The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	173317	181566	4410036		unidentified_phage(33.33%)	8	NA	NA
WP_014116080.1|173317_173599_-	VRR-NUC domain-containing protein	NA	A0A2I7QIL0	Bacillus_phage	42.0	9.1e-10
WP_014116081.1|173595_175941_-	hypothetical protein	NA	A0A2I6PEP4	Staphylococcus_phage	34.0	3.6e-115
WP_014116082.1|176015_176498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116083.1|176519_178538_-	hypothetical protein	NA	H7BVQ1	unidentified_phage	59.6	6.0e-228
WP_145973833.1|178605_178965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116084.1|179007_179814_-	DUF2815 family protein	NA	A0A0A7RVM4	Clostridium_phage	35.8	7.9e-22
WP_014116085.1|179831_181016_-	DUF2800 domain-containing protein	NA	H7BVP9	unidentified_phage	44.6	7.6e-82
WP_014116086.1|181002_181566_-	HNH endonuclease	NA	K7PL64	Enterobacteria_phage	50.6	8.8e-12
>prophage 2
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	260309	327995	4410036	integrase,transposase,tRNA	Bacillus_phage(20.0%)	59	304387:304401	324371:324385
WP_014116174.1|260309_260756_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_014116175.1|260908_263125_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	35.1	1.9e-09
WP_014116176.1|263121_265224_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	32.5	7.2e-75
WP_014116177.1|265479_267003_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_014116178.1|267110_267521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014116179.1|267667_269002_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_014116180.1|269119_270238_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_041614969.1|270714_271107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116181.1|271458_272052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116182.1|272438_272867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014116183.1|272863_273070_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_145974045.1|273433_274795_-	YfcC family protein	NA	NA	NA	NA	NA
WP_014116185.1|274852_276055_-	amidohydrolase	NA	NA	NA	NA	NA
WP_014116186.1|276298_276847_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_014116187.1|276956_278345_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_014116188.1|278459_279716_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_014116189.1|280138_281113_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_014116190.1|281152_281797_-	signal peptidase I	NA	NA	NA	NA	NA
WP_014116191.1|281789_285320_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_014116192.1|285401_286001_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_049801329.1|286067_286652_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_014116194.1|286740_287700_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SKK7	Klosneuvirus	32.5	3.2e-38
WP_014116195.1|287755_288871_-	glucosamine-1-phosphate N-acetyltransferase	NA	NA	NA	NA	NA
WP_014116196.1|289228_289720_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_014116197.1|289836_291030_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_014116198.1|291185_291959_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_014116200.1|292183_293701_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_041614970.1|293975_294701_+	M23 family metallopeptidase	NA	A0A292GJG6	Xanthomonas_phage	32.0	5.3e-09
WP_014116202.1|294840_295707_+	patatin family protein	NA	NA	NA	NA	NA
WP_014116203.1|295805_297185_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_014116204.1|297356_298481_-	peptide chain release factor 2	NA	W8EDB3	Pseudomonas_phage	29.3	3.2e-05
WP_014116206.1|298718_299144_-	RNHCP domain-containing protein	NA	NA	NA	NA	NA
WP_014116210.1|300560_301313_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014116212.1|301647_302340_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_014116214.1|302539_303271_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_083855468.1|304102_304255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145974046.1|304331_304610_+|transposase	transposase	transposase	NA	NA	NA	NA
304387:304401	attL	AGCAGGCGGCGGCAC	NA	NA	NA	NA
WP_014116217.1|304634_305234_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	38.0	1.4e-20
WP_014116222.1|307631_308324_+	iron-sulfur cluster assembly scaffold protein	NA	NA	NA	NA	NA
WP_014116223.1|308341_309340_+	GGGtGRT protein	NA	NA	NA	NA	NA
WP_014116224.1|309463_310705_-|integrase	site-specific integrase	integrase	A0A0A8WIE1	Clostridium_phage	34.9	1.7e-60
WP_014116225.1|310767_310998_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014116229.1|312785_313583_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	48.3	1.4e-55
WP_014116230.1|313708_314161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161603815.1|314169_314397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116232.1|314678_315935_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_041614972.1|316087_316789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145973839.1|317664_318754_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.1	3.2e-50
WP_014116239.1|319115_319607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014116240.1|319874_320054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014116241.1|320185_320746_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_014116242.1|320877_321312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014116243.1|321418_321910_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014116244.1|322400_323669_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_014116245.1|323837_323990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014116246.1|324015_324750_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
324371:324385	attR	GTGCCGCCGCCTGCT	NA	NA	NA	NA
WP_014116248.1|325852_326311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014116249.1|326346_326607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145973840.1|326905_327995_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	7.1e-50
>prophage 3
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	333777	394238	4410036	integrase,transposase	uncultured_Caudovirales_phage(22.22%)	48	327221:327245	406444:406468
327221:327245	attL	TCAGCGAGCGCCGCGCGTGCAGGCT	NA	NA	NA	NA
WP_014116259.1|333777_334593_+|integrase	tyrosine-type recombinase/integrase	integrase	W8EHC2	Mycobacterium_phage	31.8	3.5e-09
WP_014116262.1|335744_335903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014116263.1|336269_337592_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_014116264.1|337805_338069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014116265.1|338065_338344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014116267.1|340235_341294_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014116268.1|341325_342612_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_083855470.1|342608_343145_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_014116270.1|343420_344185_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041614976.1|344430_347955_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_014116009.1|348076_348508_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_014116010.1|348547_350035_+	4-hydroxybutyryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_014116271.1|350053_351190_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_014116272.1|351204_352005_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_014116273.1|352022_353156_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_014116274.1|353203_354166_+	C-terminal binding protein	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	31.8	5.0e-23
WP_014116275.1|354812_356534_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_014116276.1|356801_358256_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	50.1	2.8e-126
WP_014116278.1|358475_358985_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J4N8	uncultured_Caudovirales_phage	48.3	5.0e-06
WP_014116279.1|359100_359481_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014116281.1|359858_360008_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_014116282.1|360401_360788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041614977.1|360780_360990_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014116284.1|361175_361496_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_049801332.1|361916_362918_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_014116289.1|364976_365684_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.0	1.2e-21
WP_014116290.1|365680_367285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116291.1|367384_367822_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014116292.1|367930_368923_+	YhdH/YhfP family quinone oxidoreductase	NA	NA	NA	NA	NA
WP_083855657.1|371389_373321_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_014116297.1|373443_375309_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_014116298.1|375675_376743_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_014116299.1|376818_377457_+	putative methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.0	2.7e-09
WP_014116300.1|377677_378292_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_083855473.1|378288_379005_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_014116306.1|380515_381259_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_145973841.1|381221_381380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116307.1|382150_382333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116308.1|382467_383724_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_014116309.1|384133_385276_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_014116311.1|386576_386864_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014116312.1|386888_387434_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	36.5	1.5e-19
WP_161603816.1|387517_389485_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014116314.1|389471_390236_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	9.7e-30
WP_014116315.1|390311_391289_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_014116316.1|391285_391897_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014116317.1|392261_393578_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	31.6	5.1e-18
WP_014116319.1|393950_394238_+|transposase	transposase	transposase	NA	NA	NA	NA
406444:406468	attR	TCAGCGAGCGCCGCGCGTGCAGGCT	NA	NA	NA	NA
>prophage 4
