The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015913	Candidatus Arthromitus sp. SFB-mouse-Japan, complete genome	1620005	109831	154328	1620005	tail,capsid,terminase,portal,plate,integrase	Clostridium_phage(50.0%)	56	111154:111198	157133:157177
WP_007439944.1|109831_111217_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	35.3	1.7e-80
111154:111198	attL	GTTTTGTCAAACATATCATGTAGAAACTATTGTTAGATTTACTTT	NA	NA	NA	NA
WP_005807580.1|111269_112460_-|integrase	site-specific integrase	integrase	A0A0A8WIE1	Clostridium_phage	49.9	2.1e-100
WP_005807578.1|112694_113999_+	AAA family ATPase	NA	V9QJ85	Oenococcus_phage	32.2	9.4e-49
WP_005807576.1|113999_114587_+	hypothetical protein	NA	V9QKG0	Oenococcus_phage	32.7	6.8e-07
WP_041568914.1|115046_115298_-	peptidase S24	NA	A0A142LP05	Marinitoga_camini_virus	42.9	8.2e-10
WP_014017795.1|115640_116375_+	DUF3644 domain-containing protein	NA	A0A220NQR4	Corynebacterium_phage	35.8	1.1e-17
WP_014017796.1|117112_117826_-	helix-turn-helix domain-containing protein	NA	A0A1Q1PVX8	Staphylococcus_phage	31.1	7.7e-21
WP_014017797.1|117965_118169_+	DUF739 family protein	NA	NA	NA	NA	NA
WP_041568926.1|118287_118503_-	helix-turn-helix transcriptional regulator	NA	G3MBD2	Bacillus_virus	52.3	2.0e-09
WP_014017799.1|118614_118806_+	helix-turn-helix transcriptional regulator	NA	J9QEC3	Clostridium_phage	50.0	4.9e-07
WP_014017800.1|118930_119551_+	phage antirepressor	NA	B2ZYU5	Staphylococcus_phage	35.0	1.5e-25
WP_014017801.1|119553_119772_-	helix-turn-helix transcriptional regulator	NA	A0A139ZPK3	Marinitoga_camini_virus	46.7	3.0e-08
WP_014017802.1|119889_120090_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005807558.1|120144_120363_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005807556.1|120367_120547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005807554.1|120632_120899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005807552.1|120915_121215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005807550.1|121214_122351_+	DUF2800 domain-containing protein	NA	A0A0A7S066	Clostridium_phage	48.2	1.2e-97
WP_014017803.1|122366_122927_+	DUF2815 family protein	NA	A0A0A7RVM4	Clostridium_phage	58.6	3.1e-57
WP_014017804.1|122926_124846_+	DNA polymerase	NA	S5M5X4	Brevibacillus_phage	55.1	1.0e-192
WP_014017805.1|127658_127967_+	VRR-NUC domain-containing protein	NA	A0A1W6JQA8	Corynebacterium_phage	40.4	9.7e-13
WP_014017806.1|127918_129259_+	DEAD/DEAH box helicase family protein	NA	A0A1S7FYY5	Listeria_phage	53.6	1.1e-134
WP_014017807.1|129271_129697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005807536.1|129683_129896_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007440106.1|129973_130690_+	SHOCT domain-containing protein	NA	X5JB37	Clostridium_phage	37.5	5.2e-33
WP_005807533.1|130853_131276_+|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	45.6	5.8e-24
WP_005807531.1|131272_131704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005807529.1|131718_132966_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M4R5F3	Bacillus_phage	57.7	3.4e-141
WP_007440341.1|133006_133486_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_007440342.1|133526_133781_-	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_007440343.1|133876_135265_+|portal	phage portal protein	portal	A0A0A7S074	Clostridium_phage	42.7	1.6e-107
WP_005807521.1|135257_136841_+|capsid	minor capsid protein	capsid	A0A0A8WIE7	Clostridium_phage	51.9	6.6e-105
WP_005807519.1|136844_137051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007440347.1|137083_137425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005807517.1|137510_138188_+	DUF4065 domain-containing protein	NA	I6R0L8	Salmonella_phage	29.4	9.3e-08
WP_005807516.1|138384_138984_+	phage scaffolding protein	NA	A0A1Z1LZK8	Bacillus_phage	31.0	3.0e-10
WP_014017808.1|138992_140051_+	hypothetical protein	NA	A0A0A7RTH8	Clostridium_phage	51.5	2.3e-93
WP_005807512.1|140057_140438_+	hypothetical protein	NA	X5JAJ0	Clostridium_phage	39.5	6.3e-14
WP_005807509.1|140413_140788_+	hypothetical protein	NA	X5JAV9	Clostridium_phage	44.7	2.3e-16
WP_005807507.1|140787_141195_+	HK97 gp10 family phage protein	NA	A0A0A7RVN8	Clostridium_phage	33.1	4.7e-15
WP_005807505.1|141191_141620_+	hypothetical protein	NA	A0A0A8WJT3	Clostridium_phage	36.8	1.3e-20
