The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010284	Salmonella enterica subsp. enterica serovar Newport str. CVM N1543 chromosome, complete genome	4827959	330608	437755	4827959	protease,tail,integrase,lysis,head,transposase,tRNA,terminase,holin,portal,capsid	Salmonella_phage(33.33%)	112	355153:355169	445659:445675
WP_000940030.1|330608_331340_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553474.1|331458_332262_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174939.1|332406_333285_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	6.0e-15
WP_000985200.1|333466_334510_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|334513_335332_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|335342_336356_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111025.1|336356_337343_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|337333_337972_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982964.1|338097_339375_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|339369_340509_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|340704_341958_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|342282_343473_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|343654_345199_+	lysine decarboxylation/transport transcriptional activator CadC	NA	NA	NA	NA	NA
WP_000100008.1|345559_346891_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|346973_349118_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|349173_350634_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|350682_351021_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|351097_352435_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054239.1|352431_353196_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|353197_354628_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
355153:355169	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970062.1|355277_359165_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	8.0e-128
WP_001667158.1|359189_359420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|359420_360965_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134572.1|361015_361567_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|361591_362227_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|362230_363592_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|363602_364496_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995694.1|364611_365460_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684023.1|365498_366416_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276364.1|366437_367634_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022472.1|367749_368676_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	1.8e-09
WP_001196291.1|368713_368974_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_000986042.1|369085_369466_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|369465_370197_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|370208_370937_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|370948_371854_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|371850_372531_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|372804_373779_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|373795_375595_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|375999_377493_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|377977_378115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|378827_378992_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001738443.1|379699_379912_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|380018_380246_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|380342_380921_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|380910_381735_-	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|381731_384104_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|384157_384400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|384438_387801_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|387862_388510_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|388407_389145_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|389151_389850_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|389859_390189_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372072.1|390191_393287_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_010989052.1|393258_393597_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|393593_393989_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|394039_394786_-	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|394793_395195_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|395303_396434_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|396482_397061_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|397088_397472_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|397482_397842_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522566.1|397899_398928_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|398982_399330_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|399342_400839_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|400828_402409_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|402405_402609_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|402592_404524_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|404495_405041_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|405327_405729_+	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_001533543.1|405964_406417_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000984581.1|406434_406887_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001574216.1|406870_407200_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|407475_408162_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|408376_408565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|409071_409635_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|409907_410585_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|410581_410722_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096562.1|410718_411330_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.5	1.8e-90
