The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015923	Salmonella enterica subsp. enterica serovar Newport str. Levine 1 chromosome, complete genome	4841916	1118717	1124530	4841916		Enterobacteria_phage(100.0%)	8	NA	NA
WP_000783714.1|1118717_1121051_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.1	0.0e+00
WP_000743149.1|1121065_1121386_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216599.1|1121382_1121610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980355.1|1121606_1122164_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	66.7	9.3e-30
WP_000556587.1|1122160_1122427_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_000194694.1|1122967_1123705_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	65.3	3.1e-81
WP_000984211.1|1123701_1123947_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_000210077.1|1123963_1124530_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.2	2.9e-55
>prophage 2
NZ_CP015923	Salmonella enterica subsp. enterica serovar Newport str. Levine 1 chromosome, complete genome	4841916	1183541	1291839	4841916	holin,terminase,portal,protease,tail,transposase,tRNA,lysis,integrase	Salmonella_phage(36.21%)	107	1169179:1169195	1278048:1278064
1169179:1169195	attL	TTGACCCGGTAATTGGT	NA	NA	NA	NA
WP_000183635.1|1183541_1184222_-|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_001098732.1|1184294_1184714_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997374.1|1184917_1185955_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1186070_1186760_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1187078_1187462_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188410.1|1187523_1188111_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_024133293.1|1188213_1189113_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1189130_1190465_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083347.1|1190594_1191332_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989186.1|1191316_1192939_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1193202_1193367_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1193363_1193939_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1193970_1194621_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1194620_1195577_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589049.1|1195573_1196053_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|1196549_1197779_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|1197756_1198041_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1198081_1198321_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|1198363_1199521_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_000017125.1|1199483_1202411_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_001539619.1|1202537_1202888_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|1202909_1203068_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_000950426.1|1203524_1204187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356948.1|1204186_1204573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111772.1|1204565_1205405_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000660736.1|1205463_1205859_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_000643689.1|1205958_1206201_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_010835408.1|1206160_1206535_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000024044.1|1206626_1207511_+	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_000801764.1|1207507_1208203_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000664368.1|1208216_1208915_+	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000877757.1|1209022_1209655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1209897_1210131_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1210247_1210496_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929791.1|1210530_1211133_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_001096550.1|1211341_1211953_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|1211949_1212090_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1212086_1212764_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|1213036_1213600_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1214106_1214295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1214509_1215196_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1215471_1215801_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984581.1|1215784_1216237_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001533543.1|1216254_1216707_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1216942_1217344_-	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_001102153.1|1217630_1218176_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1218147_1220079_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1220062_1220266_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1220262_1221843_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1221832_1223329_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_072610223.1|1225605_1226199_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	75.4	1.0e-74
WP_000479607.1|1228642_1229038_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1229034_1229373_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372072.1|1229344_1232440_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_000447369.1|1232442_1232772_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1232781_1233480_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1233486_1234224_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1234121_1234769_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|1234830_1238193_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|1238231_1238474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|1238527_1240900_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|1240896_1241721_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1241710_1242289_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1242385_1242613_-	phage virulence factor PagK family protein	NA	NA	NA	NA	NA
