The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_016790	Corynebacterium diphtheriae VA01, complete sequence	2395441	620122	724101	2395441	tRNA,transposase,protease,integrase	Bacillus_phage(20.0%)	89	723100:723119	729109:729128
WP_004567125.1|620122_620626_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_010934497.1|620671_621295_+	sigma-70 family RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	28.5	1.7e-08
WP_072588051.1|621291_621543_+	mycothiol system anti-sigma-R factor	NA	NA	NA	NA	NA
WP_014309177.1|621547_621892_-	DUF4288 domain-containing protein	NA	NA	NA	NA	NA
WP_004567132.1|622229_622490_-	WhiB family transcriptional regulator	NA	A0A2P1N2X5	Mycobacterium_phage	45.1	2.0e-11
WP_014309178.1|623121_623583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014309179.1|623576_624839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014309180.1|624835_626146_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.0	1.3e-42
WP_004567139.1|626361_626589_+	DUF3107 domain-containing protein	NA	NA	NA	NA	NA
WP_014309181.1|626591_627470_+	DUF3152 domain-containing protein	NA	NA	NA	NA	NA
WP_014309182.1|627493_628351_+	TIGR02569 family protein	NA	NA	NA	NA	NA
WP_014311312.1|628354_631537_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_014310151.1|631530_634761_+	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	22.9	5.1e-19
WP_004567149.1|634805_635894_+	potassium channel protein	NA	NA	NA	NA	NA
WP_014308089.1|635925_636609_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_004567152.1|636601_638653_+	ATP-dependent DNA helicase UvrD2	NA	S5MMD7	Bacillus_phage	27.5	1.7e-44
WP_014311313.1|638597_639491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014311314.1|639526_640048_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_014311315.1|640044_641436_-|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_014310154.1|641516_642569_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_014311316.1|642580_643279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014310156.1|643329_643833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014311317.1|644005_646969_+	UPF0182 family protein	NA	NA	NA	NA	NA
WP_010934516.1|647452_648022_-	sodium:glutamate symporter	NA	NA	NA	NA	NA
WP_010934518.1|648551_649562_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_014311318.1|649564_650521_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_014311319.1|650776_650944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010934521.1|651199_652681_+	methylmalonyl-CoA carboxytransferase subunit 5S	NA	NA	NA	NA	NA
WP_010934522.1|652693_654250_+	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_003850577.1|654263_654527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003850583.1|654551_654920_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_014306632.1|655122_656214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014308098.1|656232_657021_-	histidinol-phosphatase	NA	NA	NA	NA	NA
WP_014308099.1|657077_657893_-	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_014311320.1|658072_659182_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_014311321.1|659178_660783_-	AbgT family transporter	NA	NA	NA	NA	NA
WP_014303094.1|660961_661651_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	38.2	9.1e-27
WP_003850598.1|661667_662570_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003850600.1|662674_663166_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	52.2	1.5e-36
WP_014308372.1|665339_666689_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	36.1	5.2e-34
WP_050879494.1|666734_669629_+	type 2 lantipeptide synthetase LanM	NA	NA	NA	NA	NA
WP_014311325.1|669616_671749_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.0	3.4e-32
WP_010934533.1|671748_672627_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.4	6.6e-30
WP_010934534.1|672626_673424_+	lantibiotic ABC transporter permease	NA	NA	NA	NA	NA
WP_010934535.1|673589_673856_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013170013.1|674890_675172_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_148265586.1|675244_676048_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_010934538.1|676270_676612_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_010934539.1|676645_677449_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014311327.1|677570_677801_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080574137.1|679153_679516_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_014308109.1|679745_679910_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_014311330.1|679997_680234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014309234.1|686509_687718_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014308112.1|688467_689196_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_111933930.1|689243_689423_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_014308113.1|689389_689788_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_014308114.1|689792_690440_-	DUF3239 domain-containing protein	NA	NA	NA	NA	NA
WP_014311332.1|690444_692109_-	DEAD/DEAH box helicase	NA	A0A1D8BJ75	Sulfolobus_islandicus_filamentous_virus	23.3	9.6e-14
WP_014311333.1|692154_694473_-	helicase-associated domain-containing protein	NA	NA	NA	NA	NA
WP_014301577.1|694539_694728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010934546.1|694912_695536_-	DUF3235 domain-containing protein	NA	A0A2D0ZMX2	Rhodococcus_phage	59.0	1.3e-27
WP_003850654.1|696216_696606_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_014301578.1|696713_697238_-	DUF2771 domain-containing protein	NA	NA	NA	NA	NA
WP_014311334.1|697224_698091_-	glutaminyl-peptide cyclotransferase	NA	NA	NA	NA	NA
WP_010934549.1|698130_698895_+	DUF3027 domain-containing protein	NA	NA	NA	NA	NA
WP_014311335.1|699068_700556_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.8	3.1e-40
WP_014311336.1|700635_701532_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_014311337.1|701528_702425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014309239.1|702445_703495_-	DUF3071 domain-containing protein	NA	NA	NA	NA	NA
WP_014309241.1|703696_704827_-	phosphoserine transaminase	NA	NA	NA	NA	NA
WP_003850673.1|705515_706808_+	citrate synthase	NA	NA	NA	NA	NA