WP_000929791.1|411538_412141_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_014343878.1|412175_412424_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|412540_412774_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000877757.1|413016_413649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000664368.1|413756_414455_-	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000801764.1|414468_415164_-	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000024044.1|415160_416045_-	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_010835408.1|416136_416511_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000643689.1|416470_416713_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_000660736.1|416812_417208_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_001111772.1|417266_418106_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000356948.1|418098_418485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000950426.1|418484_419147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917562.1|419603_419762_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|419783_420134_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000017128.1|420260_423188_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	99.2	0.0e+00
WP_077248255.1|423150_424308_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_001237031.1|424350_424590_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|424630_424915_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007934.1|424892_426122_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.1	4.9e-233
WP_000589050.1|426619_427099_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|427095_428052_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|428051_428702_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|428733_429309_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|429305_429470_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989165.1|429733_431356_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083342.1|431340_432078_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|432207_433542_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001670786.1|433559_434459_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|434561_435149_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|435210_435594_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|435912_436602_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997365.1|436717_437755_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
445659:445675	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 2
NZ_CP010284	Salmonella enterica subsp. enterica serovar Newport str. CVM N1543 chromosome, complete genome	4827959	543499	609280	4827959	protease,tail,integrase,lysis,head,plate,terminase,portal,capsid	Salmonella_phage(40.91%)	77	573355:573401	604334:604380
WP_000208240.1|543499_544030_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293360.1|544039_545371_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000139637.1|545437_546367_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872918.1|546459_546945_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000051370.1|547166_547406_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084285.1|547804_548650_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000136809.1|548670_550179_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250617.1|550290_551301_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796293.1|551397_552144_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000155229.1|552249_552678_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802242.1|552778_553375_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216339.1|553487_554255_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001088053.1|554346_555111_-	epimerase	NA	NA	NA	NA	NA
WP_001543603.1|555120_555411_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774146.1|555493_556369_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000090737.1|556397_557420_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000981826.1|557448_558450_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911133.1|558446_559490_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001167248.1|559483_561019_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_001283049.1|561274_562234_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113085.1|562320_563913_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001173080.1|563926_564277_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001519915.1|564775_565498_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000557881.1|565560_566601_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_000646510.1|566610_567570_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000777320.1|567580_568915_-	MFS transporter	NA	NA	NA	NA	NA
WP_000750762.1|569177_569933_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000758711.1|570033_571023_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591793.1|571226_572189_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001077320.1|572373_573276_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
573355:573401	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000933379.1|573562_573979_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	52.3	1.8e-33
WP_000468311.1|574013_574232_-	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	100.0	4.7e-38
WP_000627818.1|574309_575479_-	phage late control D family protein	NA	S4TRX8	Salmonella_phage	95.6	1.4e-205
WP_000978869.1|575475_575961_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	94.4	5.9e-81
WP_000069524.1|575972_578414_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	93.1	0.0e+00
WP_085984508.1|578406_578562_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_001029727.1|578558_578894_-|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
WP_001207676.1|578956_579475_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	1.4e-93
WP_001279030.1|579490_580678_-|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	100.0	2.0e-223
WP_000874698.1|580812_581382_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	86.8	3.0e-92
WP_000104695.1|581381_583124_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	97.1	1.5e-267
WP_001000070.1|583134_583665_-|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	100.0	1.9e-104
WP_000246674.1|583657_584566_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	98.7	1.7e-158
WP_000127150.1|584572_584920_-	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	98.3	2.1e-56
WP_001093789.1|584916_585558_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	85.0	2.4e-98
WP_000273577.1|585634_587011_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_000997680.1|587015_587483_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	67.8	9.8e-49
WP_000277800.1|587475_587943_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	69.0	2.2e-56
WP_000849743.1|588050_588464_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	59.9	8.4e-36
WP_000534554.1|588460_588970_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.6	4.6e-76
WP_000524754.1|588953_589175_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
WP_001100637.1|589165_589369_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
WP_000177982.1|589368_589869_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	3.8e-59