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	406128	468938	4410036	integrase,transposase,tRNA	Clostridium_phage(22.22%)	54	420919:420933	431554:431568
WP_145973842.1|406128_407218_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.1	2.4e-50
WP_014116332.1|407249_407657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014116333.1|407984_408539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116334.1|408535_408862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116335.1|409552_409816_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014116336.1|409849_410296_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	39.6	1.2e-19
WP_014116337.1|410246_410702_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	36.3	1.8e-10
WP_014116338.1|411861_413703_-	M56 family metallopeptidase	NA	NA	NA	NA	NA
WP_014116339.1|413699_414077_-	BlaI/MecI/CopY family transcriptional regulator	NA	A0A090DCS9	Clostridium_phage	36.1	7.2e-10
WP_014116341.1|414653_416189_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.6	8.5e-17
WP_014116342.1|416190_416769_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_014116344.1|417121_417943_-	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_145974048.1|418034_420296_-	AAA family ATPase	NA	NA	NA	NA	NA
420919:420933	attL	AACGCTGGCGGCGTG	NA	NA	NA	NA
WP_014116346.1|427631_428783_-|integrase	site-specific integrase	integrase	A0A0A8WF01	Clostridium_phage	27.3	4.1e-24
WP_145974049.1|428987_429287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014116348.1|429462_429708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145973843.1|430045_430342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014116350.1|430557_430920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145974050.1|430984_432247_+	hypothetical protein	NA	NA	NA	NA	NA
431554:431568	attR	AACGCTGGCGGCGTG	NA	NA	NA	NA
WP_014116352.1|432249_432939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116319.1|434240_434528_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014116355.1|435022_435814_+	Fic family protein	NA	NA	NA	NA	NA
WP_145974051.1|436126_436336_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014116358.1|436338_436716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116359.1|436782_437070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116360.1|437069_437345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116361.1|437522_437702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116362.1|438411_438771_-|tRNA	methionine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_014116363.1|438787_440494_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_014116364.1|440823_441618_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014116365.1|441663_443058_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	NA	NA	NA	NA
WP_014116366.1|443075_444641_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPB	NA	NA	NA	NA	NA
WP_014116367.1|444637_445738_+	ATP-NAD kinase family protein	NA	NA	NA	NA	NA
WP_014116368.1|445756_446542_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_049801336.1|446681_448124_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_145973845.1|448110_449742_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_014116372.1|450789_450981_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014116373.1|451589_452783_+	threonine ammonia-lyase	NA	NA	NA	NA	NA
WP_014116374.1|452893_454126_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_014116375.1|454169_454550_+	RidA family protein	NA	NA	NA	NA	NA
WP_014116376.1|454642_455221_+	2-oxoacid:acceptor oxidoreductase family protein	NA	NA	NA	NA	NA
WP_014116377.1|455217_455523_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_014116378.1|455537_456716_+	2-ketoisovalerate ferredoxin oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_014116379.1|456731_457664_+	pyruvate synthase subunit PorB	NA	NA	NA	NA	NA
WP_014116380.1|457878_459333_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	50.3	7.3e-127
WP_014116381.1|459794_460970_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	29.2	1.3e-12
WP_161603819.1|462201_462360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041614984.1|462346_462535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116386.1|463082_463805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116387.1|463866_464655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116388.1|465093_465522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116389.1|465655_466681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116390.1|467125_467698_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_014116391.1|467732_468938_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	42.4	2.7e-82
>prophage 5
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	653523	765447	4410036	integrase,transposase,protease	Bacillus_phage(23.81%)	105	695957:695982	705534:705985
WP_014116576.1|653523_653871_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_161603825.1|653867_654113_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_014116578.1|654051_654570_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.2	1.8e-43
WP_014116579.1|654646_656413_-	DUF4127 family protein	NA	NA	NA	NA	NA
WP_014116580.1|656474_656843_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_014116581.1|656955_657687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014116582.1|657689_658754_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.8	1.1e-44
WP_014116583.1|659012_659969_-	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	25.5	2.5e-14
WP_041615000.1|660345_661638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116585.1|661641_662346_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_014116586.1|662701_664189_-	APC family permease	NA	NA	NA	NA	NA
WP_014116587.1|664429_665299_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014116588.1|665321_666815_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_014116589.1|666929_668426_-	glycerol kinase	NA	NA	NA	NA	NA
WP_014116590.1|668698_669796_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_014116591.1|669902_670775_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041615001.1|671164_671866_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_161603826.1|671887_672034_+	ethanolamine utilization protein EutH	NA	NA	NA	NA	NA
WP_014116594.1|672326_672635_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014116595.1|672730_673744_+	permease	NA	NA	NA	NA	NA
WP_041615002.1|673758_674523_+	DUF2703 domain-containing protein	NA	NA	NA	NA	NA
WP_014116597.1|674558_674903_+	TM0996/MTH895 family glutaredoxin-like protein	NA	NA	NA	NA	NA
WP_014116598.1|674920_675994_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_014116599.1|675965_676514_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_014116600.1|676518_676908_+	arsenate reductase ArsC	NA	NA	NA	NA	NA
WP_145973856.1|676983_677475_-	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	67.4	1.4e-50
WP_083855659.1|677647_678031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116603.1|678027_678915_+	hydrogenase small subunit	NA	NA	NA	NA	NA
WP_014116604.1|678929_680339_+	nickel-dependent hydrogenase large subunit	NA	NA	NA	NA	NA
WP_014116605.1|680335_680800_+|protease	hydrogenase maturation protease	protease	NA	NA	NA	NA
WP_014116606.1|680792_681050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116607.1|681030_683346_+	carbamoyltransferase HypF	NA	NA	NA	NA	NA
WP_014116608.1|683305_683527_+	HypC/HybG/HupF family hydrogenase formation chaperone	NA	NA	NA	NA	NA
WP_014116609.1|683523_684612_+	hydrogenase formation protein HypD	NA	NA	NA	NA	NA
WP_014116610.1|684608_685607_+	hydrogenase expression/formation protein HypE	NA	NA	NA	NA	NA
WP_014116611.1|685675_687796_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014116612.1|687792_688542_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	7.8e-32
WP_014116613.1|688761_689481_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.0	2.0e-16
WP_014116614.1|689474_690722_+	sensor histidine kinase	NA	X5JAC0	Clostridium_phage	24.6	1.1e-19
WP_161603827.1|690841_691948_-	FMN-binding protein	NA	NA	NA	NA	NA
WP_014116616.1|691944_692472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049801345.1|692477_693413_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_014116618.1|693415_694912_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	28.3	9.5e-13
WP_014116619.1|694908_695571_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.3	1.7e-30
695957:695982	attL	TTTTCGTAAAGTATCTGACTTTGCGA	NA	NA	NA	NA
WP_014116621.1|696183_697311_+|integrase	site-specific integrase	integrase	A0A2R2ZGM9	Clostridioides_phage	27.4	6.3e-25
695957:695982	attL	TTTTCGTAAAGTATCTGACTTTGCGA	NA	NA	NA	NA
WP_014116622.1|697450_699103_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_014116622.1|697450_699103_+	EAL domain-containing protein	NA	NA	NA	NA	NA
697383:697408	attR	TCGCAAAGTCAGATACTTTACGAAAA	NA	NA	NA	NA
WP_161603828.1|699402_700455_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.1	1.2e-09
697383:697408	attR	TCGCAAAGTCAGATACTTTACGAAAA	NA	NA	NA	NA
WP_014116624.1|700671_702126_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	50.8	7.3e-127
WP_014116625.1|702313_703249_-|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	27.9	7.5e-24
WP_049801347.1|703245_703566_-	MCP four helix bundle domain-containing protein	NA	NA	NA	NA	NA
WP_014116627.1|703946_705107_+|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	27.9	7.1e-24
WP_014116628.1|705293_706988_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_014116629.1|707058_707700_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_014116630.1|707796_708750_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_014116631.1|708960_709506_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014116632.1|709593_710307_+	ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	31.2	2.5e-19
WP_014116633.1|710308_711025_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_083855494.1|711249_711582_+	GtrA family protein	NA	NA	NA	NA	NA
WP_041615508.1|713395_714586_+	amidohydrolase	NA	NA	NA	NA	NA
WP_014116638.1|714703_715918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116639.1|715938_717108_+	amidohydrolase	NA	NA	NA	NA	NA
WP_041615509.1|717283_717967_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_014116641.1|717970_718186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116642.1|718384_718948_+	CarD family transcriptional regulator	NA	NA	NA	NA	NA