WP_003850674.1|706974_707334_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_014301581.1|707420_708926_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha/beta	NA	NA	NA	NA	NA
WP_014309242.1|709018_709891_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	3.6e-52
WP_014309243.1|709890_710667_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_014311338.1|710977_712186_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014301583.1|712714_713056_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_014301584.1|713059_714712_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_044048985.1|714920_715694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014309246.1|715686_716595_-	DUF1906 domain-containing protein	NA	A0A2D1GEF2	Gordonia_phage	37.1	3.5e-26
WP_014309247.1|716723_717923_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_044026483.1|718180_718633_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_014309248.1|718644_719211_-	SocA family protein	NA	NA	NA	NA	NA
WP_014309249.1|719543_719819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014309250.1|720371_721310_-	tyrosine recombinase XerC	NA	NA	NA	NA	NA
WP_014311340.1|721421_722522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014309252.1|722709_723036_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
723100:723119	attL	AGCCGGGTACCCGGCTAACC	NA	NA	NA	NA
WP_014309253.1|723318_724101_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_014309253.1|723318_724101_+|integrase	integrase	integrase	NA	NA	NA	NA
729109:729128	attR	GGTTAGCCGGGTACCCGGCT	NA	NA	NA	NA
>prophage 2
NC_016790	Corynebacterium diphtheriae VA01, complete sequence	2395441	1769131	1784891	2395441	tRNA,transposase,protease,integrase	Agrobacterium_phage(40.0%)	12	1760320:1760335	1789448:1789463
1760320:1760335	attL	ACGACGGCCGCGACGA	NA	NA	NA	NA
WP_014308109.1|1769131_1769296_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080574137.1|1769526_1769889_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_014311327.1|1771241_1771472_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014309471.1|1772627_1773041_-	DUF4233 domain-containing protein	NA	NA	NA	NA	NA
WP_014308610.1|1773037_1774534_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_014309472.1|1774530_1777239_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	37.4	2.1e-135
WP_014308612.1|1777333_1778314_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_014303750.1|1778796_1779549_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010935337.1|1779585_1780878_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.2	3.3e-131
WP_014309473.1|1781024_1783550_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	30.4	1.6e-65
WP_003852475.1|1783644_1784274_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	44.0	3.6e-38
WP_003852476.1|1784291_1784891_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	46.7	3.3e-41
1789448:1789463	attR	TCGTCGCGGCCGTCGT	NA	NA	NA	NA
>prophage 3
NC_016790	Corynebacterium diphtheriae VA01, complete sequence	2395441	2166021	2209606	2395441	holin,tRNA,transposase,integrase	Macacine_betaherpesvirus(28.57%)	34	2155440:2155454	2212377:2212391
2155440:2155454	attL	AAGCCTATGGGTATT	NA	NA	NA	NA
WP_014304028.1|2166021_2166801_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_014302497.1|2166797_2167418_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_014311642.1|2167432_2169673_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_014309664.1|2169674_2170718_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_014309665.1|2170714_2171071_+	DUF3054 domain-containing protein	NA	NA	NA	NA	NA
WP_004567314.1|2171229_2171430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014308849.1|2171596_2171848_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004567317.1|2172262_2175262_-	VaFE repeat-containing surface-anchored protein	NA	NA	NA	NA	NA
WP_014308850.1|2175679_2176114_-	endo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_014308851.1|2176266_2176683_-	endo-beta-N-acetylglucosaminidase F2	NA	NA	NA	NA	NA
WP_014311644.1|2176838_2178389_-	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_004567323.1|2178400_2183161_-	acyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_004567325.1|2183259_2185074_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_004567333.1|2185148_2186060_-	cutinase family protein	NA	NA	NA	NA	NA
WP_004567335.1|2186065_2186581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014308854.1|2186580_2188497_-	hypothetical protein	NA	A0A2I6B2Q9	Macacine_betaherpesvirus	37.6	4.9e-38
WP_004567341.1|2188857_2189874_-	esterase family protein	NA	A0A2I6AZZ6	Macacine_betaherpesvirus	35.1	5.4e-36
WP_004567343.1|2190040_2191729_-	arabinofuranosyl transferase C	NA	NA	NA	NA	NA
WP_014309669.1|2191737_2192715_-	decaprenyl-phosphate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_004567346.1|2192711_2193206_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_014309670.1|2193205_2195191_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_014311645.1|2195275_2195761_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_014311646.1|2195831_2197409_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_014311647.1|2197475_2199701_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	2.5e-17
WP_014311648.1|2199972_2201766_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	28.1	1.6e-54
WP_014302517.1|2201951_2203115_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	46.1	1.3e-94
WP_014308865.1|2203922_2204765_-	type IV toxin-antitoxin system AbiEi family antitoxin	NA	NA	NA	NA	NA
WP_014308867.1|2205009_2205285_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_014308868.1|2205755_2207576_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A159B6I5	Gordonia_phage	34.8	8.9e-05
WP_004567362.1|2207815_2208049_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_014308869.1|2208358_2208481_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080564351.1|2208863_2209043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014308870.1|2209008_2209350_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	42.0	8.8e-07
WP_158307782.1|2209330_2209606_+|transposase	transposase	transposase	NA	NA	NA	NA
2212377:2212391	attR	AAGCCTATGGGTATT	NA	NA	NA	NA
