The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007598	Salmonella enterica subsp. enterica serovar Enteritidis str. 77-1427 chromosome, complete genome	4679081	2546103	2553416	4679081	integrase,protease	Dickeya_phage(16.67%)	7	2534841:2534855	2553634:2553648
2534841:2534855	attL	AGCCTGCGAGGAGAC	NA	NA	NA	NA
WP_001201751.1|2546103_2547222_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125875.1|2547218_2549165_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|2549294_2549516_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|2549839_2550160_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934059.1|2550190_2552467_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	1.4e-164
WP_001117984.1|2552679_2552877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539594.1|2553038_2553416_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
2553634:2553648	attR	GTCTCCTCGCAGGCT	NA	NA	NA	NA
>prophage 2
NZ_CP007598	Salmonella enterica subsp. enterica serovar Enteritidis str. 77-1427 chromosome, complete genome	4679081	2625126	2635920	4679081	tail	Escherichia_phage(37.5%)	9	NA	NA
WP_000274547.1|2625126_2625756_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_000729406.1|2625739_2626366_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000583382.1|2626362_2628072_+|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000143167.1|2628071_2628653_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001674638.1|2629130_2630099_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000334547.1|2630746_2631373_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001525490.1|2631732_2632419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|2632689_2632881_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193790.1|2633307_2635920_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
>prophage 3
NZ_CP007598	Salmonella enterica subsp. enterica serovar Enteritidis str. 77-1427 chromosome, complete genome	4679081	2837785	2850396	4679081	integrase,lysis,holin,tail	Salmonella_phage(33.33%)	15	2837621:2837650	2857242:2857271
2837621:2837650	attL	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
WP_000087636.1|2837785_2838865_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
WP_001575998.1|2838839_2839118_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_001237395.1|2839531_2841511_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_000911593.1|2842199_2842448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000940753.1|2842511_2843111_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000784710.1|2843107_2843335_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_001097218.1|2843464_2844154_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_001574213.1|2844250_2844775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798708.1|2845148_2845598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001574215.1|2845958_2846645_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_001574216.1|2846920_2847250_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|2847233_2847686_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|2847703_2848183_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000877926.1|2849077_2849611_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|2849700_2850396_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
2857242:2857271	attR	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
>prophage 4
NZ_CP007598	Salmonella enterica subsp. enterica serovar Enteritidis str. 77-1427 chromosome, complete genome	4679081	3077873	3092149	4679081	tRNA,holin	Escherichia_phage(66.67%)	19	NA	NA
WP_000123686.1|3077873_3079247_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
WP_001156217.1|3079290_3080226_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_001676915.1|3080542_3081160_-	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_000800272.1|3081187_3081505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|3081589_3081811_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000004762.1|3082248_3082770_+	super-infection exclusion protein B	NA	NA	NA	NA	NA
WP_085981757.1|3082877_3083033_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_001227859.1|3083417_3083885_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_001676916.1|3084157_3084487_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001033796.1|3084648_3085203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000556389.1|3085199_3086132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000882662.1|3086501_3086714_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000734094.1|3087004_3087175_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	61.8	8.5e-11
WP_000940751.1|3087237_3087837_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000774470.1|3087836_3088127_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000640113.1|3088123_3088660_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_001688615.1|3091147_3091336_+	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000445513.1|3091325_3091607_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_000802786.1|3091603_3092149_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
>prophage 5
NZ_CP007598	Salmonella enterica subsp. enterica serovar Enteritidis str. 77-1427 chromosome, complete genome	4679081	3745726	3756230	4679081		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|3745726_3747040_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565913.1|3747066_3748146_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000648783.1|3748150_3748924_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018223.1|3748939_3749914_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973709.1|3749919_3750471_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000857535.1|3750471_3751350_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_001023658.1|3751397_3752297_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697848.1|3752296_3753382_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|3753755_3754649_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001144948.1|3754826_3756230_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
>prophage 6
NZ_CP007598	Salmonella enterica subsp. enterica serovar Enteritidis str. 77-1427 chromosome, complete genome	4679081	3823427	3832598	4679081	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195340.1|3823427_3825461_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703145.1|3825701_3826160_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_001197951.1|3826331_3826862_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950414.1|3826918_3827386_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_000598637.1|3827432_3828152_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|3828148_3829834_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240421.1|3830056_3830788_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
WP_001261696.1|3830847_3830955_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|3830935_3831667_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569168.1|3831650_3832598_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
>prophage 7
NZ_CP007598	Salmonella enterica subsp. enterica serovar Enteritidis str. 77-1427 chromosome, complete genome	4679081	4069032	4075099	4679081		Salmonella_virus(50.0%)	6	NA	NA
WP_000377779.1|4069032_4069974_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
WP_001576268.1|4071216_4071606_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000703599.1|4071574_4071829_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_000400616.1|4071846_4073769_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_105789228.1|4074758_4074902_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_115367774.1|4074946_4075099_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	68.6	4.6e-08