WP_014116643.1|719577_722622_-	DUF4825 domain-containing protein	NA	NA	NA	NA	NA
WP_014116644.1|722618_722984_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_014116645.1|723126_723795_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014116646.1|723787_724699_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.0	1.3e-20
WP_014116647.1|724803_726561_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	42.2	4.3e-73
WP_014116648.1|726738_728142_-	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_014116649.1|728158_732691_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_014116650.1|732822_733371_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_014116651.1|733523_734855_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_014116652.1|735250_735838_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014116654.1|736415_736883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116655.1|737018_738362_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_014116656.1|738545_740006_+	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_014116657.1|740002_741682_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_014116658.1|741678_743031_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_014116660.1|743311_744079_+	LamB/YcsF family protein	NA	NA	NA	NA	NA
WP_014116661.1|744119_745352_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_014116662.1|745410_746148_+	5-oxoprolinase subunit PxpB	NA	NA	NA	NA	NA
WP_014116663.1|746144_747089_+	biotin-dependent carboxyltransferase family protein	NA	NA	NA	NA	NA
WP_014116664.1|747188_748010_+	putative hydro-lyase	NA	NA	NA	NA	NA
WP_014116666.1|748372_748627_+	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	50.0	1.6e-13
WP_014116667.1|748683_748923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116668.1|749868_750057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145973857.1|750291_750579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014116671.1|751036_751519_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_014116672.1|751600_751864_+	DUF2508 family protein	NA	NA	NA	NA	NA
WP_014116673.1|751854_752118_+	pro-sigmaK processing inhibitor BofA family protein	NA	NA	NA	NA	NA
WP_014116675.1|752375_752807_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_014116676.1|752821_753226_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_145973858.1|753443_754534_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	7.1e-50
WP_014116678.1|754851_756399_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_145973859.1|756627_757206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014116680.1|757335_757623_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014116681.1|757649_758453_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.6	8.1e-27
WP_014116682.1|758671_759424_-	DUF4367 domain-containing protein	NA	NA	NA	NA	NA
WP_041615004.1|759413_759983_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_083855498.1|760077_760353_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145973860.1|761338_762428_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.1	1.9e-50
WP_014116687.1|763236_763851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014116688.1|764501_764687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145974059.1|765207_765447_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	783742	829306	4410036	integrase,transposase	Leptospira_phage(12.5%)	46	799400:799423	806399:806422
WP_041615513.1|783742_785257_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_145973864.1|785443_786534_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	1.7e-51
WP_083855503.1|786783_786930_-	DUF4367 domain-containing protein	NA	NA	NA	NA	NA
WP_083855661.1|787462_787654_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014116711.1|788026_789178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145973865.1|789696_790116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041615014.1|790243_790609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014116713.1|790910_791198_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014116716.1|792302_793409_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_014116717.1|793975_794788_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014116718.1|794940_795435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116719.1|795468_795654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116721.1|796238_796829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041615015.1|796818_797301_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_014116727.1|799062_799350_-|transposase	transposase	transposase	NA	NA	NA	NA
799400:799423	attL	TGCCCTCTGCACTTCTATGATATC	NA	NA	NA	NA
WP_014116730.1|800660_801476_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014116731.1|801660_802476_+|integrase	site-specific integrase	integrase	W8EHC2	Mycobacterium_phage	31.1	5.9e-09
WP_014116732.1|802531_803626_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_014116733.1|803976_804687_-	SDR family oxidoreductase	NA	A0A0G2Y8L6	Acanthamoeba_polyphaga_mimivirus	31.9	7.5e-08
WP_014116734.1|804823_805039_-	DUF503 domain-containing protein	NA	NA	NA	NA	NA
WP_014116735.1|805137_805425_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014116738.1|806412_807348_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
806399:806422	attR	TGCCCTCTGCACTTCTATGATATC	NA	NA	NA	NA
WP_014116739.1|807642_808914_+	anion permease	NA	Q6A201	Oenococcus_phage	27.3	2.4e-33
WP_014116740.1|808951_809830_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_014116741.1|810482_810770_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_083855505.1|810861_812499_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_014116743.1|812834_814835_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014116744.1|815009_815960_+	alpha/beta hydrolase	NA	A0A2P1EM31	Moumouvirus	26.1	3.9e-20
WP_014116745.1|816103_816391_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014116747.1|816739_817957_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	33.9	1.0e-44
WP_014116748.1|817953_818751_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	47.1	5.9e-54
WP_083855506.1|818872_819154_+	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
WP_014116750.1|819187_819613_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_014116751.1|819667_819826_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_014116752.1|819844_820963_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_014116753.1|820975_821176_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_014116754.1|821338_821650_-	zinc-ribbon domain containing protein	NA	NA	NA	NA	NA
WP_014116755.1|822220_822460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014116756.1|822467_822926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014116757.1|823032_823590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049801354.1|823586_824123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041615017.1|824149_824725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161603831.1|824775_824925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145974061.1|825133_826735_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_014116762.1|826750_827290_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014116391.1|828100_829306_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	42.4	2.7e-82
>prophage 7
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	868849	915592	4410036	transposase	Streptococcus_phage(30.0%)	44	NA	NA
WP_014116317.1|868849_870166_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	31.6	5.1e-18
WP_014116809.1|870592_871606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116810.1|871638_872829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116811.1|872809_874543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116812.1|874539_877482_+	helicase	NA	NA	NA	NA	NA
WP_014116813.1|877602_877977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116814.1|878000_878906_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_014116815.1|878902_879421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145973869.1|879564_879945_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_014116817.1|880087_880696_+	peptidase S24	NA	NA	NA	NA	NA
WP_014116818.1|880751_880982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116819.1|881001_882036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116820.1|882321_882831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116821.1|883346_883853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116822.1|883972_884779_+	recombinase family protein	NA	NA	NA	NA	NA
WP_014116823.1|884782_885619_+	recombinase zinc beta ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_014116824.1|885728_886223_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_014116825.1|886185_887700_+	DNA methylase	NA	O64031	Bacillus_phage	26.1	1.7e-33
WP_014116826.1|887696_888125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116827.1|888231_889251_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.6	1.3e-66
WP_014116828.1|889272_890373_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_014116829.1|890411_892463_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_049801360.1|892708_894352_-	recombinase family protein	NA	NA	NA	NA	NA
WP_014116832.1|894481_894661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119427.1|895191_895617_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_014116834.1|896036_897257_-	serine racemase VanT catalytic subunit	NA	NA	NA	NA	NA
WP_014116835.1|897183_897657_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_014116836.1|897693_898455_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_014116837.1|898451_899501_-	D-alanine--D-serine ligase VanG	NA	NA	NA	NA	NA
WP_014116838.1|899497_900334_-	glycopeptide resistance accessory protein VanW	NA	NA	NA	NA	NA
WP_083855664.1|900466_901534_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_014116840.1|901577_902282_-	VanR-ABDEGLN family response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	8.4e-36
WP_014116841.1|902589_902835_+	helix-turn-helix transcriptional regulator	NA	A0A2K5B2A6	Erysipelothrix_phage	47.3	3.7e-15
WP_014116842.1|902896_903694_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	47.9	7.0e-55