WP_000224816.1|589966_590725_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	67.1	2.7e-80
WP_001224307.1|590728_591889_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	62.5	2.8e-129
WP_001074705.1|591920_592784_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	64.8	4.5e-100
WP_000214048.1|592948_594718_+|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	81.0	3.2e-286
WP_000039235.1|594717_595755_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	78.7	7.7e-163
WP_000551923.1|596275_596467_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	100.0	1.1e-27
WP_000042036.1|596465_596897_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	100.0	1.1e-75
WP_000680929.1|597030_598071_+	Fic family protein	NA	S4TP71	Salmonella_phage	100.0	6.3e-197
WP_000037667.1|598067_598265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257582.1|598443_600720_-	replication endonuclease	NA	S4TTC1	Salmonella_phage	88.0	0.0e+00
WP_000027647.1|600709_600985_-	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	72.5	7.0e-31
WP_001113578.1|600981_601206_-	TraR/DksA C4-type zinc finger protein	NA	A0A0F7LDG9	Escherichia_phage	75.7	2.0e-23
WP_000557712.1|601507_601732_-	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	78.4	3.4e-23
WP_001670778.1|601795_602296_-	hypothetical protein	NA	M1SV55	Escherichia_phage	91.0	1.8e-85
WP_001583792.1|602465_602738_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	87.8	1.0e-42
WP_001099751.1|602874_603168_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	75.3	1.6e-36
WP_000985251.1|603237_604218_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	96.0	1.5e-179
WP_001233463.1|604402_604903_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
604334:604380	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033731.1|605053_605752_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580402.1|605748_607122_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_000338672.1|607169_607373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000133442.1|607493_607889_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000559230.1|607900_608590_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000122632.1|608659_609280_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
>prophage 3
NZ_CP010284	Salmonella enterica subsp. enterica serovar Newport str. CVM N1543 chromosome, complete genome	4827959	1449304	1505988	4827959	tail,integrase,plate,head,tRNA,terminase,holin,portal,capsid	Cronobacter_phage(63.41%)	61	1458505:1458525	1508295:1508315
WP_000785626.1|1449304_1449703_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000031219.1|1449705_1450011_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000877300.1|1450052_1450421_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000917516.1|1450565_1450949_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000422141.1|1450952_1451615_-	DedA family protein	NA	NA	NA	NA	NA
WP_000235363.1|1452064_1453309_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_001098837.1|1453563_1454532_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	2.2e-39
WP_000617688.1|1454802_1455801_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000951045.1|1455889_1456582_-	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_000202966.1|1456733_1457231_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000019993.1|1457316_1458453_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
1458505:1458525	attL	GATAAGCGCAGCGCCATCAGG	NA	NA	NA	NA
WP_000121526.1|1458533_1460552_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_001520281.1|1460722_1462102_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	2.9e-32
WP_000094651.1|1462531_1464052_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	48.5	6.4e-33
WP_000478471.1|1464439_1466005_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.7e-12
WP_000983434.1|1466001_1466649_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000213689.1|1466880_1467648_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000627044.1|1467905_1469687_-	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_001145219.1|1469676_1470714_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000568371.1|1470717_1471284_-	PH domain-containing protein	NA	Q4ZA70	Staphylococcus_virus	32.2	7.5e-19
WP_000514631.1|1471300_1471882_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_001247711.1|1472025_1472247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460878.1|1472277_1472781_+	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|1472790_1473018_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000996837.1|1473007_1473433_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000022786.1|1473432_1473834_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000551169.1|1473901_1474135_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000279404.1|1474125_1474986_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.0	1.1e-130
WP_000170874.1|1474982_1477004_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.5	7.9e-297
WP_000353141.1|1477123_1477330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|1477303_1477627_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000038213.1|1477623_1478685_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001151939.1|1478681_1480457_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	9.8e-291
WP_000018800.1|1480617_1481421_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	2.0e-78
WP_000550495.1|1481482_1482505_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.5	3.9e-159
WP_001218537.1|1482508_1483210_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_001680743.1|1483306_1483759_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	1.6e-64
WP_000084218.1|1483755_1484262_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.2e-63
WP_000560080.1|1484258_1484966_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	1.3e-100
WP_000220203.1|1484962_1486090_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000166743.1|1486086_1486542_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|1486551_1486845_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|1486841_1487183_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376373.1|1487182_1487515_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	1.5e-35
WP_001670161.1|1487486_1487675_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	77.4	1.5e-21
WP_000411339.1|1487661_1487919_+|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000811094.1|1488106_1490077_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	3.2e-274
WP_001002797.1|1490073_1490403_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136921.1|1490399_1491584_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001001828.1|1491576_1492164_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
