The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007727	Klebsiella pneumoniae subsp. pneumoniae KPNIH10 chromosome, complete genome	5395263	590779	596604	5395263		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152202.1|590779_591346_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|591363_591609_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152204.1|591605_592343_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_000556592.1|592903_593170_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_072093163.1|593172_593715_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152205.1|593711_593939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152206.1|593935_594256_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152207.1|594270_596604_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
>prophage 2
NZ_CP007727	Klebsiella pneumoniae subsp. pneumoniae KPNIH10 chromosome, complete genome	5395263	1064850	1076504	5395263	integrase	Enterobacteria_phage(70.0%)	15	1052984:1052998	1076041:1076055
1052984:1052998	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_002889890.1|1064850_1067184_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
WP_002889897.1|1067195_1067516_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004219964.1|1067512_1067692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072028197.1|1067736_1068288_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889915.1|1068290_1068557_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_004903606.1|1068661_1068799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889917.1|1069098_1069836_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889919.1|1069832_1070078_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889930.1|1070095_1070662_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_020802988.1|1070734_1070884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152979.1|1071230_1071656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152029.1|1071655_1072606_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889938.1|1072593_1073784_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_002889940.1|1074136_1075390_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_004144574.1|1075400_1076504_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
1076041:1076055	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
>prophage 3
NZ_CP007727	Klebsiella pneumoniae subsp. pneumoniae KPNIH10 chromosome, complete genome	5395263	1286059	1331334	5395263	integrase,tRNA,lysis,head	Escherichia_phage(26.42%)	65	1288942:1288988	1338076:1338122
WP_004143010.1|1286059_1287445_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|1287490_1287703_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|1287704_1288571_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
1288942:1288988	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
WP_004151318.1|1289001_1290165_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
WP_004151317.1|1290041_1290377_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151316.1|1290378_1290594_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151314.1|1290595_1290814_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151312.1|1290810_1291578_-	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151310.1|1291574_1292231_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151308.1|1292227_1292386_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151306.1|1292382_1293063_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151305.1|1293059_1293905_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151304.1|1293920_1294205_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151303.1|1294293_1294488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151302.1|1294480_1294591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151301.1|1294587_1294803_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151300.1|1295153_1295843_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151299.1|1295970_1296204_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_001548453.1|1296244_1296466_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151298.1|1296551_1296698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004230546.1|1296738_1297590_+	hypothetical protein	NA	F1C5C3	Cronobacter_phage	56.3	5.3e-85
WP_004230547.1|1297594_1299010_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.1	1.8e-183
WP_004151295.1|1299009_1299303_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151294.1|1299299_1299806_+	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151293.1|1299912_1300755_+	translation repressor RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151291.1|1300927_1301575_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151288.1|1302075_1302531_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151287.1|1302530_1302701_+	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151286.1|1302693_1303329_+	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151285.1|1303325_1303463_+	YlcG family protein	NA	NA	NA	NA	NA
WP_004151284.1|1303455_1303986_+	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151283.1|1303982_1304672_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151282.1|1305581_1305830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151281.1|1305832_1306363_+	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151280.1|1306359_1306824_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151279.1|1306929_1307259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151277.1|1307629_1308232_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151276.1|1308231_1309704_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151275.1|1309716_1311138_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151274.1|1311112_1312117_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151273.1|1312158_1312635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151272.1|1312707_1314093_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151271.1|1314096_1314525_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151270.1|1314536_1315631_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151269.1|1315641_1315881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151268.1|1315883_1316264_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151267.1|1316263_1316437_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151266.1|1316436_1316799_+	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151265.1|1316801_1317227_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151264.1|1317223_1317616_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151263.1|1317684_1318437_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151262.1|1318489_1319167_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151261.1|1319342_1320098_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151260.1|1320100_1320355_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151259.1|1320648_1321119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151258.1|1321135_1321495_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151257.1|1321594_1321765_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151256.1|1321754_1322468_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151255.1|1322533_1323319_+	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151254.1|1323446_1323950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151253.1|1324042_1327489_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004151252.1|1327531_1328008_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.7	3.0e-37
WP_004199076.1|1328007_1328478_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004151250.1|1328474_1328870_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004151249.1|1328856_1331334_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
1338076:1338122	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 4