WP_161603834.1|905075_905177_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_014116846.1|905228_907157_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_041615025.1|907450_908626_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_014116848.1|908815_909301_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014116849.1|909414_910773_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_014116850.1|910787_911330_+	flavodoxin	NA	NA	NA	NA	NA
WP_014116851.1|911425_912880_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	50.1	1.1e-125
WP_014116852.1|913115_914099_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	47.3	5.9e-80
WP_049801363.1|914210_914627_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.8	1.6e-31
WP_014116854.1|914623_915592_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.3	1.7e-55
>prophage 8
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	1545949	1646229	4410036	integrase,transposase,tRNA,protease	Bacillus_phage(33.33%)	102	1591917:1591935	1636021:1636039
WP_145973897.1|1545949_1546366_+|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.3	1.2e-05
WP_014117477.1|1546403_1546874_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_014117478.1|1546857_1548660_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.6	4.5e-09
WP_014117479.1|1548861_1549923_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_154652477.1|1550314_1550452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117482.1|1550485_1552066_+	recombinase family protein	NA	A0A2H4J992	uncultured_Caudovirales_phage	26.0	6.9e-30
WP_014117483.1|1552096_1552300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014117484.1|1552521_1552833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117485.1|1552889_1553792_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_014117486.1|1554108_1554519_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_014117487.1|1554602_1556513_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_014117488.1|1556534_1557746_+	FprA family A-type flavoprotein	NA	NA	NA	NA	NA
WP_014117489.1|1557944_1558517_-	N-acetylmuramoyl-L-alanine amidase	NA	I1TLF9	Bacillus_phage	34.2	3.2e-09
WP_014117490.1|1558774_1559143_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_014116578.1|1559202_1559721_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.2	1.8e-43
WP_161603825.1|1559659_1559905_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_014117492.1|1560154_1561069_-	DMT family transporter	NA	NA	NA	NA	NA
WP_014117493.1|1561071_1561404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049801385.1|1561674_1562247_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	35.1	2.1e-13
WP_014117495.1|1562282_1562480_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_014117496.1|1562515_1562869_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_014117497.1|1562927_1563647_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_014117498.1|1564077_1564854_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_014117499.1|1564912_1565749_+	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014117500.1|1565772_1566915_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_014116272.1|1566933_1567734_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_014117501.1|1567751_1568885_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_041615085.1|1569542_1569977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145974075.1|1570126_1570621_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_014117504.1|1570805_1571627_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_014117505.1|1571620_1572484_-	bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/5,10-methylene-tetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
WP_014117506.1|1572486_1573119_-	cyclodeaminase/cyclohydrolase family protein	NA	NA	NA	NA	NA
WP_014117507.1|1573199_1574870_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_014117509.1|1575206_1576733_+	histidine kinase	NA	NA	NA	NA	NA
WP_014117510.1|1576710_1577382_+	response regulator	NA	NA	NA	NA	NA
WP_014117511.1|1577489_1578746_-	serine hydroxymethyltransferase	NA	G9I092	Helicoverpa_zea_nudivirus	40.7	1.1e-75
WP_014117512.1|1578979_1579453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014117513.1|1579456_1580308_-	DUF3100 domain-containing protein	NA	NA	NA	NA	NA
WP_041615636.1|1580351_1581521_-	amidohydrolase	NA	NA	NA	NA	NA
WP_083855669.1|1583347_1584010_-	hypothetical protein	NA	A0A0E3T7R5	Bacillus_phage	65.0	3.2e-37
WP_014117519.1|1585202_1586393_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_014117520.1|1586645_1587494_-	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014117521.1|1587490_1588768_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_014117522.1|1589048_1589903_+	dipicolinate synthase subunit DpsA	NA	NA	NA	NA	NA
WP_014117523.1|1589903_1590491_+	dipicolinate synthase subunit B	NA	NA	NA	NA	NA
WP_014117524.1|1590600_1590891_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014117525.1|1590950_1591742_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	36.5	7.0e-39
1591917:1591935	attL	AACTTGCCGCATGTCAAGA	NA	NA	NA	NA
WP_014117526.1|1592317_1592470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117527.1|1592802_1592976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117528.1|1593037_1593289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117529.1|1593485_1596257_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_014117530.1|1596350_1597262_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_014117531.1|1597634_1597802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161603845.1|1598399_1599395_+	PocR ligand-binding domain-containing protein	NA	NA	NA	NA	NA
WP_145973899.1|1599758_1600631_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.5	1.2e-28
WP_014117534.1|1600642_1600930_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014117535.1|1601522_1602059_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_014117537.1|1603092_1604787_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_014117538.1|1604789_1606679_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_014117539.1|1606675_1607155_-	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_014117540.1|1607709_1609008_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_014117541.1|1609004_1609847_+	DNA-binding domain-containing protein	NA	W8CYM9	Bacillus_phage	22.7	4.9e-06
WP_014117542.1|1610028_1611144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041615640.1|1611436_1612120_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	3.4e-34
WP_014117544.1|1612146_1614648_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014116745.1|1614873_1615161_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014117545.1|1615220_1615490_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_083855548.1|1615447_1616017_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	35.8	2.5e-22
WP_049801386.1|1616798_1617632_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	30.5	2.5e-26
WP_014117548.1|1617652_1617958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161603846.1|1617995_1618148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049801389.1|1618199_1618637_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I723	Streptococcus_phage	45.6	5.6e-06
WP_145973900.1|1618711_1619802_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.1	2.4e-50
WP_014117551.1|1619940_1620228_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041615087.1|1620353_1620560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117552.1|1621047_1621779_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.0	2.5e-35
WP_014117553.1|1621779_1623186_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	1.3e-19
WP_014117554.1|1623286_1623535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117555.1|1623549_1623783_+	serine hydrolase	NA	NA	NA	NA	NA
WP_014117556.1|1623783_1624032_+	serine hydrolase	NA	NA	NA	NA	NA
WP_014117559.1|1625150_1625735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117560.1|1625811_1626615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049801392.1|1626614_1627055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117561.1|1626945_1627173_+	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_014117562.1|1627461_1629249_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	60.7	7.6e-09
WP_014117564.1|1630042_1630423_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6J1X2	Lactobacillus_phage	34.3	1.4e-08
WP_014117565.1|1630571_1630841_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_014116745.1|1630900_1631188_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_161603847.1|1631419_1631665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041615090.1|1631636_1631831_+	hypothetical protein	NA	H7BW18	unidentified_phage	67.7	9.1e-17
WP_041615091.1|1631883_1632282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014117567.1|1632340_1632535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117568.1|1632676_1633396_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_145973901.1|1634412_1635502_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	7.1e-50
WP_083855670.1|1637590_1637824_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
1636021:1636039	attR	TCTTGACATGCGGCAAGTT	NA	NA	NA	NA
WP_014117575.1|1637937_1638168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014117576.1|1638520_1641430_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_145973903.1|1642651_1643173_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_145973904.1|1643429_1644520_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.3	1.6e-49
WP_049801393.1|1644606_1645026_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	47.3	1.1e-32
WP_041615098.1|1645257_1645545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014117581.1|1645707_1646229_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 9
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	1703696	1732880	4410036	integrase,terminase,transposase,portal,tRNA	unidentified_phage(22.22%)	27	1700269:1700283	1727138:1727152
1700269:1700283	attL	CCTTGCAGCCCCGGC	NA	NA	NA	NA
WP_161603810.1|1703696_1703837_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_161603848.1|1703853_1704123_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2I6AZV9	Macacine_betaherpesvirus	53.9	7.6e-22
WP_162471066.1|1704040_1704472_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	67.7	2.6e-19
