042_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	6.9e-44
WP_000985653.1|2795145_2795601_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_001235094.1|2801481_2804055_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
2795720:2795736	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_000992639.1|2804184_2804916_-	polyphenol oxidase	NA	NA	NA	NA	NA
2795720:2795736	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_000079130.1|2804912_2805893_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|2806024_2806762_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|2807033_2807372_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|2807475_2807523_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200080.1|2807622_2808783_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210995.1|2808743_2809652_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225191.1|2809709_2810831_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|2810840_2811911_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|2812350_2812869_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|2812861_2814082_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000218691.1|2814334_2815384_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	90.3	5.4e-188
WP_000823622.1|2815408_2815747_-	DUF2511 domain-containing protein	NA	A0A0M3ULF8	Salmonella_phage	72.1	1.4e-41
WP_001096998.1|2815755_2816601_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	73.7	4.9e-115
WP_001278192.1|2816714_2817068_+	hypothetical protein	NA	Q6K1F9	Salmonella_virus	100.0	2.3e-58
WP_000883911.1|2817118_2817628_+	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	98.8	3.6e-89
WP_000920166.1|2817635_2817836_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	92.4	9.6e-30
WP_000963466.1|2817799_2818138_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	92.9	2.3e-52
WP_001246236.1|2818205_2818433_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	98.7	2.6e-31
WP_000752587.1|2818432_2818657_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	98.6	1.1e-34
WP_157868817.1|2818678_2819272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000978866.1|2822040_2822526_+|tail	phage tail protein	tail	O80317	Escherichia_phage	91.9	1.1e-79
WP_000988226.1|2822522_2823689_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	95.8	3.2e-205
WP_000416621.1|2823883_2824573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972009.1|2824649_2824868_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	97.2	6.1e-38
WP_000065257.1|2825013_2825361_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|2825401_2826169_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2826213_2826762_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2826780_2827029_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2827342_2828704_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_127172650.1|2829679_2830966_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287923.1|2831086_2831692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2831726_2832317_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|2832439_2833318_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2833403_2835065_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2835213_2835552_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2835717_2836008_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2835997_2836474_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2836623_2837106_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237670.1|2837719_2849194_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533859.1|2849258_2850668_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196159.1|2850664_2852845_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_010989057.1|2852852_2854016_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000980498.1|2854567_2854786_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_001010542.1|2854854_2855745_-	late control	NA	A0A1S6KZZ5	Salmonella_phage	78.7	7.1e-141
WP_000980418.1|2855741_2856227_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	98.5	2.4e-66
WP_001282764.1|2856223_2859031_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	99.5	0.0e+00
WP_000763316.1|2859023_2859143_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001280960.1|2859157_2859460_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	5.5e-45
WP_001207652.1|2859514_2860030_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	98.8	7.9e-92
WP_000046099.1|2860039_2861212_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.2	2.9e-222
WP_000161707.1|2861745_2862468_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_001287102.1|2862664_2863072_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	85.0	1.1e-59
WP_001274643.1|2863078_2864698_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	90.9	2.1e-154
WP_001086808.1|2864694_2865300_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.5	1.4e-116
WP_000268332.1|2865292_2866201_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_000177406.1|2866187_2866547_-	GPW/gp25 family protein	NA	E5G6N7	Salmonella_phage	95.8	6.8e-58
WP_000993750.1|2866543_2867122_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.0	1.5e-107
WP_000343940.1|2867190_2867637_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	87.0	1.3e-63
WP_001039965.1|2867629_2868061_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	96.5	6.2e-74
WP_001648763.1|2868156_2868585_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	95.0	2.6e-64
WP_000871616.1|2868581_2868956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069920.1|2868960_2869470_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.8	6.4e-94
WP_000171565.1|2869450_2869666_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868182.1|2869669_2869873_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	98.5	5.5e-33
WP_000673534.1|2869872_2870337_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	1.9e-84
WP_000059178.1|2870430_2871084_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	98.6	4.6e-113
WP_000730752.1|2871087_2872170_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	96.9	6.5e-189
WP_000216273.1|2872186_2873020_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.7	2.7e-126
WP_001098460.1|2873162_2874929_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_001292072.1|2874928_2875960_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	95.0	1.3e-191
WP_014344392.1|2875986_2876964_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	32.7	1.2e-24
WP_014344393.1|2876953_2877436_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000698372.1|2877811_2878189_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	50.0	1.5e-28
WP_014344394.1|2878166_2879276_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	38.9	2.9e-67
WP_001217569.1|2879381_2879615_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	3.7e-33
WP_001154443.1|2879626_2879815_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	6.1e-26
WP_000301157.1|2880138_2882382_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	96.9	0.0e+00
WP_000104129.1|2882372_2883230_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	93.3	4.6e-153
WP_000785514.1|2883226_2883454_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	66.7	5.4e-21
WP_001178763.1|2883453_2883681_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	64.0	8.1e-17
WP_000963476.1|2883748_2884090_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	84.1	6.0e-48
WP_001528723.1|2884053_2884248_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	84.1	5.3e-25
WP_000794278.1|2884332_2884608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460863.1|2884694_2885204_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.9	1.3e-83
WP_000102529.1|2885236_2885485_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	67.9	6.4e-23
WP_000616881.1|2885604_2886237_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	89.5	3.5e-102
WP_000155500.1|2886238_2887264_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.3	3.5e-192
WP_000834152.1|2887260_2888472_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	47.5	6.3e-108
WP_000124715.1|2888814_2890011_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.9	1.4e-107
2892998:2893019	attR	TCCCCGCCACGCCTGCCCGCTT	NA	NA	NA	NA
>prophage 9
NC_017046	Salmonella enterica subsp. enterica serovar Typhimurium str. 798, complete sequence	4876219	2893183	2898984	4876219		Enterobacteria_phage(100.0%)	8	NA	NA
WP_000210082.1|2893183_2893750_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.2	4.1e-57
WP_000984209.1|2893766_2894009_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	77.8	5.2e-30
WP_000149860.1|2894005_2894743_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.4	9.0e-81
WP_000556594.1|2895280_2895547_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	69.3	3.7e-29
WP_015701354.1|2895543_2896095_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
WP_001216603.1|2896091_2896319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000795388.1|2896315_2896636_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783717.1|2896650_2898984_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.7	0.0e+00
>prophage 10
NC_017046	Salmonella enterica subsp. enterica serovar Typhimurium str. 798, complete sequence	4876219	4437867	4458287	4876219	plate,tail,holin	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4437867_4438596_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4438792_4439083_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4439331_4439787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015690888.1|4439783_4440389_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4440393_4442139_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4442141_4442774_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4442766_4443882_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4443872_4444232_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4444395_4445943_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4445942_4446872_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4446868_4447231_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4447558_4448281_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4448290_4449334_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4449321_4449531_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4449530_4450484_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262500.1|4450483_4452838_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_001185654.1|4452934_4453063_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4453022_4453340_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4453391_4453916_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4453915_4455343_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4455332_4455530_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4455526_4455982_-	Gp37 family protein	NA	NA	NA	NA	NA
WP_000777266.1|4456141_4456456_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4456468_4457074_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4457076_4457364_-|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4457939_4458287_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