WP_001738443.1|1242719_1242932_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_001526383.1|1243684_1243804_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1244516_1244654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1245102_1246596_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1247000_1248800_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1248816_1249791_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1250064_1250745_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102230.1|1250741_1251647_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399384.1|1251658_1252387_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818964.1|1252398_1253130_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1253129_1253510_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|1253621_1253882_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022468.1|1253919_1254846_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276365.1|1254961_1256158_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684036.1|1256179_1257097_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995705.1|1257135_1257984_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048531.1|1258099_1258993_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1259003_1260365_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1260368_1261004_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1261028_1261580_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000734248.1|1261630_1263175_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001667771.1|1263175_1263406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000970048.1|1263430_1267318_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	6.1e-128
WP_001670672.1|1267822_1269253_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
WP_001054239.1|1269254_1270019_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_000625591.1|1270015_1271353_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_000717694.1|1271429_1271768_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000856793.1|1271816_1273277_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_001100652.1|1273332_1275477_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000100008.1|1275559_1276891_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001187133.1|1277251_1278793_-	lysine decarboxylation/transport transcriptional activator CadC	NA	NA	NA	NA	NA
1278048:1278064	attR	TTGACCCGGTAATTGGT	NA	NA	NA	NA
WP_000883145.1|1278974_1280165_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919176.1|1280489_1281743_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.2	7.8e-101
WP_001173729.1|1281938_1283078_+	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000982964.1|1283072_1284350_-	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_000805728.1|1284475_1285114_+	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000111025.1|1285104_1286091_+	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000020685.1|1286091_1287105_-	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000017587.1|1287115_1287934_-	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000985209.1|1287937_1288981_-	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000174944.1|1289162_1290041_-	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000553467.1|1290185_1290989_-	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000940032.1|1291107_1291839_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP015923	Salmonella enterica subsp. enterica serovar Newport str. Levine 1 chromosome, complete genome	4841916	1708697	1717868	4841916	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569165.1|1708697_1709645_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824855.1|1709628_1710360_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1710340_1710448_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1710507_1711239_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1711461_1713147_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1713143_1713863_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1713909_1714377_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001265355.1|1714433_1714964_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1715135_1715594_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195330.1|1715834_1717868_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP015923	Salmonella enterica subsp. enterica serovar Newport str. Levine 1 chromosome, complete genome	4841916	1792366	1802873	4841916		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111836.1|1792366_1793770_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1793947_1794841_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1795217_1796303_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023659.1|1796302_1797202_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857530.1|1797249_1798128_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
WP_000973714.1|1798128_1798680_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
WP_000018224.1|1798685_1799660_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1799675_1800449_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565902.1|1800453_1801533_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
WP_000126352.1|1801559_1802873_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
NZ_CP015923	Salmonella enterica subsp. enterica serovar Newport str. Levine 1 chromosome, complete genome	4841916	1899414	1906680	4841916		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1899414_1899834_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457666.1|1899836_1901105_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.7	1.3e-225
WP_000187976.1|1901559_1901772_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	5.1e-21
WP_024131109.1|1901782_1901971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080683.1|1902228_1903440_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.0	1.3e-108
WP_000107430.1|1904089_1904389_+	membrane protein	NA	NA	NA	NA	NA
WP_000377048.1|1904480_1905176_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.1e-07