WP_014117644.1|1704595_1704769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014117645.1|1704981_1705335_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_049801552.1|1705416_1706118_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_014117647.1|1706512_1706719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117648.1|1706956_1707301_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_014117649.1|1707628_1709626_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.0	3.0e-06
WP_014117650.1|1709827_1711315_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014117651.1|1711534_1713268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014117652.1|1714184_1714439_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_014117653.1|1714768_1714927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014117654.1|1715152_1716472_-	HD domain-containing protein	NA	H7BUW3	unidentified_phage	47.7	3.1e-108
WP_014117655.1|1716802_1718182_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_014117656.1|1718337_1718877_+|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_014117657.1|1719004_1719604_-	4'-phosphopantetheinyl transferase	NA	NA	NA	NA	NA
WP_014117658.1|1719810_1721604_+	DNA primase	NA	C7F4F5	Cyanophage	27.0	4.6e-38
WP_049801553.1|1721698_1723078_+	RNA polymerase sigma factor RpoD	NA	M4SMP8	Cyanophage	33.8	2.2e-32
WP_145974078.1|1724747_1724933_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014117664.1|1725476_1726274_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	47.1	1.7e-53
WP_014117667.1|1727652_1727820_+	hypothetical protein	NA	NA	NA	NA	NA
1727138:1727152	attR	CCTTGCAGCCCCGGC	NA	NA	NA	NA
WP_014117668.1|1728321_1728801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041615103.1|1729289_1729715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117670.1|1730252_1731518_+|terminase	PBSX family phage terminase large subunit	terminase	H7BVR2	unidentified_phage	58.9	1.2e-133
WP_041615104.1|1731504_1731708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117671.1|1731704_1732880_+|portal	portal protein	portal	A0A2K9V3H9	Faecalibacterium_phage	30.4	3.0e-30
>prophage 10
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	1764514	1909021	4410036	coat,integrase,capsid,terminase,transposase,plate,portal,protease,head,tRNA,tail	Bacillus_phage(13.64%)	163	1876937:1876953	1916946:1916962
WP_173387022.1|1764514_1764793_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014117714.1|1764819_1765623_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	32.9	2.0e-25
WP_014117715.1|1765677_1767042_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_014117716.1|1767046_1767715_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.6	1.8e-35
WP_014117717.1|1767906_1768158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117718.1|1768471_1768894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161603849.1|1769455_1769677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117721.1|1769669_1769978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117723.1|1770384_1770825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014117724.1|1770808_1771156_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014117725.1|1771427_1771721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154652480.1|1771764_1771902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117726.1|1771983_1773186_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_014117727.1|1773182_1773827_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014117728.1|1773862_1774642_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	3.9e-10
WP_014117729.1|1774638_1775709_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_014117730.1|1775715_1776852_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014117731.1|1776932_1777766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014117733.1|1778348_1778870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014117734.1|1779418_1780264_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014117735.1|1780311_1780494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117736.1|1780558_1781452_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014117737.1|1781497_1781962_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_014117738.1|1781958_1782291_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_014117739.1|1782280_1782604_+	monovalent cation/H(+) antiporter subunit G	NA	NA	NA	NA	NA
WP_014117740.1|1782600_1782852_+	DUF4040 domain-containing protein	NA	NA	NA	NA	NA
WP_014117741.1|1782844_1783735_+	putative transporter	NA	NA	NA	NA	NA
WP_014117742.1|1783734_1784109_+	NADH-quinone oxidoreductase subunit K	NA	NA	NA	NA	NA
WP_014117743.1|1784108_1785623_+	transporter	NA	NA	NA	NA	NA
WP_014117744.1|1785701_1787147_+	transporter	NA	NA	NA	NA	NA
WP_014117745.1|1787177_1788662_+	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_014117746.1|1788679_1790626_+	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_014117747.1|1790781_1791552_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_014117748.1|1791754_1792225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049801406.1|1792181_1793447_+|terminase	PBSX family phage terminase large subunit	terminase	V9QIY4	Oenococcus_phage	48.6	1.9e-110
WP_014117750.1|1793466_1794630_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_070107677.1|1794738_1795605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041615671.1|1795715_1796063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117753.1|1796078_1797110_+	cell surface protein	NA	NA	NA	NA	NA
WP_014117754.1|1797152_1797503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117755.1|1797499_1797808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117756.1|1797804_1798296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041615111.1|1798292_1799360_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0M3LQC3	Mannheimia_phage	31.9	1.2e-14
WP_014117758.1|1799436_1799826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117759.1|1799822_1800137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117760.1|1800133_1800715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041615672.1|1800750_1801311_+|coat	SafA/ExsA family spore coat assembly protein	coat	A0A142IG96	Bacillus_phage	59.5	5.5e-06
WP_014117762.1|1801307_1802249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117763.1|1802274_1802688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117764.1|1802700_1803039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117765.1|1803052_1804111_+|plate	baseplate J/gp47 family protein	plate	NA	NA	NA	NA
WP_014117766.1|1804112_1804679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117767.1|1804680_1804977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117768.1|1804973_1805240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117769.1|1805257_1805509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117770.1|1805505_1806201_+	CHAP domain-containing protein	NA	A0A2H5BLQ0	Streptomyces_phage	39.2	4.7e-15
WP_014117771.1|1806257_1806548_-	helix-turn-helix transcriptional regulator	NA	X2CXD8	Lactobacillus_phage	45.2	7.5e-07
WP_041615112.1|1806657_1807296_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	43.7	7.8e-41
WP_014117773.1|1807477_1807636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117774.1|1807710_1807956_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_014117775.1|1808059_1810756_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_014117776.1|1810773_1811799_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	35.8	8.2e-32
WP_145973909.1|1811822_1812170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014117778.1|1812509_1813994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145973910.1|1814252_1815122_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_145974080.1|1815163_1815754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117781.1|1815786_1816959_+	alanine racemase	NA	NA	NA	NA	NA
WP_041615116.1|1817134_1817506_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	7.8e-09
WP_014117783.1|1817600_1818062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041615117.1|1818220_1818736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117785.1|1818936_1819392_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_014117787.1|1819973_1820270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117788.1|1820275_1820482_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014117789.1|1820536_1821211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014117790.1|1821212_1821539_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014117791.1|1821827_1822169_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_014117792.1|1822632_1823238_+	signal peptidase I	NA	NA	NA	NA	NA
WP_041615676.1|1823304_1824141_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_014117794.1|1824133_1824769_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	43.1	6.6e-24
WP_014117795.1|1824765_1825119_+	YraN family protein	NA	NA	NA	NA	NA
WP_014117796.1|1825326_1826814_+	threonine synthase	NA	NA	NA	NA	NA
WP_014117797.1|1826919_1827606_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_014117798.1|1827695_1829195_+	trigger factor	NA	NA	NA	NA	NA
WP_014117799.1|1829338_1829920_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	53.4	1.3e-50
WP_014117800.1|1829968_1831288_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.6	1.9e-137
WP_014117801.1|1831364_1833803_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	42.0	6.7e-165
WP_014117802.1|1833882_1834473_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_041615118.1|1834602_1835025_+	YjdF family protein	NA	NA	NA	NA	NA
WP_014117805.1|1835340_1836057_+	UMP kinase	NA	NA	NA	NA	NA
WP_014117806.1|1836062_1836620_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_014117807.1|1836619_1837372_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.8	7.4e-14
WP_014117808.1|1837400_1838243_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_014117809.1|1838297_1839443_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_014117810.1|1839570_1840641_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_014117811.1|1840654_1841692_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_041615119.1|1841719_1845712_+	PolC-type DNA polymerase III	NA	A0A1I9SA84	Rhodococcus_phage	26.2	6.9e-10
WP_014117813.1|1845726_1847070_+	potassium transporter TrkH	NA	NA	NA	NA	NA