NZ_CP007727	Klebsiella pneumoniae subsp. pneumoniae KPNIH10 chromosome, complete genome	5395263	1776443	1813779	5395263	capsid,tail,integrase,portal,lysis,plate,head,terminase	Salmonella_phage(85.0%)	48	1776351:1776369	1813851:1813869
1776351:1776369	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_014342959.1|1776443_1777424_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
WP_004178082.1|1777911_1779399_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004150866.1|1779497_1780442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|1780453_1781332_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_000188448.1|1781477_1781699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|1781731_1782241_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956179.1|1782248_1782449_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000963473.1|1782412_1782754_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_004150864.1|1782821_1783055_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000752622.1|1783054_1783282_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150863.1|1783278_1784136_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_004150862.1|1784132_1786547_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001154434.1|1786700_1786889_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|1786899_1787133_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|1787247_1787925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199124.1|1788200_1789943_+	AIPR family protein	NA	NA	NA	NA	NA
WP_002895959.1|1790004_1791030_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004150858.1|1791029_1792796_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895967.1|1792938_1793772_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_002895972.1|1793788_1794847_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|1794850_1795501_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|1795596_1796061_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_002896155.1|1796060_1796264_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896158.1|1796267_1796483_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896161.1|1796463_1796973_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896163.1|1796977_1797361_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896168.1|1797357_1797786_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896170.1|1797772_1797919_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896172.1|1797881_1798313_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896175.1|1798305_1798752_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_004199112.1|1798748_1799258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004226282.1|1799256_1799421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896177.1|1799535_1800108_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_002896179.1|1800104_1800467_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896182.1|1800453_1801362_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_004150856.1|1801354_1801954_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_004152882.1|1801955_1804907_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_002896186.1|1804910_1805642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004232615.1|1805680_1805842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896191.1|1805871_1806948_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896193.1|1807086_1808259_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|1808268_1808784_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896204.1|1808836_1809136_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896220.1|1809150_1809270_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_014342962.1|1809496_1811890_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.0	1.1e-106
WP_002896224.1|1811886_1812372_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896225.1|1812368_1813469_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_000972391.1|1813560_1813779_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
1813851:1813869	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 5
NZ_CP007727	Klebsiella pneumoniae subsp. pneumoniae KPNIH10 chromosome, complete genome	5395263	1848195	1857659	5395263	tRNA,protease	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|1848195_1849311_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|1849307_1851248_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|1851324_1851546_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|1851871_1852189_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|1852219_1854499_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|1854619_1854838_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004141853.1|1855191_1855911_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004150847.1|1855937_1857659_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 6
NZ_CP007727	Klebsiella pneumoniae subsp. pneumoniae KPNIH10 chromosome, complete genome	5395263	2223730	2278526	5395263	integrase,transposase,protease	Klebsiella_phage(23.08%)	52	2264923:2264982	2270834:2271491
WP_002901758.1|2223730_2224777_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_002901761.1|2224824_2225076_-	YciN family protein	NA	NA	NA	NA	NA
WP_002901763.1|2225482_2228080_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
WP_002901772.1|2228425_2229400_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_002901776.1|2229645_2229813_+	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_002901777.1|2230201_2232874_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_002901778.1|2232920_2233523_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
WP_002901779.1|2233686_2234454_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_002901780.1|2234589_2234898_+	LapA family protein	NA	NA	NA	NA	NA
WP_002901781.1|2234904_2236074_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_004151907.1|2236265_2237003_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_002901782.1|2237002_2237329_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_002901783.1|2237460_2237679_-	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_004225185.1|2237763_2237883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002901785.1|2237954_2238704_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_004140283.1|2238775_2239033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002901787.1|2239113_2241048_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
WP_004151905.1|2241129_2242287_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004151904.1|2242477_2243266_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_004152967.1|2243464_2244007_-	HutD family protein	NA	NA	NA	NA	NA
WP_004151902.1|2244254_2245634_+	cytosine permease	NA	NA	NA	NA	NA
WP_004140269.1|2245678_2246488_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|2246489_2247482_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|2247481_2248372_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004151900.1|2248518_2249736_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	8.6e-121
WP_004151899.1|2249943_2250606_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004151898.1|2250602_2251031_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_074401227.1|2251027_2251534_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.5	9.5e-82
WP_000019473.1|2251559_2252540_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152648.1|2252730_2253066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152649.1|2253380_2253845_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
WP_004152650.1|2254025_2254508_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
WP_004152651.1|2254517_2254898_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_004152652.1|2254894_2257963_+	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_022644627.1|2258039_2260994_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