WP_000084307.1|1492173_1494408_+|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	73.7	7.2e-182
WP_000861353.1|1494420_1494975_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.0	2.7e-90
WP_000267957.1|1494964_1495690_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.5	3.7e-63
WP_000200789.1|1495661_1496207_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_000977530.1|1496206_1497910_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	9.9e-224
WP_000340945.1|1499297_1499600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|1499923_1500430_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|1500553_1502401_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918864.1|1502550_1504296_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|1504531_1504747_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264391.1|1504974_1505988_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
1508295:1508315	attR	GATAAGCGCAGCGCCATCAGG	NA	NA	NA	NA
>prophage 4
NZ_CP010284	Salmonella enterica subsp. enterica serovar Newport str. CVM N1543 chromosome, complete genome	4827959	1979709	1985522	4827959		Enterobacteria_phage(100.0%)	8	NA	NA
WP_000783706.1|1979709_1982043_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.5	0.0e+00
WP_000743153.1|1982057_1982378_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216598.1|1982374_1982602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980354.1|1982598_1983156_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	66.4	2.7e-29
WP_000556587.1|1983152_1983419_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_000194694.1|1983959_1984697_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	65.3	3.1e-81
WP_000984206.1|1984693_1984939_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	76.5	4.8e-31
WP_000210079.1|1984955_1985522_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.2	3.8e-55
>prophage 5
NZ_CP010284	Salmonella enterica subsp. enterica serovar Newport str. CVM N1543 chromosome, complete genome	4827959	1988611	2103481	4827959	plate,tail,integrase,tRNA	Burkholderia_phage(31.03%)	97	1984487:1984502	1992420:1992435
1984487:1984502	attL	GCAGCAGGTGAAAGCG	NA	NA	NA	NA
WP_000124716.1|1988611_1989805_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.6	2.6e-106
WP_000342601.1|1990423_1991587_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000196147.1|1991594_1993775_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	9.9e-19
1992420:1992435	attR	CGCTTTCACCTGCTGC	NA	NA	NA	NA
WP_000533874.1|1993771_1995181_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001237676.1|1995245_2006411_-	Ig-like domain repeat protein	NA	NA	NA	NA	NA
WP_001518569.1|2007024_2007507_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|2007656_2008133_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|2008122_2008413_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|2008578_2008917_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|2009065_2010727_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|2010812_2011691_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|2011813_2012404_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001294020.1|2012438_2013044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|2013164_2014451_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|2014470_2015262_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|2015427_2016789_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|2017041_2017290_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|2017308_2017857_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469804.1|2017901_2018669_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|2018709_2019057_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|2019213_2020434_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212380.1|2020426_2020945_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|2021384_2022455_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_000225194.1|2022464_2023586_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000632386.1|2023643_2024552_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200080.1|2024512_2025673_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|2025772_2025820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|2025923_2026262_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197660.1|2026533_2027271_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|2027402_2028383_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992639.1|2028379_2029111_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235092.1|2029240_2031814_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_000973244.1|2037758_2038196_-	acetyltransferase	NA	NA	NA	NA	NA
WP_001122767.1|2038352_2039282_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_001069371.1|2039550_2041152_+	malate synthase A	NA	NA	NA	NA	NA
WP_000857882.1|2041183_2042488_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_001137266.1|2042589_2044341_+	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_010989091.1|2044304_2044712_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_000226434.1|2044722_2045547_-	glyoxylate bypass operon transcriptional repressor IclR	NA	NA	NA	NA	NA
WP_000095969.1|2045850_2049534_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.7e-26
WP_000956811.1|2049800_2051432_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_000421793.1|2051521_2052211_-	dipeptidase PepE	NA	NA	NA	NA	NA
WP_001541281.1|2052282_2052384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001096724.1|2052418_2052958_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_000954618.1|2053004_2053874_+	23S rRNA pseudouridine(2604) synthase RluF	NA	NA	NA	NA	NA
WP_001207628.1|2053870_2054143_-	DUF3811 domain-containing protein	NA	NA	NA	NA	NA
WP_001068168.1|2054205_2054964_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000924651.1|2054950_2055814_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000472331.1|2055830_2056670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000716849.1|2056693_2058283_-	PTS sugar transporter	NA	NA	NA	NA	NA
WP_001177098.1|2058705_2059221_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	40.7	1.3e-33
WP_000368212.1|2059230_2060712_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.6e-52
WP_000359503.1|2060714_2061347_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_000951728.1|2061339_2062455_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	5.3e-101
WP_001093501.1|2062445_2062805_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000632052.1|2062968_2064516_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	30.4	1.6e-50