WP_014117814.1|1847080_1847728_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_014117815.1|1847805_1848459_-	endonuclease III	NA	NA	NA	NA	NA
WP_014117817.1|1848715_1849096_-	DUF4363 family protein	NA	NA	NA	NA	NA
WP_014117818.1|1849092_1849776_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_014117820.1|1850273_1852112_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	37.4	8.7e-101
WP_014117821.1|1853731_1854529_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	47.5	2.7e-54
WP_014117823.1|1855728_1856526_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	48.3	1.8e-55
WP_014117824.1|1856522_1857740_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	33.9	1.0e-44
WP_145973913.1|1858176_1859266_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.3	3.4e-52
WP_014117826.1|1859336_1859981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117827.1|1860129_1860396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014116391.1|1861565_1862771_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	42.4	2.7e-82
WP_014117828.1|1862896_1863841_-	AEC family transporter	NA	NA	NA	NA	NA
WP_014117829.1|1871557_1872238_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_014117830.1|1872263_1872836_+	manganese efflux pump	NA	NA	NA	NA	NA
WP_014117831.1|1872937_1873882_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_014117832.1|1873974_1875327_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_014117833.1|1875646_1876213_+	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_014117834.1|1876272_1876845_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
1876937:1876953	attL	TCTTAACGCACACTTAA	NA	NA	NA	NA
WP_014117835.1|1877048_1878098_-|integrase	site-specific integrase	integrase	H7BVF7	unidentified_phage	31.5	1.2e-38
WP_014117836.1|1878151_1878460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014117837.1|1878500_1878776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014117838.1|1878786_1879881_-	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	43.7	2.0e-76
WP_014117839.1|1880075_1880438_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014117840.1|1880602_1880896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117841.1|1880957_1881155_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014117842.1|1881209_1881659_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014117843.1|1881661_1882009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117844.1|1882259_1882469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117845.1|1882461_1883220_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014117846.1|1883209_1884565_+	AAA family ATPase	NA	A0A2H4J8K1	uncultured_Caudovirales_phage	30.8	3.4e-25
WP_014117847.1|1884769_1885579_+	ParA family protein	NA	Q71TL9	Escherichia_phage	32.0	6.5e-08
WP_014117848.1|1885571_1887125_+	ParB N-terminal domain-containing protein	NA	H7BUL7	unidentified_phage	28.1	2.7e-10
WP_014117849.1|1887111_1887297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145973917.1|1887302_1887527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117851.1|1887528_1887759_+	helix-turn-helix transcriptional regulator	NA	Q0H244	Geobacillus_phage	41.4	5.0e-06
WP_041615125.1|1887745_1887976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117853.1|1887975_1888392_+	single-stranded DNA-binding protein	NA	A0A0K2CYR2	Paenibacillus_phage	50.0	1.9e-27
WP_014117854.1|1888420_1888627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014117855.1|1888682_1888934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041615126.1|1888949_1889462_+	ASCH domain-containing protein	NA	A0A068CCC0	Rhizobium_phage	28.1	7.3e-05
WP_014117857.1|1889451_1890159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161603850.1|1890249_1890450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117858.1|1890510_1890885_+	HNH endonuclease	NA	A0A218MNA6	uncultured_virus	44.3	3.2e-18
WP_014117859.1|1891117_1891723_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_145974081.1|1891759_1892995_+	ParB N-terminal domain-containing protein	NA	K4HZA5	Acidithiobacillus_phage	43.2	1.9e-83
WP_014117861.1|1892984_1893458_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	40.7	1.2e-22
WP_041615685.1|1893480_1895265_+|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	33.6	4.5e-78
WP_041615127.1|1895266_1895497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145974082.1|1895607_1896720_+|portal	phage portal protein	portal	Q9ZXF8	Bacillus_phage	27.4	7.5e-39
WP_014117865.1|1896712_1897420_+|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	34.6	4.5e-21
WP_014117866.1|1897442_1898744_+|capsid	phage major capsid protein	capsid	A0A1B1IQC5	uncultured_Mediterranean_phage	30.1	1.3e-37
WP_014117867.1|1898763_1899174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117868.1|1899176_1899518_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_014117869.1|1899517_1900090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117870.1|1900089_1900581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117871.1|1900577_1901051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117872.1|1901047_1902130_+	hypothetical protein	NA	A0A0A7S0D2	Clostridium_phage	40.6	6.6e-64
WP_014117873.1|1902145_1902574_+|tail	phage tail tube protein	tail	A0A090DCP2	Clostridium_phage	34.8	2.2e-15
WP_014117874.1|1902573_1902975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117875.1|1903141_1905277_+	tape measure protein	NA	NA	NA	NA	NA
WP_014117876.1|1905286_1905928_+	LysM peptidoglycan-binding domain-containing protein	NA	J9QDY6	Clostridium_phage	31.9	3.1e-21
WP_014117877.1|1906076_1907063_+	hypothetical protein	NA	A0A0A7RTP6	Clostridium_phage	26.3	2.1e-24
WP_041615128.1|1907104_1907521_+	DUF2577 family protein	NA	NA	NA	NA	NA
WP_014117879.1|1907517_1907937_+	DUF2634 domain-containing protein	NA	A0A1V0DZX2	Clostridioides_phage	38.0	7.0e-22
WP_014117880.1|1907929_1909021_+|plate	baseplate J/gp47 family protein	plate	Q24LH1	Clostridium_phage	29.9	2.9e-35
1916946:1916962	attR	TCTTAACGCACACTTAA	NA	NA	NA	NA
>prophage 11
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	2064783	2088790	4410036	coat,protease,transposase	Thermus_virus(16.67%)	27	NA	NA
WP_014118028.1|2064783_2065323_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014118029.1|2065469_2066024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118030.1|2066184_2066409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145974085.1|2066501_2067182_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_145973925.1|2067498_2068038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118034.1|2068712_2068826_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_014118035.1|2068825_2069275_-|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_014118036.1|2069470_2070196_+	N-acetylmuramoyl-L-alanine amidase	NA	C8CHK8	Thermus_virus	31.7	1.5e-08
WP_014118037.1|2070196_2071591_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_014118040.1|2072315_2073323_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	38.5	7.1e-20
WP_161603852.1|2073647_2073794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118041.1|2073786_2074251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118042.1|2074289_2074724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118043.1|2074875_2075343_+	tryptophan-rich sensory protein	NA	A0A1V0S976	Catovirus	27.9	3.5e-06
WP_014118044.1|2075642_2076113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118045.1|2076128_2076332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118047.1|2077252_2077624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118048.1|2077628_2079086_+	recombinase family protein	NA	A0A0A7S0M8	Clostridium_phage	27.6	1.3e-17
WP_083855565.1|2079025_2079622_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_014118050.1|2079757_2081212_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	50.6	3.3e-127
WP_014118051.1|2081271_2083248_-	NAD-dependent DNA ligase LigA	NA	A0A1W6DX16	Sphingobium_phage	36.3	3.8e-102
WP_014118052.1|2083307_2084006_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_041615147.1|2084049_2085429_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_014118054.1|2086059_2086452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118058.1|2087594_2087882_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145973926.1|2088152_2088503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118060.1|2088502_2088790_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	2102597	2166720	4410036	transposase,tRNA,plate,tail	Faecalibacterium_phage(22.22%)	59	NA	NA
WP_014118081.1|2102597_2103731_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.4	4.0e-88
WP_014118082.1|2103740_2103995_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_014118083.1|2104108_2105134_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_014118084.1|2105251_2106787_-	SpoIID/LytB domain-containing protein	NA	NA	NA	NA	NA
WP_014118085.1|2106974_2108066_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014118086.1|2108135_2109740_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.6	1.3e-47
WP_014118087.1|2109838_2111059_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	34.3	2.2e-63
WP_014118088.1|2111471_2112806_-	uracil-xanthine permease	NA	Q9KX94	Enterobacteria_phage	37.6	4.2e-60
WP_014118089.1|2113075_2114245_-	cation transporter	NA	NA	NA	NA	NA
WP_014118090.1|2114340_2114952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118091.1|2115046_2118610_-	helicase-exonuclease AddAB subunit AddA	NA	S5MMD7	Bacillus_phage	24.5	2.3e-17
WP_014118092.1|2118602_2121923_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_014118093.1|2122093_2122705_+	DUF1643 domain-containing protein	NA	A0A2D2W2H2	Stenotrophomonas_phage	30.8	3.1e-10
WP_014118094.1|2122873_2123131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145974087.1|2123203_2123662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118096.1|2123665_2124046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145974088.1|2124090_2124798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118098.1|2124874_2126026_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	28.0	1.6e-23
WP_014118099.1|2126025_2127216_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_014118100.1|2127279_2128287_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014118101.1|2128521_2130021_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014118102.1|2130064_2131072_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	44.7	1.7e-61