WP_004152700.1|2260997_2261729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152702.1|2261953_2262553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152703.1|2262794_2264738_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
2264923:2264982	attL	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067855.1|2264986_2265691_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_015057121.1|2265581_2266541_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_001261740.1|2266686_2267478_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|2267641_2267989_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|2267982_2268822_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|2268949_2269450_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|2269956_2270721_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|2270897_2271602_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
2270834:2271491	attR	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACC	NA	NA	NA	NA
WP_004152776.1|2272194_2272617_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_004178082.1|2273511_2274999_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002901812.1|2275078_2275498_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_002901813.1|2275499_2276765_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_071531199.1|2276840_2277668_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901815.1|2277854_2278526_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
>prophage 7
NZ_CP007727	Klebsiella pneumoniae subsp. pneumoniae KPNIH10 chromosome, complete genome	5395263	2311459	2354507	5395263	integrase,transposase,terminase	Klebsiella_phage(33.33%)	63	2309540:2309554	2318480:2318494
2309540:2309554	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_004152144.1|2311459_2312221_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|2312437_2313970_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|2314168_2314717_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|2314913_2316095_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|2316075_2316318_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004198245.1|2316277_2316424_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_014343018.1|2316496_2316730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218013.1|2316972_2317086_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	100.0	4.6e-13
WP_004152151.1|2317181_2317406_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|2317395_2318106_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|2318111_2318630_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
2318480:2318494	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_004152154.1|2318734_2319562_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|2319558_2319753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|2319749_2320175_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004146412.1|2320171_2320294_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
WP_004152157.1|2320361_2320616_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004218017.1|2320608_2320770_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	96.2	1.5e-20
WP_004152159.1|2321143_2321332_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|2321324_2321639_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|2321809_2322478_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|2322575_2322797_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|2323373_2325032_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004218023.1|2325018_2325996_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|2325992_2326469_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|2326465_2327248_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004152168.1|2327314_2327470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218026.1|2327507_2327636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004146526.1|2327653_2327902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152169.1|2327904_2328435_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|2328431_2328821_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|2329055_2329376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218030.1|2329741_2330230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152172.1|2330180_2331581_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152173.1|2331818_2333270_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152174.1|2333325_2333874_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|2333925_2335128_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|2335131_2335626_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_001132269.1|2335637_2336579_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000725700.1|2336618_2336900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|2336868_2337288_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|2337284_2337791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|2337790_2338177_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|2338271_2338712_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|2338715_2339861_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152178.1|2339871_2340162_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_085955245.1|2340102_2341295_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152564.1|2341621_2342047_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|2342082_2342235_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|2342224_2344228_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004225238.1|2344413_2344827_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.9	8.1e-31
WP_004217362.1|2344902_2345130_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004152569.1|2345132_2346155_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152570.1|2346154_2346496_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004173705.1|2346548_2346734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004225248.1|2346986_2347337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|2347390_2348044_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|2348045_2348399_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|2348398_2349595_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152575.1|2349591_2350365_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004231600.1|2350839_2351004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004231602.1|2351124_2351256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152577.1|2351230_2351428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343022.1|2351483_2354507_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	44.7	1.6e-22
>prophage 8
NZ_CP007727	Klebsiella pneumoniae subsp. pneumoniae KPNIH10 chromosome, complete genome	5395263	2577793	2587207	5395263		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|2577793_2578414_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|2578406_2579672_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_004151610.1|2579683_2580586_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|2580846_2581608_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|2581628_2582489_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002904006.1|2582786_2583047_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|2583133_2584222_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004151612.1|2584252_2585518_-	MFS transporter	NA	NA	NA	NA	NA
WP_160463746.1|2585572_2587207_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.8	3.1e-182
>prophage 9
NZ_CP007727	Klebsiella pneumoniae subsp. pneumoniae KPNIH10 chromosome, complete genome	5395263	3245666	3288767	5395263	plate,tRNA,transposase	Microcystis_virus(37.5%)	41	NA	NA