WP_001157313.1|1905249_1906680_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP015923	Salmonella enterica subsp. enterica serovar Newport str. Levine 1 chromosome, complete genome	4841916	2668150	2710278	4841916	holin,tail,lysis,head,plate,integrase	Salmonella_phage(17.39%)	59	2659799:2659813	2708965:2708979
2659799:2659813	attL	TTTAAAGAGGTAATA	NA	NA	NA	NA
WP_000143157.1|2668150_2668735_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	82.2	2.8e-85
WP_000772814.1|2668734_2670186_-|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	69.6	1.2e-41
WP_001181747.1|2670175_2670778_-	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	3.3e-33
WP_001293658.1|2670779_2672021_-|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	49.9	1.2e-101
WP_001191865.1|2672017_2672374_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_000068499.1|2672386_2673064_-	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	36.4	5.4e-32
WP_000122818.1|2673044_2673914_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_000890115.1|2673910_2674213_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_000010345.1|2674212_2674923_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	8.5e-28
WP_000741783.1|2674919_2677091_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.1e-49
WP_000386822.1|2677074_2677254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000101346.1|2677298_2677703_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000016413.1|2677702_2678149_-	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	39.7	4.8e-21
WP_001122279.1|2678149_2679634_-	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	40.4	5.8e-95
WP_000094503.1|2679614_2680160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001048639.1|2680144_2680510_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	3.0e-21
WP_000247615.1|2680506_2681091_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	31.7	3.2e-17
WP_000537612.1|2681084_2681531_-	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	43.1	1.8e-15
WP_000829562.1|2681536_2681884_-	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	35.4	2.1e-08
WP_001031914.1|2681887_2682916_-	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.4	8.7e-82
WP_001091402.1|2682915_2683398_-	hypothetical protein	NA	K4HYQ5	Acinetobacter_phage	41.2	5.8e-20
WP_000587352.1|2683399_2684746_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	36.5	1.1e-68
WP_000552015.1|2684742_2685432_-|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	48.7	1.0e-57
WP_000266182.1|2685472_2686993_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.9	2.6e-106
WP_001130802.1|2686992_2688612_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	81.2	1.9e-261
WP_001118124.1|2688614_2689244_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	97.6	1.3e-107
WP_001288297.1|2689308_2689722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001533411.1|2690022_2690211_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_086010415.1|2690368_2690872_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	78.5	5.8e-55
WP_001208107.1|2691189_2691729_-	lysozyme	NA	S5MQK2	Escherichia_phage	74.1	5.7e-77
WP_001533331.1|2691706_2692009_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_001533418.1|2692258_2692726_+	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
WP_000690097.1|2692737_2692956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000658040.1|2693109_2693298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000155182.1|2693540_2694092_-	ORF6N domain-containing protein	NA	A0A0P0ZDQ5	Stx2-converting_phage	94.8	1.3e-55
WP_000211400.1|2694354_2694666_-	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	74.4	6.5e-41
WP_000639983.1|2694931_2695486_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	65.3	5.7e-64
WP_000926968.1|2695482_2695779_-	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	81.3	1.6e-36
WP_000784711.1|2695760_2695955_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	7.9e-13
WP_000940757.1|2695951_2696551_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	83.9	2.9e-98
WP_000911593.1|2696614_2696863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001597144.1|2697113_2697269_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	1.2e-14
WP_000687967.1|2697472_2697745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000533386.1|2697741_2698137_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	37.0	3.7e-17
WP_162010736.1|2698148_2698691_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	73.9	2.9e-68
WP_000729543.1|2698602_2699610_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	69.3	5.1e-127
WP_024159654.1|2699656_2700151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001033909.1|2700137_2700392_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	59.4	1.2e-16
WP_001224472.1|2700488_2700914_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	1.2e-13
WP_024133274.1|2701357_2701537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613376.1|2701967_2702252_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	53.2	5.1e-08
WP_000023731.1|2702801_2705492_+	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	74.9	1.1e-115
WP_001126032.1|2705484_2706315_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_001033922.1|2706350_2706671_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	59.2	1.8e-33
WP_000066251.1|2706663_2706996_+	hypothetical protein	NA	S4TNP2	Salmonella_phage	81.8	8.8e-20
WP_000069466.1|2706992_2707496_+	hypothetical protein	NA	A0A075B8H2	Enterobacteria_phage	92.3	6.0e-36
WP_000089141.1|2707545_2707782_+	excisionase	NA	NA	NA	NA	NA
WP_000741322.1|2707771_2708914_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	79.7	2.0e-172
WP_000444507.1|2709027_2710278_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.1e-19
2708965:2708979	attR	TTTAAAGAGGTAATA	NA	NA	NA	NA
>prophage 7
NZ_CP015923	Salmonella enterica subsp. enterica serovar Newport str. Levine 1 chromosome, complete genome	4841916	2858609	2961653	4841916	holin,terminase,protease,tail,transposase,capsid,lysis,tRNA,head	Enterobacteria_phage(30.0%)	96	NA	NA
WP_000938188.1|2858609_2859290_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	72.4	1.6e-84