WP_014118103.1|2131173_2132583_-	aminopeptidase	NA	NA	NA	NA	NA
WP_014118104.1|2132569_2134243_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	41.8	1.6e-45
WP_014118105.1|2134282_2135344_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	39.7	3.6e-06
WP_014118106.1|2135385_2135886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118107.1|2135920_2136694_-	YdcF family protein	NA	NA	NA	NA	NA
WP_014118108.1|2136690_2138589_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	30.1	8.3e-54
WP_014118109.1|2138598_2139981_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_014118110.1|2139982_2141032_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_014118111.1|2141261_2142245_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_014118112.1|2142360_2143059_-	V-type ATP synthase subunit D	NA	NA	NA	NA	NA
WP_014118113.1|2143071_2144457_-	V-type ATP synthase subunit B	NA	NA	NA	NA	NA
WP_014118114.1|2144456_2146226_-	V-type ATP synthase subunit A	NA	NA	NA	NA	NA
WP_014118115.1|2146300_2146618_-	V-type ATP synthase subunit F	NA	NA	NA	NA	NA
WP_014118116.1|2146631_2147627_-	V-type ATPase subunit	NA	NA	NA	NA	NA
WP_014118117.1|2147654_2148245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118118.1|2148267_2148756_-	V-type ATP synthase subunit K	NA	NA	NA	NA	NA
WP_014118119.1|2148770_2150705_-	V-type ATP synthase subunit I	NA	NA	NA	NA	NA
WP_014118120.1|2150706_2151021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118121.1|2151311_2151872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118122.1|2152504_2152921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145973928.1|2152955_2154045_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.3	1.6e-49
WP_014118123.1|2154538_2155240_-	CHAP domain-containing protein	NA	A0A1B0XTM8	Freshwater_phage	37.7	2.1e-18
WP_014118124.1|2155223_2155601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118125.1|2155614_2155935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118126.1|2155940_2156465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041615152.1|2156477_2156909_-	membrane protein	NA	NA	NA	NA	NA
WP_014118129.1|2157443_2157815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118130.1|2157826_2159323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041615153.1|2159336_2159906_-	hypothetical protein	NA	A0A2K9V337	Faecalibacterium_phage	34.2	3.5e-16
WP_014118132.1|2159898_2161038_-|plate	baseplate J/gp47 family protein	plate	A0A2K9V320	Faecalibacterium_phage	45.9	1.3e-86
WP_014118133.1|2161030_2161324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118134.1|2161338_2161731_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_014118135.1|2161746_2162262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083855567.1|2162264_2163551_-	hypothetical protein	NA	A0A2K9V3Y5	Faecalibacterium_phage	38.8	1.9e-57
WP_083855568.1|2163547_2163760_-|tail	tail protein X	tail	A0A2K9V3Y4	Faecalibacterium_phage	44.6	1.3e-08
WP_014118138.1|2165858_2166152_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_014118139.1|2166204_2166720_-|tail	phage major tail tube protein	tail	A0A0C5AJ56	Bacteriophage	31.8	7.0e-16
>prophage 13
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	2320804	2404142	4410036	capsid,integrase,terminase,holin,transposase,plate,protease,portal,tRNA,tail	Faecalibacterium_phage(26.67%)	107	2352722:2352747	2399796:2399821
WP_014118301.1|2320804_2322499_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	54.5	3.9e-172
WP_041615795.1|2322675_2322921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118304.1|2323169_2323763_-	DUF4093 domain-containing protein	NA	NA	NA	NA	NA
WP_014118305.1|2323759_2324815_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_014118306.1|2324824_2327080_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	32.1	3.0e-26
WP_014118307.1|2327076_2327298_-	helix-turn-helix transcriptional regulator	NA	A0A1L2JY18	Aeribacillus_phage	42.4	2.2e-06
WP_014118308.1|2327405_2327618_-	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	41.9	7.1e-07
WP_041615163.1|2327638_2328727_-	DUF3048 domain-containing protein	NA	NA	NA	NA	NA
WP_041615164.1|2328882_2329431_+	DUF4364 family protein	NA	NA	NA	NA	NA
WP_014118311.1|2329512_2330052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118312.1|2330081_2331107_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_014118313.1|2331365_2331827_-	major facilitator superfamily transporter	NA	NA	NA	NA	NA
WP_014118314.1|2331823_2332309_-	major facilitator superfamily transporter	NA	NA	NA	NA	NA
WP_014118315.1|2332436_2333240_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	47.5	2.0e-54
WP_014118318.1|2335187_2335820_+	undecaprenyl diphosphate synthase family protein	NA	A0A076FI83	Aureococcus_anophage	24.8	1.7e-08
WP_014118319.1|2335972_2336125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118320.1|2336166_2336343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118321.1|2336505_2336688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145973937.1|2336692_2337052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161603859.1|2337446_2337650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145973938.1|2337695_2338121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118324.1|2338190_2338640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118326.1|2339337_2342346_-	M56 family metallopeptidase	NA	NA	NA	NA	NA
WP_014118327.1|2342342_2342714_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_041615166.1|2343197_2343602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118329.1|2344458_2344764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118332.1|2346223_2346481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118333.1|2346590_2346878_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041615167.1|2348852_2349305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118340.1|2350358_2350718_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014118341.1|2350720_2351170_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_145973939.1|2351322_2352403_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.3	1.6e-49
WP_083855573.1|2352400_2352553_-	hypothetical protein	NA	NA	NA	NA	NA
2352722:2352747	attL	TGGTCCGAGTGGCGGGATTTGAACCC	NA	NA	NA	NA
WP_014118343.1|2352901_2353201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118344.1|2353643_2353856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118345.1|2354788_2355286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161603860.1|2355278_2356100_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_014118347.1|2356178_2356739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118348.1|2357220_2357823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070107694.1|2357823_2358231_-	DUF4065 domain-containing protein	NA	A0A0N9SGM1	Paenibacillus_phage	42.1	4.7e-23
WP_014118350.1|2358515_2358986_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_014118351.1|2358975_2359473_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_014118352.1|2359488_2359959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118353.1|2359951_2360614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145973941.1|2360627_2360972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118355.1|2361002_2361329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041615169.1|2361463_2361745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118356.1|2361744_2362587_-	hypothetical protein	NA	A0A0C5AEQ0	Bacteriophage	37.4	1.5e-18
WP_014118357.1|2362602_2363154_-|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	31.9	4.4e-24
WP_014118358.1|2363165_2364080_-	hypothetical protein	NA	A0A2K9V340	Faecalibacterium_phage	27.4	4.8e-15
WP_014118359.1|2364076_2364319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118360.1|2364315_2365422_-|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	44.3	6.5e-75
WP_014118361.1|2365418_2365718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118362.1|2365721_2366594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118363.1|2366607_2366823_-|tail	tail protein X	tail	A0A2K9V353	Faecalibacterium_phage	44.9	1.2e-06
WP_014118364.1|2366815_2368654_-|tail	phage tail tape measure protein	tail	A0A0A7RVT5	Clostridium_phage	37.2	2.4e-50
WP_014118365.1|2368767_2369157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118366.1|2369214_2369733_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	29.4	1.1e-05
WP_014118367.1|2369732_2371187_-|tail	tail sheath protein	tail	A0A0E3U251	Fusobacterium_phage	26.6	5.8e-31
WP_014118368.1|2371205_2371724_-	hypothetical protein	NA	A0A0C5AN06	Bacteriophage	26.8	5.4e-08
WP_014118369.1|2371720_2372347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118370.1|2372351_2372681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118371.1|2372694_2373045_-	Rho termination factor N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_014118372.1|2373054_2374122_-|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	34.6	1.7e-48
WP_014118373.1|2374137_2374485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118374.1|2374500_2375673_-|protease	Clp protease ClpP	protease	A0A2K9V495	Faecalibacterium_phage	32.2	2.9e-41
WP_014118375.1|2375662_2377336_-|portal	phage portal protein	portal	A0A2K9V2Q1	Faecalibacterium_phage	45.8	3.7e-122
WP_014118376.1|2377349_2377592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161603861.1|2377604_2379518_-|terminase	phage terminase large subunit family protein	terminase	A0A2K9V3X4	Faecalibacterium_phage	44.9	3.4e-156
WP_041615170.1|2379453_2379969_-	hypothetical protein	NA	A0A0C5AN04	Bacteriophage	33.6	4.9e-17
WP_161603862.1|2380076_2380283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118379.1|2380491_2380896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118380.1|2380888_2381662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118381.1|2381800_2382280_-	DUF1064 domain-containing protein	NA	NA	NA	NA	NA
WP_014118382.1|2382285_2382579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118383.1|2382556_2382757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118384.1|2382729_2383137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118385.1|2383272_2383548_-	hypothetical protein	NA	A0A218KCM5	Bacillus_phage	46.7	5.8e-09