WP_002910404.1|3245666_3246923_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002910405.1|3247193_3247805_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_004217879.1|3247804_3248653_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|3248836_3249784_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004152259.1|3249908_3251588_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	7.9e-24
WP_002910436.1|3251588_3252635_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|3252857_3253133_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_002910438.1|3253405_3253990_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|3254107_3255199_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_002910446.1|3255281_3255491_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|3255692_3256607_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152260.1|3256738_3258154_-	membrane protein	NA	NA	NA	NA	NA
WP_004152261.1|3258173_3258617_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002910493.1|3258619_3259156_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004152910.1|3259136_3260153_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002910495.1|3260182_3261946_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004152262.1|3262079_3265490_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004198077.1|3265473_3266631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|3266634_3266901_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_072093174.1|3267198_3267384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072093175.1|3267644_3267779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|3268004_3268985_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152632.1|3269321_3270212_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_004217421.1|3270387_3271161_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	28.1	1.2e-11
WP_038435084.1|3271302_3271431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152633.1|3271456_3272350_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_004217423.1|3272371_3272488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910544.1|3272533_3273427_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_004199323.1|3273448_3273760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004227470.1|3273800_3274889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|3275270_3275777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|3275773_3276103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199326.1|3276099_3276282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644641.1|3276423_3277392_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	6.5e-180
WP_002910586.1|3278997_3279507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|3279743_3280250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|3280246_3280756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152319.1|3280756_3282112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152317.1|3285075_3286773_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004152316.1|3286776_3287430_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002910645.1|3287426_3288767_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 10
NZ_CP007727	Klebsiella pneumoniae subsp. pneumoniae KPNIH10 chromosome, complete genome	5395263	3546916	3554541	5395263		Escherichia_phage(28.57%)	7	NA	NA
WP_004152482.1|3546916_3547918_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
WP_004152483.1|3548111_3549278_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004152484.1|3549458_3550013_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
WP_004152485.1|3550027_3550918_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
WP_004152486.1|3550949_3551819_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
WP_004152487.1|3551845_3552910_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
WP_004152488.1|3553134_3554541_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 11
NZ_CP007727	Klebsiella pneumoniae subsp. pneumoniae KPNIH10 chromosome, complete genome	5395263	3591108	3598015	5395263	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004151135.1|3591108_3592587_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
WP_002912634.1|3592583_3593306_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_002912635.1|3593624_3594986_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_004151134.1|3595228_3596125_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912638.1|3596367_3597141_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_004175147.1|3597151_3598015_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 12
NZ_CP007727	Klebsiella pneumoniae subsp. pneumoniae KPNIH10 chromosome, complete genome	5395263	3897797	3971454	5395263	capsid,tail,protease,integrase,transposase,tRNA,holin,terminase	Salmonella_phage(40.43%)	79	3903439:3903456	3970443:3970460
WP_004152006.1|3897797_3899801_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_002913800.1|3899810_3900686_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_002913801.1|3900805_3901519_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
WP_002913802.1|3901734_3902769_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_002913803.1|3902785_3903664_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
3903439:3903456	attL	CAGCGATAACCGGAATAC	NA	NA	NA	NA
WP_002913804.1|3903817_3904384_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_002913805.1|3904387_3904858_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_002913806.1|3904919_3905981_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_004221267.1|3906035_3906152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002913807.1|3906203_3907667_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_002913810.1|3907676_3908036_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_002913812.1|3908163_3909075_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
WP_020947395.1|3909071_3909773_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913824.1|3909871_3911158_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_002913827.1|3911253_3911880_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002913829.1|3912097_3913531_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002913833.1|3913540_3914434_-	ROK family protein	NA	NA	NA	NA	NA
WP_002913836.1|3914697_3915735_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_004152007.1|3915731_3916373_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
WP_002913838.1|3916553_3918614_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_002913839.1|3918617_3920150_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002913841.1|3920203_3922432_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_004174861.1|3922802_3922976_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	78.8	1.4e-16
WP_004221278.1|3923072_3923984_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002913847.1|3924057_3925290_+	MFS transporter	NA	NA	NA	NA	NA
WP_004162150.1|3925583_3926762_+	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_004152009.1|3926745_3928614_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_004152707.1|3928833_3929316_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
WP_004152706.1|3929312_3929942_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
WP_004146393.1|3929931_3930237_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
WP_004146394.1|3930223_3930628_-	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_004221284.1|3930912_3933282_-|tail	phage tail fibers	tail	A0A2H5BN49	Klebsiella_phage	79.5	9.1e-268
WP_004152453.1|3933820_3934078_+	DUF1902 domain-containing protein	NA	A0A0M4R2Z9	Salmonella_phage	54.1	2.3e-12
WP_004152454.1|3934081_3934279_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	69.8	2.0e-19
WP_157833602.1|3934387_3934576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152455.1|3934659_3935355_+	hypothetical protein	NA	A0A193GYJ9	Enterobacter_phage	52.7	4.4e-61