WP_000374046.1|2859928_2860588_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904446.1|2860674_2861004_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2861000_2861282_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548081.1|2861330_2862110_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2862135_2862684_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2862898_2864110_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2864167_2864485_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2864529_2864943_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847736.1|2865116_2865779_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2865873_2866332_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2866367_2868422_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2868545_2868992_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950881.1|2869010_2871164_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2871150_2871756_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2871972_2872482_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_022630818.1|2872838_2873891_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2873962_2874415_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156459.1|2874600_2876361_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2876429_2876948_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2877047_2877215_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2877470_2878034_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2878030_2879671_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2879675_2880929_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053051.1|2880943_2882851_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	5.4e-53
WP_001086485.1|2882863_2884972_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224076.1|2885070_2886180_+	YcbX family protein	NA	NA	NA	NA	NA
WP_001220671.1|2886176_2886719_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000193785.1|2888101_2890714_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2891140_2891332_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2891602_2892289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|2892273_2892573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2892641_2893268_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001533476.1|2893915_2894884_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000143167.1|2895359_2895941_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_072610225.1|2895940_2898379_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	4.1e-90
WP_000178853.1|2898432_2898675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2898713_2902076_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2902137_2902785_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2902682_2903420_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2903426_2904125_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2904134_2904464_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372072.1|2904466_2907562_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_010989052.1|2907533_2907872_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2907868_2908264_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2908314_2909061_-	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2909068_2909470_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2909578_2910709_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2910757_2911336_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2911363_2911747_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2911757_2912117_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522566.1|2912174_2913203_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2913257_2913605_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2913617_2915114_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000201415.1|2916679_2916883_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623083.1|2916866_2918798_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.6	1.4e-258
WP_001102152.1|2918769_2919315_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	79.9	1.9e-56
WP_000669689.1|2919600_2920002_+	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_001673842.1|2920190_2920682_-|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	74.2	9.6e-55
WP_001533556.1|2921143_2921359_-|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	47.5	2.2e-08
WP_000029436.1|2921536_2922076_+	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
WP_000690098.1|2922087_2922306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000658040.1|2922459_2922648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001533567.1|2923023_2923710_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	98.2	1.1e-130
WP_000764542.1|2923841_2924639_-	antitermination protein	NA	H6WRZ1	Salmonella_phage	98.5	9.8e-150
WP_024134429.1|2924628_2924775_-	YlcG family protein	NA	H6WRZ0	Salmonella_phage	100.0	4.3e-19
WP_001096565.1|2924771_2925413_-	recombination protein NinG	NA	S4TSR3	Salmonella_phage	98.6	3.7e-115
WP_001241015.1|2925415_2925622_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	85.3	1.5e-30
WP_000929790.1|2925621_2926224_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_000911593.1|2926286_2926535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|2927223_2929203_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_000529512.1|2929599_2930730_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000089415.1|2931016_2931412_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.8	9.8e-18
WP_157872077.1|2931425_2931968_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.1e-67
WP_000729539.1|2931879_2932887_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.8	1.2e-123
WP_001533160.1|2932933_2933428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001033911.1|2933414_2933669_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
WP_001574209.1|2933767_2934166_+	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
WP_072610226.1|2934872_2937800_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	91.8	0.0e+00