WP_000703634.1|2064515_2065445_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_000593184.1|2065441_2065804_-	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_000679396.1|2066127_2066850_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	2.3e-12
WP_000818152.1|2066859_2067903_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	3.2e-76
WP_001269716.1|2067890_2068100_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271429.1|2068099_2069053_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262484.1|2069052_2071407_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.8	2.8e-67
WP_001185656.1|2071503_2071632_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003640.1|2071591_2071909_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907495.1|2071960_2072485_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729849.1|2072484_2073912_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.8e-194
WP_000875314.1|2073901_2074099_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|2074095_2074551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|2074710_2075025_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|2075037_2075643_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|2075645_2075933_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|2076510_2076858_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_000136394.1|2076988_2078338_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000790036.1|2078682_2080332_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001541297.1|2080775_2081018_+	outer membrane protein	NA	NA	NA	NA	NA
WP_122821798.1|2081051_2081720_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000977959.1|2081716_2082454_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000750806.1|2082453_2084550_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000982749.1|2084692_2085103_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001252081.1|2085268_2086159_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000382575.1|2086173_2087718_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_000695415.1|2087849_2089040_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000179176.1|2089401_2090511_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000973678.1|2090599_2091958_+	maltoporin	NA	NA	NA	NA	NA
WP_000782497.1|2092121_2093039_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000019230.1|2093219_2093717_+	chorismate lyase	NA	NA	NA	NA	NA
WP_000455249.1|2093730_2094603_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000017360.1|2094701_2097122_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000002900.1|2097292_2097661_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000646079.1|2097769_2098378_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_001128103.1|2098556_2099882_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_001575282.1|2099878_2099992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030592.1|2100013_2100223_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000416272.1|2100322_2100838_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001039337.1|2101084_2102395_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_001182228.1|2102482_2103481_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP010284	Salmonella enterica subsp. enterica serovar Newport str. CVM N1543 chromosome, complete genome	4827959	3455153	3462467	4827959	protease	Dickeya_phage(16.67%)	7	NA	NA
WP_001201748.1|3455153_3456272_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.8e-08
WP_000125893.1|3456268_3458215_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|3458344_3458566_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|3458889_3459210_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|3459240_3461517_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|3461730_3461928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001670446.1|3462089_3462467_-	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	42.7	5.9e-20
>prophage 7
NZ_CP010284	Salmonella enterica subsp. enterica serovar Newport str. CVM N1543 chromosome, complete genome	4827959	3512818	3653498	4827959	protease,tail,integrase,lysis,plate,tRNA,terminase,holin,portal,capsid	Salmonella_phage(50.98%)	159	3610755:3610814	3652621:3652698
WP_001154027.1|3512818_3513622_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|3513614_3514937_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060024.1|3514917_3515622_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572746.1|3515621_3520088_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925875.1|3520432_3522280_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|3522539_3523088_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|3523115_3523763_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|3523824_3525015_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977709.1|3525199_3526291_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000117870.1|3526897_3528298_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762343.1|3528498_3528960_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544853.1|3529276_3530491_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893197.1|3530736_3532170_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191406.1|3532250_3533453_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|3533647_3534940_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|3534984_3535233_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|3535273_3535513_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|3535555_3536713_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000017133.1|3536675_3539561_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001668146.1|3539687_3539987_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|3540008_3540167_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_014344008.1|3540159_3540420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|3540469_3540880_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|3540999_3541239_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|3541204_3541579_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|3541663_3542647_+	