>prophage 8
NZ_CP007598	Salmonella enterica subsp. enterica serovar Enteritidis str. 77-1427 chromosome, complete genome	4679081	4304485	4404431	4679081	capsid,tRNA,integrase,lysis,portal,transposase,terminase,head,tail,plate	Salmonella_phage(76.36%)	91	4322855:4322869	4403336:4403350
WP_000083345.1|4304485_4305223_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|4305352_4306687_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001675040.1|4306704_4307604_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188410.1|4307706_4308294_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|4308355_4308739_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|4309057_4309747_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|4309862_4310900_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098733.1|4311103_4311523_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	39.0	5.9e-13
WP_000183642.1|4311595_4312276_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_000082648.1|4312329_4314990_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949286.1|4315104_4316460_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264473.1|4316504_4316828_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807815.1|4316824_4318126_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.6	1.8e-44
WP_000985655.1|4318229_4318685_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	49.3	3.9e-34
4322855:4322869	attL	TTTGAGTTCCCGGCC	NA	NA	NA	NA
WP_001235093.1|4324461_4327035_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.0e-127
WP_000992636.1|4327164_4327896_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|4327892_4328873_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|4329004_4329742_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|4330013_4330352_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|4330455_4330503_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200077.1|4330602_4331763_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210984.1|4331723_4332632_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225188.1|4332689_4333811_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|4333820_4334891_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|4335330_4335849_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|4335841_4337062_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|4337218_4337566_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|4337606_4338374_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|4338418_4338967_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|4338985_4339234_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|4339486_4340848_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|4341013_4341805_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|4341824_4343111_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287926.1|4343231_4343837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|4343871_4344462_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059151.1|4344585_4345464_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|4345549_4347211_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|4347359_4347698_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|4347863_4348154_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|4348143_4348620_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|4348769_4349252_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237694.1|4349866_4361341_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533863.1|4361405_4362815_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196151.1|4362811_4364992_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_012543392.1|4364999_4366163_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000980500.1|4366714_4366933_-	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_001102269.1|4367001_4368102_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980411.1|4368098_4368584_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
WP_001282768.1|4368580_4371388_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.9	0.0e+00
WP_000763316.1|4371380_4371500_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001280963.1|4371514_4371817_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	100.0	1.5e-45
WP_001207651.1|4371871_4372387_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_000046107.1|4372396_4373569_-|tail	phage tail sheath protein	tail	E5G6P7	Salmonella_phage	99.7	5.7e-223
WP_000974843.1|4373671_4373896_-	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_000143187.1|4374765_4375341_-|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_001274649.1|4375340_4377194_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	100.0	0.0e+00
WP_001086804.1|4377190_4377796_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_000268332.1|4377788_4378697_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_000189373.1|4378683_4379043_-	GPW/gp25 family protein	NA	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_001672413.1|4379039_4379618_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000958562.1|4379695_4380547_+	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_000343949.1|4380548_4380995_-	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
WP_001039958.1|4380987_4381419_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_000196199.1|4381514_4381943_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_001069923.1|4381939_4382455_-	lysozyme	NA	E5G6N1	Salmonella_phage	100.0	5.3e-96
WP_000171565.1|4382435_4382651_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868184.1|4382654_4382858_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000673537.1|4382857_4383322_-|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	100.0	9.9e-86
WP_000059173.1|4383415_4384066_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000730760.1|4384069_4385131_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	99.7	6.0e-195
WP_000216276.1|4385147_4385981_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_001098395.1|4386123_4387890_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_001542203.1|4387889_4388930_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_001284991.1|4389033_4390698_-	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_001673609.1|4391011_4391689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217571.1|4391802_4392036_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	1.8e-35
WP_001154433.1|4392046_4392235_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_000017507.1|4392387_4394802_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	100.0	0.0e+00
WP_000104187.1|4394798_4395656_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	100.0	6.8e-165
WP_000752613.1|4395652_4395880_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244219.1|4395879_4396113_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	100.0	1.7e-33
WP_000963474.1|4396180_4396522_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	100.0	1.2e-56
WP_000956190.1|4396485_4396686_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_000460848.1|4396693_4397203_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	100.0	1.5e-87
WP_000102105.1|4397236_4397479_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000932273.1|4397600_4398233_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_000218402.1|4398235_4399252_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	100.0	5.0e-199
WP_000360326.1|4399804_4400467_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	100.0	3.4e-124
WP_001142974.1|4400728_4401322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000445376.1|4401720_4402524_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
WP_089113803.1|4403319_4404431_-|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
4403336:4403350	attR	TTTGAGTTCCCGGCC	NA	NA	NA	NA