WP_001539618.1|2937762_2938920_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2938962_2939202_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2939242_2939491_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|2939535_2940828_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191404.1|2941022_2942225_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893192.1|2942305_2943739_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544861.1|2943984_2945199_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762343.1|2945515_2945977_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117867.1|2946177_2947578_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
WP_000462663.1|2949459_2950650_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109471.1|2950711_2951359_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|2951386_2951935_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925891.1|2952194_2954039_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572733.1|2954383_2958850_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000060027.1|2958849_2959554_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|2959534_2960857_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154028.1|2960849_2961653_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP015923	Salmonella enterica subsp. enterica serovar Newport str. Levine 1 chromosome, complete genome	4841916	3012132	3019444	4841916	protease	Ralstonia_phage(16.67%)	7	NA	NA
WP_001531374.1|3012132_3012510_+	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
WP_001117984.1|3012671_3012869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|3013081_3015358_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3015388_3015709_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3016031_3016253_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3016382_3018329_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001202482.1|3018325_3019444_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
>prophage 9
NZ_CP015923	Salmonella enterica subsp. enterica serovar Newport str. Levine 1 chromosome, complete genome	4841916	3382279	3423539	4841916	holin,tail,head,integrase	Salmonella_phage(42.86%)	62	3381971:3382016	3423554:3423599
3381971:3382016	attL	ATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
WP_000108377.1|3382279_3384169_-	hypothetical protein	NA	S4TVJ1	Salmonella_phage	50.4	4.2e-159
WP_001114045.1|3384226_3386665_-	hypothetical protein	NA	A0A1B1W274	Salmonella_phage	66.2	0.0e+00
WP_001278433.1|3386639_3387098_-	C40 family peptidase	NA	A0A1W6DXT0	Salmonella_phage	60.5	5.6e-49
WP_001142699.1|3387090_3387561_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	73.1	2.1e-59
WP_001274291.1|3387560_3388064_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	68.9	1.2e-65
WP_000046199.1|3388066_3390580_-|tail	phage tail length tape measure family protein	tail	A0A173GC04	Salmonella_phage	63.2	3.3e-215
WP_001207359.1|3390579_3391269_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	52.9	4.6e-55
WP_001262462.1|3391327_3392086_-	immunoglobulin domain-containing protein	NA	F1C5E5	Cronobacter_phage	63.4	1.1e-54
WP_000188851.1|3392157_3392541_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	58.3	4.6e-36
WP_000501025.1|3392537_3392963_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	43.3	2.4e-25
WP_001276815.1|3392964_3393321_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	62.4	9.7e-33
WP_000968548.1|3393491_3393767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235014.1|3393766_3394147_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	53.2	1.2e-28
WP_001229819.1|3394149_3394377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000964204.1|3394387_3395482_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	63.4	7.0e-122
WP_001029956.1|3395493_3395922_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	61.5	1.6e-42
WP_000828206.1|3395926_3397312_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	58.5	1.1e-148
WP_001027974.1|3397381_3397891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024133265.1|3397931_3398936_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.4	3.8e-114
WP_001295004.1|3398862_3400332_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.8	5.8e-148
WP_000801674.1|3400344_3401817_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	83.5	1.5e-252
WP_000042457.1|3401816_3402419_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	76.6	3.2e-76
WP_001280566.1|3402422_3402641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001532917.1|3402903_3403281_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	41.5	2.8e-14
WP_001167372.1|3403277_3403715_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	2.2e-74
WP_000738703.1|3403698_3404025_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_000947775.1|3404249_3404768_-	HNH endonuclease	NA	A0A1V0E5R7	Salmonella_phage	67.4	1.2e-58
WP_001047573.1|3405103_3405868_-	antitermination protein	NA	Q5G8R6	Enterobacteria_phage	99.2	2.5e-142
WP_000219139.1|3405864_3406044_-	hypothetical protein	NA	A0A0M4QWY9	Salmonella_phage	98.3	2.7e-23
WP_000149882.1|3406024_3406228_-	phage NinH family protein	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000036319.1|3406224_3406449_-	hypothetical protein	NA	I6R0N9	Salmonella_phage	98.6	1.8e-37
WP_001108076.1|3406445_3407057_-	recombination protein NinG	NA	A0A2H5BFK3	Salmonella_phage	96.6	1.1e-95
WP_000950972.1|3407049_3407226_-	protein ninF	NA	G9L691	Escherichia_phage	98.2	2.2e-25
WP_001532927.1|3407218_3407560_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_001254224.1|3407562_3407739_-	NinE family protein	NA	K7PH28	Enterobacteria_phage	98.3	5.1e-27
WP_001250039.1|3407735_3408146_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	96.3	2.0e-69
WP_000238250.1|3408153_3408360_-	hypothetical protein	NA	K7PMD7	Enterobacterial_phage	97.1	6.9e-31
WP_001248401.1|3408432_3409809_-	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	98.0	1.1e-249
WP_000067073.1|3409805_3410621_-	replication protein	NA	A0A075B8J2	Enterobacteria_phage	95.6	6.7e-146