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|3542649_3543399_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|3543409_3543757_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|3543753_3544065_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|3544142_3544433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|3544724_3544958_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|3545069_3545291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|3545373_3545976_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001096552.1|3546184_3546796_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|3546792_3546939_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|3546928_3547726_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|3547792_3548110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|3548283_3548409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|3548544_3548994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|3549354_3550041_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|3550316_3550646_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|3550629_3551082_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|3551099_3551579_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|3551786_3552320_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|3552276_3554415_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|3554411_3554618_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009207.1|3554614_3556162_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_010989008.1|3556085_3558167_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|3558257_3558581_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|3558573_3558873_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|3558853_3559420_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|3559416_3559818_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|3559829_3560579_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|3560624_3561023_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|3561019_3561349_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|3561428_3564416_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|3564412_3564745_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|3564843_3565341_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|3565457_3565991_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|3566080_3566776_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|3566785_3567523_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|3567420_3568125_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_001541993.1|3570671_3571547_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_000178849.1|3571585_3571828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144679.1|3571881_3574320_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000143167.1|3574319_3574901_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001526469.1|3575376_3576345_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	100.0	7.1e-195
WP_000334547.1|3576992_3577619_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|3577687_3577987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|3577971_3578658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|3578928_3579120_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193770.1|3579546_3582159_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	4.8e-20
WP_000291723.1|3582366_3583377_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001670452.1|3583542_3584085_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224072.1|3584081_3585191_-	YcbX family protein	NA	NA	NA	NA	NA
WP_001086485.1|3585289_3587398_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|3587410_3589318_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333152.1|3589332_3590586_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433416.1|3590590_3592231_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|3592227_3592791_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|3593046_3593214_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|3593313_3593832_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156448.1|3593900_3595661_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|3595846_3596299_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001670727.1|3596370_3597423_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|3597779_3598289_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|3598505_3599111_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950876.1|3599097_3601251_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|3601269_3601716_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420513.1|3601839_3603894_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	1.1e-19
WP_000424187.1|3603929_3604388_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847732.1|3604482_3605145_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|3605318_3605732_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|3605776_3606094_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140482.1|3606151_3607363_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859429.1|3607577_3608126_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548080.1|3608151_3608931_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|3608979_3609261_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|3609257_3609587_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|3609673_3610333_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
3610755:3610814	attL	CCGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCC	NA	NA	NA	NA
WP_000533596.1|3610920_3611940_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.5	1.2e-91
WP_000196402.1|3611940_3612165_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000916251.1|3612377_3612560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000205292.1|3612562_3613117_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	59.3	1.3e-47
WP_000158391.1|3613113_3615378_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.7	1.5e-102
WP_001192832.1|3615407_3615653_-	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	53.8	3.5e-13
WP_000387662.1|3615660_3615984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023972394.1|3616668_3617124_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	51.7	4.6e-35
WP_001643782.1|3617529_3617976_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	50.4	5.5e-25
WP_001195066.1|3617998_3618223_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	44.7	1.0e-08
WP_000063056.1|3618225_3619206_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	80.6	2.3e-44
WP_000074839.1|3619202_3620591_+	DNA helicase	NA	Q76H51	Enterobacteria_phage	47.1	1.2e-105
WP_000130738.1|3620628_3621309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000918617.1|3621312_3621561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001037052.1|3621553_3622156_+	adenine methylase	NA	G9L699	Escherichia_phage	87.3	1.7e-98
WP_000180135.1|3622152_3622323_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	87.5	6.3e-06
WP_001129735.1|3622322_3622661_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	86.6	3.7e-50
WP_000474096.1|3622844_3623036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000090037.1|3623104_3623701_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	73.7	1.5e-81