WP_004152456.1|3935545_3935728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152457.1|3935732_3936131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152458.1|3936405_3937020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152459.1|3937029_3940419_-	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	6.3e-121
WP_004152460.1|3940418_3943163_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.2	9.1e-94
WP_004152461.1|3943175_3943673_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	40.5	5.7e-23
WP_004152462.1|3943665_3944136_-	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	7.3e-44
WP_004152463.1|3944137_3946615_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.5	3.6e-267
WP_004153043.1|3946614_3947226_-	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	1.2e-46
WP_004152465.1|3947274_3947553_-	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	6.7e-21
WP_004152466.1|3947545_3947938_-	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_004152467.1|3947947_3948955_-|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.5	2.7e-181
WP_004152468.1|3948967_3949366_-	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
WP_004152470.1|3949647_3949953_-	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_004152471.1|3949949_3951629_-|tail	tail protein	tail	T1S9Z7	Salmonella_phage	58.9	3.4e-192
WP_004152472.1|3951632_3951836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152473.1|3952541_3953063_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	55.2	7.8e-47
WP_004164044.1|3953106_3954582_-	hypothetical protein	NA	Q858H3	Salmonella_phage	92.9	1.9e-279
WP_004152523.1|3954578_3955163_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_004152524.1|3955240_3955498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152525.1|3955572_3955911_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152526.1|3955910_3956150_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152527.1|3956142_3956811_-	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004141386.1|3956807_3957020_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152529.1|3957190_3957934_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
WP_004152530.1|3957930_3958356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152531.1|3958352_3958544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152532.1|3958527_3958938_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152534.1|3959130_3959478_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152535.1|3959597_3960383_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_038431191.1|3961144_3961369_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.5	1.4e-24
WP_004152538.1|3961502_3961736_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_158423316.1|3962901_3963114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152542.1|3964049_3965072_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
WP_004152543.1|3965123_3965372_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
WP_004153052.1|3965481_3965775_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004152545.1|3965767_3965926_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_004152546.1|3965922_3966516_+	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
WP_004152547.1|3966512_3966695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152548.1|3966691_3966883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152549.1|3966899_3968150_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	1.4e-206
WP_004151979.1|3968342_3969920_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004151980.1|3969987_3971454_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
3970443:3970460	attR	CAGCGATAACCGGAATAC	NA	NA	NA	NA
>prophage 13
NZ_CP007727	Klebsiella pneumoniae subsp. pneumoniae KPNIH10 chromosome, complete genome	5395263	4042804	4122414	5395263	capsid,tail,integrase,portal,lysis,head,plate,tRNA,coat,terminase	Salmonella_phage(72.0%)	89	4087508:4087554	4124075:4124121
WP_002914079.1|4042804_4043542_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|4043673_4045005_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914084.1|4045050_4045434_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|4045747_4046437_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|4046494_4047580_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|4047783_4048209_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|4048278_4048977_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_004151994.1|4049011_4051672_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914094.1|4051792_4053148_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002914095.1|4053189_4053513_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002914097.1|4053516_4054815_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_004150973.1|4060780_4063354_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914109.1|4063483_4064215_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|4064211_4065192_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|4065323_4066061_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|4066331_4066667_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|4066773_4066821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150975.1|4066921_4068082_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002914112.1|4068078_4068951_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|4069013_4070135_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|4070144_4071215_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|4071557_4072067_+	YfiR family protein	NA	NA	NA	NA	NA
WP_004150976.1|4072059_4073283_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_002914117.1|4073296_4073779_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002914118.1|4073787_4075158_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|4075214_4075673_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_004220183.1|4075662_4075800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002914145.1|4075792_4076140_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|4076179_4076947_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|4076978_4077527_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|4077545_4077794_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|4078053_4079418_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|4079581_4080373_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|4080392_4081679_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|4081798_4082389_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|4082513_4083392_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914159.1|4083478_4085140_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_004145681.1|4085165_4085306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002914160.1|4085287_4085629_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914161.1|4085695_4085986_-	RnfH family protein	NA	NA	NA	NA	NA
WP_004188817.1|4085975_4086452_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|4086562_4087045_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
4087508:4087554	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_004150980.1|4087648_4088026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150981.1|4088053_4088272_-	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150982.1|4088338_4089433_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150983.1|4089429_4089915_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_072093161.1|4089911_4092308_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.5	8.1e-107