WP_001125981.1|3410613_3410760_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_001103492.1|3410794_3411076_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000182204.1|3411186_3411402_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|3411512_3412202_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_001532928.1|3412365_3413445_+	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_000834172.1|3413590_3413794_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	95.5	3.3e-25
WP_000216185.1|3414172_3414475_+	hypothetical protein	NA	B8K1E6	Salmonella_phage	94.0	1.7e-46
WP_001066178.1|3414487_3415075_-	superinfection exclusion B family protein	NA	A0A192Y7Z0	Salmonella_phage	94.3	7.1e-97
WP_000159516.1|3415267_3416251_+	hypothetical protein	NA	Q5G8T6	Enterobacteria_phage	80.4	2.9e-74
WP_000983400.1|3416461_3416596_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	68.2	1.4e-08
WP_001191777.1|3416580_3416733_+	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_000604103.1|3416817_3417126_+	hypothetical protein	NA	A0A0M3ULC7	Salmonella_phage	97.0	3.6e-52
WP_001532863.1|3417122_3417944_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0M5M5Y6	Salmonella_phage	99.3	7.2e-156
WP_000366151.1|3417943_3418513_+	hypothetical protein	NA	A0A0M4RD07	Salmonella_phage	100.0	2.1e-101
WP_000650384.1|3418512_3418827_+	hypothetical protein	NA	A0A0M4R304	Salmonella_phage	99.0	7.7e-50
WP_001214774.1|3418843_3419014_+	DUF2737 family protein	NA	A0A220NQV6	Salmonella_phage	98.2	5.1e-24
WP_000665857.1|3419010_3419397_+	hypothetical protein	NA	A0A0U2BZT9	Salmonella_phage	89.6	1.4e-16
WP_000065084.1|3419505_3419865_+	Eaf protein	NA	T1SA95	Salmonella_phage	94.1	1.7e-61
WP_000065098.1|3419861_3420425_+	ead/Ea22-like family protein	NA	A0A1R3Y5T1	Salmonella_virus	41.7	7.7e-24
WP_000252687.1|3420424_3420640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000208020.1|3420643_3421351_+	DUF551 domain-containing protein	NA	A0A2H4FNA9	Salmonella_phage	71.4	4.7e-87
WP_000509005.1|3421666_3421933_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	96.6	4.9e-45
WP_001532862.1|3422375_3423539_+|integrase	site-specific integrase	integrase	B9UDL9	Salmonella_phage	99.0	1.6e-225
3423554:3423599	attR	ATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
>prophage 10
NZ_CP015923	Salmonella enterica subsp. enterica serovar Newport str. Levine 1 chromosome, complete genome	4841916	4422565	4467340	4841916	tRNA,holin,tail,plate	Burkholderia_phage(36.36%)	47	NA	NA
WP_001182219.1|4422565_4423564_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039337.1|4423651_4424962_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4425208_4425724_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4425823_4426033_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001575282.1|4426054_4426168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128118.1|4426164_4427490_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4427668_4428277_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4428385_4428754_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4428924_4431345_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4431443_4432316_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019231.1|4432329_4432827_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4433007_4433925_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973642.1|4434088_4435447_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4435535_4436645_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695414.1|4437005_4438196_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4438327_4439872_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4439886_4440777_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4440942_4441353_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4441495_4443592_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977968.1|4443591_4444329_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_123220402.1|4444325_4444994_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4445027_4445270_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790042.1|4445713_4447363_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4447707_4449057_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4449187_4449535_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226439.1|4450111_4450399_+|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_001203711.1|4450401_4451007_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	9.3e-60
WP_000777266.1|4451019_4451334_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449399.1|4451493_4451949_+	Gp37 family protein	NA	NA	NA	NA	NA
WP_000875314.1|4451945_4452143_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729853.1|4452132_4453560_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.4e-194
WP_000907494.1|4453559_4454084_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003635.1|4454135_4454453_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4454412_4454541_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262490.1|4454637_4456989_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.3	5.8e-65
WP_000271425.1|4456988_4457942_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4457941_4458151_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818150.1|4458138_4459182_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.9	3.8e-77
WP_000679389.1|4459191_4459914_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|4460241_4460604_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703628.1|4460600_4461530_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	7.9e-151
WP_001095009.1|4461529_4463077_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	1.5e-48
WP_001093501.1|4463240_4463600_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951731.1|4463590_4464706_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.0	9.0e-101
WP_000359499.1|4464698_4465331_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368203.1|4465333_4466815_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_001177097.1|4466824_4467340_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