WP_005807504.1|141624_141813_+	hypothetical protein	NA	A0A0A7RTG1	Clostridium_phage	61.5	2.0e-05
WP_005807500.1|141814_143116_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	X5JAJ1	Clostridium_phage	59.0	5.5e-150
WP_005807498.1|143127_143604_+|tail	phage tail tube protein	tail	A0A0A8WJ62	Clostridium_phage	69.1	3.4e-57
WP_005807496.1|143605_144037_+	hypothetical protein	NA	X5JAB6	Clostridium_phage	35.4	2.2e-18
WP_100181642.1|144036_144225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014017810.1|144231_146892_+	tape measure protein	NA	H7BVH2	unidentified_phage	47.8	9.8e-178
WP_005807488.1|146891_147593_+	hypothetical protein	NA	X5J9Z8	Clostridium_phage	47.9	1.0e-33
WP_005807486.1|147595_148555_+	hypothetical protein	NA	H7BVH4	unidentified_phage	61.0	4.2e-115
WP_005807484.1|148547_148868_+	DUF2577 domain-containing protein	NA	A0A0A7RTJ2	Clostridium_phage	39.4	1.2e-13
WP_005807482.1|148864_149272_+	DUF2634 domain-containing protein	NA	A0A0A8WJV8	Clostridium_phage	48.6	8.8e-30
WP_005807480.1|149271_150342_+|plate	baseplate J/gp47 family protein	plate	X5JAB8	Clostridium_phage	48.1	9.0e-90
WP_005807479.1|150328_151018_+	DUF2313 domain-containing protein	NA	H7BVG1	unidentified_phage	39.2	8.5e-25
WP_005807478.1|151004_151769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007441037.1|151773_152619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014017811.1|152618_154328_+|tail	phage tail protein	tail	A0A0C5AEQ0	Bacteriophage	36.6	4.0e-15
157133:157177	attR	GTTTTGTCAAACATATCATGTAGAAACTATTGTTAGATTTACTTT	NA	NA	NA	NA
>prophage 2
NC_015913	Candidatus Arthromitus sp. SFB-mouse-Japan, complete genome	1620005	413865	421106	1620005	capsid,terminase,portal	Clostridium_phage(50.0%)	11	NA	NA
WP_005806970.1|413865_414288_+|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	45.6	1.3e-23
WP_005806968.1|414284_414716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005806966.1|414731_414992_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_005806964.1|415005_415308_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_007440545.1|415304_416546_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M4R5F3	Bacillus_phage	57.5	2.6e-141
WP_014017855.1|416604_417816_+|portal	phage portal protein	portal	A0A0A7S074	Clostridium_phage	43.4	7.5e-93
WP_014017856.1|417893_418778_+|capsid	minor capsid protein	capsid	A0A0A8WIE7	Clostridium_phage	49.6	5.2e-27
WP_005807519.1|418781_418988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007440347.1|419020_419362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005806950.1|419511_420111_+	phage scaffolding protein	NA	S5M9M5	Brevibacillus_phage	31.6	2.5e-12
WP_005806949.1|420119_421106_+	ATP-binding protein	NA	A0A0A7RTH8	Clostridium_phage	44.9	5.8e-35
>prophage 3
NC_015913	Candidatus Arthromitus sp. SFB-mouse-Japan, complete genome	1620005	1256299	1270698	1620005		Erysipelothrix_phage(50.0%)	13	NA	NA
WP_014018025.1|1256299_1257193_-	FAD-dependent oxidoreductase	NA	A0A2I2L5E1	Orpheovirus	32.9	1.5e-29
WP_014018027.1|1258716_1259151_-	DUF4406 domain-containing protein	NA	A0A2K5B270	Erysipelothrix_phage	85.4	1.3e-68
WP_014018028.1|1259152_1259932_-	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVU2	Staphylococcus_phage	50.4	1.6e-67
WP_014018029.1|1259995_1260538_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2K5B267	Erysipelothrix_phage	64.2	1.3e-60
WP_014018030.1|1260841_1260985_-	hypothetical protein	NA	A0A0A8WJA8	Clostridium_phage	72.7	1.4e-06
WP_014018031.1|1261343_1262177_+	hypothetical protein	NA	A0A2K5B265	Erysipelothrix_phage	72.2	3.8e-112
WP_014018032.1|1262197_1265008_+	AAA family ATPase	NA	A0A2K5B264	Erysipelothrix_phage	88.8	0.0e+00
WP_014018033.1|1264991_1265204_+	helix-turn-helix domain-containing protein	NA	A0A2K5B263	Erysipelothrix_phage	75.7	4.4e-25
WP_014018034.1|1265336_1266380_+	NgoFVII family restriction endonuclease	NA	NA	NA	NA	NA
WP_014018035.1|1266401_1267640_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	30.4	1.5e-27
WP_014018036.1|1267617_1268745_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	38.9	1.8e-56
WP_014018037.1|1268737_1268959_-	helix-turn-helix transcriptional regulator	NA	A0A1P8BML9	Lactococcus_phage	55.9	3.7e-14
WP_014018038.1|1269357_1270698_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	31.4	5.5e-52