WP_002896220.1|4092534_4092654_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150985.1|4092668_4092968_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_004150986.1|4093020_4093536_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150987.1|4093545_4094718_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150988.1|4094866_4095940_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150989.1|4095991_4097110_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150990.1|4097119_4099069_-|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004152935.1|4099070_4099742_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150992.1|4099734_4100643_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004150993.1|4100629_4100992_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150994.1|4100988_4101561_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150995.1|4101655_4102522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150996.1|4102544_4102991_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150997.1|4102983_4103406_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_072093160.1|4103368_4103527_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150998.1|4103501_4103930_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150999.1|4103926_4104310_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004151000.1|4104314_4104824_-	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004134639.1|4104804_4105020_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151001.1|4105023_4105227_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004151002.1|4105226_4105691_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004134644.1|4105786_4106440_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151003.1|4106443_4107496_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004151004.1|4107512_4108346_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_019405037.1|4108486_4110250_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151006.1|4110249_4111293_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_024940854.1|4111349_4111619_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151007.1|4112140_4113142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|4113141_4114221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151009.1|4114207_4114891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151010.1|4114986_4115220_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151011.1|4115231_4115420_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151012.1|4115582_4117967_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151013.1|4117963_4118815_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151014.1|4118811_4119039_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151016.1|4119038_4119272_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004144796.1|4119339_4119678_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151017.1|4119641_4119842_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004151018.1|4119849_4120359_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_001397669.1|4120391_4120634_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151019.1|4120756_4121386_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_004151020.1|4121388_4122414_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
4124075:4124121	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 14
NZ_CP007727	Klebsiella pneumoniae subsp. pneumoniae KPNIH10 chromosome, complete genome	5395263	4843965	4892808	5395263	capsid,tail,protease,portal,tRNA,head,terminase	uncultured_Caudovirales_phage(68.75%)	56	NA	NA
WP_002918465.1|4843965_4844460_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|4844463_4845102_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_135801240.1|4845071_4845356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829818.1|4845413_4845806_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|4845821_4846250_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|4846515_4847643_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|4847833_4848232_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002918566.1|4848405_4849773_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|4849860_4850919_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918570.1|4851055_4851994_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|4852408_4852879_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|4853254_4853518_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|4853616_4853883_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|4853933_4854209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918632.1|4854288_4856256_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|4856261_4857194_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|4857201_4857405_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|4857536_4858466_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918642.1|4858501_4859947_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004150952.1|4860035_4863833_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918644.1|4863870_4865340_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002918646.1|4865342_4865924_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|4865931_4866420_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|4866419_4867412_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|4867482_4868526_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|4868831_4870772_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918687.1|4870851_4871043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|4871271_4872273_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918689.1|4872272_4872881_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918732.1|4873104_4873557_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|4873579_4874047_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918738.1|4874057_4875407_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|4875517_4875760_+	YhdT family protein	NA	NA	NA	NA	NA
WP_004150953.1|4875749_4877201_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|4877212_4878094_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|4878451_4879417_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|4879441_4879738_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_004150954.1|4879891_4880083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150955.1|4880085_4881747_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_000113647.1|4881730_4882087_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150957.1|4882217_4882370_-	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_004150959.1|4882362_4882806_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_001547824.1|4882805_4883105_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|4883101_4883437_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_004150962.1|4883433_4884675_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_001547826.1|4884676_4885237_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|4885288_4886455_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|4886718_4887231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150964.1|4887279_4887615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|4887957_4890093_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_001549749.1|4890092_4890458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|4890454_4890823_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_004218267.1|4890921_4891050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001549752.1|4891126_4891315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157263200.1|4891307_4891526_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	1.4e-34
WP_004150969.1|4892028_4892808_-	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
>prophage 1
NZ_CP007729	Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence	243824	26876	64973	243824	integrase,transposase	Escherichia_phage(29.41%)	36	46434:46448	63775:63789