WP_000717784.1|3623697_3623991_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	65.3	2.1e-33
WP_000640103.1|3623987_3624566_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.0	2.4e-44
WP_000658037.1|3624958_3625147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001525456.1|3625349_3625652_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000951228.1|3625629_3626169_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	74.1	4.0e-78
WP_086374239.1|3626486_3626942_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	76.8	1.3e-53
WP_001118126.1|3627442_3628072_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.1	1.5e-108
WP_001130808.1|3628074_3629697_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	99.4	0.0e+00
WP_000113503.1|3629696_3631166_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.3e-280
WP_137911068.1|3631050_3631797_+|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	91.2	3.1e-97
WP_000873181.1|3631800_3633033_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.3	3.7e-228
WP_000128057.1|3633037_3633535_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000627463.1|3633546_3634488_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	99.7	3.1e-179
WP_001040693.1|3634529_3634919_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	62.0	4.0e-32
WP_001125672.1|3634884_3635292_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	96.3	3.0e-70
WP_000008738.1|3635288_3635843_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	99.5	1.4e-94
WP_001121925.1|3635829_3636219_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	2.1e-68
WP_001670724.1|3636193_3636757_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	78.7	2.1e-82
WP_001135539.1|3636760_3637906_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.3	1.2e-164
WP_000535992.1|3637918_3638362_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.5	1.0e-55
WP_000389049.1|3638365_3638818_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	78.7	1.3e-61
WP_000990866.1|3638995_3641005_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	95.2	0.0e+00
WP_000353826.1|3641004_3641580_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	100.0	2.4e-97
WP_000155111.1|3641579_3641882_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	100.0	4.2e-53
WP_000081749.1|3641884_3642952_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	91.5	2.0e-174
WP_000819157.1|3642948_3643281_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	69.1	1.7e-23
WP_000931859.1|3643364_3643820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000301078.1|3643938_3644691_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	69.8	9.7e-91
WP_001270641.1|3644690_3645044_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	95.7	3.0e-58
WP_001197089.1|3645044_3646244_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	96.7	5.5e-213
WP_000049939.1|3646240_3646921_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	96.0	5.5e-125
WP_001670454.1|3646920_3648453_+	hypothetical protein	NA	S4TP62	Salmonella_phage	66.2	1.4e-128
WP_000421108.1|3648467_3648986_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	53.8	2.0e-47
WP_071786695.1|3649234_3649420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370530.1|3649482_3650091_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	44.7	1.1e-31
WP_000033280.1|3650200_3650593_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	37.4	8.5e-14
WP_127913510.1|3650790_3651036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001670723.1|3651218_3651416_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	97.0	1.4e-09
WP_000503667.1|3651458_3652106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938182.1|3652817_3653498_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	9.8e-82
3652621:3652698	attR	CCGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAGATTAAACAAGGGGTTA	NA	NA	NA	NA
>prophage 8
NZ_CP010284	Salmonella enterica subsp. enterica serovar Newport str. CVM N1543 chromosome, complete genome	4827959	4553515	4560766	4827959		Morganella_phage(33.33%)	8	NA	NA
WP_001157313.1|4553515_4554946_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377036.1|4555019_4555715_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	2.8e-07
WP_000107431.1|4555794_4556106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080660.1|4556755_4557952_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_024131109.1|4558209_4558398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|4558408_4558621_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457658.1|4559075_4560344_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.4e-227
WP_000394197.1|4560346_4560766_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 9
NZ_CP010284	Salmonella enterica subsp. enterica serovar Newport str. CVM N1543 chromosome, complete genome	4827959	4657297	4667804	4827959		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126351.1|4657297_4658611_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	9.1e-52
WP_000565902.1|4658637_4659717_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
WP_000648783.1|4659721_4660495_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018224.1|4660510_4661485_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973714.1|4661490_4662042_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
WP_000857530.1|4662042_4662921_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
WP_001023659.1|4662968_4663868_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697840.1|4663867_4664953_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981471.1|4665329_4666223_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111837.1|4666400_4667804_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
>prophage 10
NZ_CP010284	Salmonella enterica subsp. enterica serovar Newport str. CVM N1543 chromosome, complete genome	4827959	4735895	4745066	4827959	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195330.1|4735895_4737929_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|4738169_4738628_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|4738799_4739330_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|4739386_4739854_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|4739900_4740620_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|4740616_4742302_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240417.1|4742524_4743256_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|4743315_4743423_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|4743403_4744135_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569168.1|4744118_4745066_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