WP_004118231.1|26876_27044_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_004118840.1|27328_28456_+	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118229.1|28452_29046_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004152279.1|29042_29891_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118227.1|29890_30811_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152278.1|30823_32428_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118225.1|32472_33420_+	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004118832.1|33427_35161_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004152557.1|38983_39331_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
WP_020956879.1|39327_39714_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	90.7	1.1e-58
WP_004118217.1|40261_40897_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_000005560.1|40893_42006_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
WP_004152560.1|41998_43387_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.0	1.1e-50
WP_016197752.1|43386_43617_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_000412211.1|44388_45048_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|45248_45626_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|45692_48659_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
46434:46448	attL	TTCGTGGTACAGCAG	NA	NA	NA	NA
WP_000147567.1|48661_49222_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|49347_49698_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|49900_50914_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|51058_51556_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|51667_51958_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|51963_52755_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|52918_53266_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|53259_54099_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|54226_54430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|54585_55791_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|55801_56107_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|56333_57098_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|57590_58175_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|58174_59413_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|59409_60315_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|60436_61141_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|61291_62107_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_044117068.1|62296_62965_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_004217321.1|64268_64973_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
63775:63789	attR	TTCGTGGTACAGCAG	NA	NA	NA	NA
>prophage 2
NZ_CP007729	Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence	243824	71442	133225	243824	transposase,protease	uncultured_Caudovirales_phage(29.41%)	57	NA	NA
WP_000019473.1|71442_72423_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004118209.1|73624_73888_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004118208.1|73902_74166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|74409_74691_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004152117.1|74725_75295_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|75409_78205_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152115.1|78204_78402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483782.1|78639_79389_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152113.1|79375_80338_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_020314316.1|82180_83527_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_003026803.1|83738_84221_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003026799.1|84208_84475_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004152108.1|84650_84905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152107.1|84980_85238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|85286_85490_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152105.1|85523_85892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|85935_86430_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152103.1|86460_87036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152102.1|87023_87293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152101.1|87650_88001_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152100.1|88050_88413_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152099.1|88430_90182_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152098.1|90229_91519_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152097.1|91531_91957_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152096.1|91989_92526_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152095.1|94422_94785_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004182005.1|94860_95406_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152093.1|95414_96128_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004152092.1|96124_96451_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004152091.1|96782_97280_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_031944101.1|97329_97839_-	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152086.1|99581_99761_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004152085.1|99992_100427_-	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152084.1|100643_102044_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_001188930.1|102040_102721_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004118344.1|102775_103705_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|103709_104090_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_001242438.1|104129_105026_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_004152083.1|105025_106843_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001023257.1|107076_107526_+	copper resistance protein	NA	NA	NA	NA	NA
WP_004118669.1|107814_108552_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000843497.1|108585_108783_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004098955.1|108823_111271_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000758228.1|111397_111838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098958.1|111924_115071_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_004152079.1|115081_116374_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246153.1|116487_116841_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000475512.1|116869_118255_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001572351.1|118444_119125_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_003032875.1|119117_120593_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_004178091.1|120843_121275_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_085955172.1|122703_123910_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178088.1|124950_126948_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_004152070.1|127010_128288_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_020444838.1|129270_130725_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004197688.1|131326_131584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011977741.1|132256_133225_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	2.5e-184
>prophage 3
NZ_CP007729	Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence	243824	138892	187337	243824	terminase,integrase,holin,tail	Salmonella_phage(39.22%)	56	124631:124645	184427:184441
124631:124645	attL	AAAGCTGCACGTTAT	NA	NA	NA	NA
WP_000523813.1|138892_140059_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
WP_004152062.1|140058_141030_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
WP_004152549.1|142430_143681_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	1.4e-206
WP_004152548.1|143697_143889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152547.1|143885_144068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152546.1|144064_144658_-	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
WP_004152545.1|144654_144813_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_004153052.1|144805_145099_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004152543.1|145208_145457_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
WP_004152542.1|145508_146531_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
WP_004152541.1|146540_147440_-	endonuclease	NA	Q858E0	Salmonella_phage	93.0	1.5e-159
WP_004164029.1|147436_147736_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004152539.1|148102_148684_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
WP_004152538.1|148837_149071_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|149218_149428_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004152536.1|149427_150195_+	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.0	3.4e-139
WP_004152535.1|150191_150977_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004152534.1|151096_151444_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152532.1|151636_152047_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152531.1|152030_152222_+	hypothetical protein	NA	A0A1B1W2B6	Salmonella_phage	47.3	1.6e-05
WP_004152530.1|152218_152644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152529.1|152640_153384_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
WP_004141386.1|153554_153767_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152527.1|153763_154432_+	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004152526.1|154424_154664_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152525.1|154663_155002_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152524.1|155076_155334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152523.1|155411_155996_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_004154331.1|155992_157468_+	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	3.8e-280
WP_004152449.1|157534_157846_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	45.2	2.5e-16
WP_004141368.1|158647_158854_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_004152447.1|158868_160551_+|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.6	2.3e-265
WP_004152446.1|160547_160844_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_004152445.1|160846_161527_+	peptidase	NA	G9L6C4	Escherichia_phage	83.5	4.0e-75
WP_004152444.1|161541_162528_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	93.9	1.6e-178
WP_004152443.1|162581_163019_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.0	4.8e-66
WP_004152442.1|163029_163371_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	4.0e-36
WP_004152441.1|163421_163745_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_004152440.1|163744_164350_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	78.5	2.8e-88
WP_004152439.1|164349_166848_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.0	0.0e+00
WP_004152438.1|166847_167312_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_004152437.1|167311_167851_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	6.1e-71
WP_004152436.1|167861_170693_+	hypothetical protein	NA	Q858G0	Salmonella_phage	75.7	0.0e+00
WP_004152435.1|170692_172603_+	hypothetical protein	NA	Q858F9	Salmonella_phage	81.9	5.2e-290
WP_004152434.1|172602_175368_+	hypothetical protein	NA	Q858F8	Salmonella_phage	94.5	0.0e+00
WP_071531206.1|175510_175894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152433.1|175979_176669_-	hypothetical protein	NA	G9L6E2	Escherichia_phage	65.2	1.6e-79
WP_004152432.1|176983_177280_-	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	64.0	1.1e-24
WP_004152705.1|178861_179803_+	hypothetical protein	NA	A0A2H5BN49	Klebsiella_phage	89.4	2.8e-164
WP_004146394.1|180087_180492_+	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_004146393.1|180478_180784_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
WP_004152706.1|180773_181403_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
WP_004152707.1|181399_181882_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
WP_004152715.1|183750_185022_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.6e-155
184427:184441	attR	ATAACGTGCAGCTTT	NA	NA	NA	NA
WP_004178083.1|185021_185447_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.6	8.3e-31
WP_004178082.1|185849_187337_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
>prophage 1
NZ_CP007730	Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKpQIL-6e6, complete sequence	113639	8933	42817	113639	transposase,integrase	Escherichia_phage(25.0%)	32	17251:17268	52015:52032
WP_004152391.1|8933_10649_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|10758_13788_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|13894_14920_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|14916_15696_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004152396.1|15983_16865_+	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152397.1|17114_18434_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
17251:17268	attL	ATCGACTTGCGCCGGCGG	NA	NA	NA	NA
WP_004152398.1|18710_19895_-|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
WP_004152400.1|20398_20758_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
WP_004152402.1|21923_22544_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
WP_004152403.1|22632_25530_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
WP_001067855.1|25602_26307_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|28050_28911_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000935452.1|29478_30783_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001300294.1|30821_31490_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|31525_31762_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|31758_32121_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|32138_33833_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|33884_34307_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_072093211.1|34342_34468_-	mercury transporter	NA	NA	NA	NA	NA
WP_004152334.1|35199_35910_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044770.1|35983_36400_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261282.1|36396_36627_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_072093212.1|36583_37045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153649.1|37279_37486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152336.1|37531_37840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152337.1|37867_38197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004171440.1|38222_38621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152339.1|38627_38960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152340.1|38959_39742_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
WP_011977773.1|40633_40864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152341.1|40955_41429_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_004152342.1|41548_42817_-|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
52015:52032	attR	ATCGACTTGCGCCGGCGG	NA	NA	NA	NA
>prophage 2
NZ_CP007730	Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKpQIL-6e6, complete sequence	113639	47392	59484	113639		Enterobacteria_phage(25.0%)	13	NA	NA
WP_004152345.1|47392_49420_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
WP_004227314.1|49531_49747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152347.1|49971_50304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152348.1|50680_51655_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
WP_004152349.1|51651_52857_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004152350.1|53178_54075_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
WP_004152351.1|54475_55747_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
WP_004152352.1|55746_56178_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
WP_004152353.1|56409_57381_+	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152354.1|57383_58055_+	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568040.1|58115_58346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343518.1|58464_58581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|58782_59484_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