WP_014118386.1|2383540_2384161_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014118387.1|2384153_2384519_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_049801435.1|2384511_2385024_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_014118389.1|2385020_2385248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118390.1|2385251_2386364_-	DNA polymerase III subunit beta	NA	NA	NA	NA	NA
WP_014118391.1|2386360_2386561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118392.1|2386557_2387085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118393.1|2387068_2387671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118394.1|2387667_2388456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118395.1|2388452_2389676_-	DUF3102 domain-containing protein	NA	NA	NA	NA	NA
WP_014118396.1|2389672_2391436_-	PcfJ domain-containing protein	NA	A0A2H4J308	uncultured_Caudovirales_phage	41.2	6.2e-11
WP_014118397.1|2391445_2391808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118398.1|2391889_2392144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118399.1|2392140_2392407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041615819.1|2392696_2393509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118401.1|2393511_2394222_-	3D domain-containing protein	NA	A0A2K9V442	Faecalibacterium_phage	36.1	4.5e-05
WP_014118402.1|2394429_2394843_+	DUF2513 domain-containing protein	NA	A0A0H4TJ44	Erysipelothrix_phage	33.6	1.3e-07
WP_014118403.1|2395123_2395465_-	hypothetical protein	NA	A0A2K9V3K2	Faecalibacterium_phage	47.1	1.3e-13
WP_014118404.1|2395461_2395620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041615172.1|2395694_2395925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118406.1|2396397_2396598_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_049801438.1|2396828_2397167_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014118408.1|2397346_2398336_+	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
WP_173387012.1|2398372_2398516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118409.1|2398620_2399727_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9V3H5	Faecalibacterium_phage	37.2	1.7e-54
WP_014118410.1|2400180_2401188_+	M23 family metallopeptidase	NA	Q8SBN9	Clostridium_phage	38.3	2.0e-14
2399796:2399821	attR	TGGTCCGAGTGGCGGGATTTGAACCC	NA	NA	NA	NA
WP_014118411.1|2401171_2401825_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_014118413.1|2402152_2402629_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_014118414.1|2402639_2404142_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.4	6.7e-91
>prophage 14
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	2421247	2486868	4410036	tRNA,plate,tail	Bacillus_phage(25.0%)	53	NA	NA
WP_014118433.1|2421247_2422555_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_014118434.1|2422627_2425051_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	38.6	3.6e-102
WP_041615824.1|2425089_2426262_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	35.7	2.7e-23
WP_014118436.1|2426281_2427049_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_014118437.1|2427319_2428042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145973945.1|2428171_2429377_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	40.0	8.2e-15
WP_014118439.1|2429419_2430307_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014118440.1|2430299_2430992_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.1	1.3e-25
WP_014118442.1|2431407_2432769_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_014118443.1|2432761_2433103_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014118446.1|2433772_2434813_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_014118447.1|2435013_2436597_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	27.1	1.6e-13
WP_014117321.1|2437244_2437604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014117322.1|2437624_2438455_-	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_014117323.1|2438471_2439299_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_014117324.1|2439295_2440174_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_014117325.1|2440145_2441027_-	ATPase	NA	NA	NA	NA	NA
WP_041615182.1|2441016_2441382_-	NifB/NifX family molybdenum-iron cluster-binding protein	NA	NA	NA	NA	NA
WP_014118450.1|2441356_2441761_-	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_014118451.1|2441821_2442079_-	DUF5320 domain-containing protein	NA	NA	NA	NA	NA
WP_014118452.1|2442532_2446123_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_014118453.1|2446436_2447069_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161603865.1|2447487_2449356_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_014118455.1|2449370_2449829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118456.1|2449915_2451454_-	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_014118457.1|2451455_2451875_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_014118458.1|2451867_2453526_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_041615184.1|2453522_2455562_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_145973946.1|2455667_2457416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118461.1|2457431_2457725_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_014118462.1|2457749_2459897_-	ATP-binding protein	NA	A0A109WUE1	Acidianus_tailed_spindle_virus	34.1	1.8e-12
WP_014118463.1|2459928_2460306_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_014118464.1|2460330_2461065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161603866.1|2461061_2461652_-	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_014118466.1|2461707_2464110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118467.1|2464137_2464521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118468.1|2464530_2467149_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_041615186.1|2467155_2467881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118470.1|2467914_2469684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118471.1|2469676_2470771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118472.1|2470796_2472863_-|plate	baseplate J/gp47 family protein	plate	NA	NA	NA	NA
WP_014118473.1|2472997_2475922_-|plate	baseplate J/gp47 family protein	plate	NA	NA	NA	NA
WP_014118474.1|2475918_2476338_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_014118475.1|2476360_2477128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118476.1|2477124_2478231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118477.1|2478270_2478990_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_041615187.1|2479079_2482796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118479.1|2482795_2483215_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_014118480.1|2483364_2483838_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_041615836.1|2483850_2484033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118482.1|2484134_2484494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118483.1|2484589_2485069_-|tail	phage tail protein	tail	J9PTZ5	Bacillus_phage	27.6	1.8e-05
WP_014118484.1|2485104_2486868_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	J9PVC2	Bacillus_phage	36.7	8.2e-48
>prophage 15
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	2552118	2624135	4410036	capsid,integrase,transposase,head,protease,tRNA,tail	Bacillus_phage(22.22%)	74	2578887:2578946	2610474:2612070
WP_014118549.1|2552118_2552484_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_041615852.1|2552738_2554112_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.0	5.6e-36
WP_014118551.1|2554174_2556640_+	alpha-ketoacid dehydrogenase subunit alpha/beta	NA	NA	NA	NA	NA
WP_014118552.1|2556749_2557583_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_145973952.1|2557673_2558255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118554.1|2558639_2558843_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_014118555.1|2558976_2559483_+	flavin reductase	NA	NA	NA	NA	NA
WP_014118556.1|2559508_2560798_+	GTPase HflX	NA	NA	NA	NA	NA
WP_014118557.1|2560846_2561482_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	53.5	7.8e-25
WP_041615198.1|2563221_2563695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118560.1|2564143_2565385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118561.1|2565628_2565790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118562.1|2566044_2566743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118563.1|2567000_2567405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118564.1|2568099_2569059_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.0	3.8e-47
WP_014118565.1|2569374_2569962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014116391.1|2571067_2572273_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	42.4	2.7e-82
WP_145973956.1|2572638_2572905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161603868.1|2572995_2573331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118570.1|2573921_2574758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118571.1|2575030_2575963_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_145973957.1|2576054_2576330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118573.1|2576444_2576792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118574.1|2576890_2578090_+	glucosyltransferase	NA	A0A0K0WSC2	Clostera_anastomosis_granulovirus	25.0	2.0e-05
WP_014118575.1|2578162_2578363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145974095.1|2578469_2578784_+	hypothetical protein	NA	NA	NA	NA	NA
2578887:2578946	attL	TTTTGGTACTATAAAAAGCGTAAGTGTAGGACGCCGACGGGCGTTTCACATTTGCGCTTA	NA	NA	NA	NA
WP_014118578.1|2579153_2580359_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	42.6	1.9e-83
WP_014118579.1|2580431_2581085_-	LysM peptidoglycan-binding domain-containing protein	NA	J9QDY6	Clostridium_phage	31.4	9.2e-21
WP_014118580.1|2581089_2583183_-	tape measure protein	NA	NA	NA	NA	NA
WP_014118582.1|2583588_2583990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014117873.1|2583989_2584418_-|tail	phage tail tube protein	tail	A0A090DCP2	Clostridium_phage	34.8	2.2e-15
WP_014118583.1|2584433_2585516_-	hypothetical protein	NA	A0A0A7S0D2	Clostridium_phage	39.7	6.1e-62
WP_014117871.1|2585512_2585986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014117870.1|2585982_2586474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014117869.1|2586473_2587046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014117868.1|2587045_2587387_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_014117867.1|2587389_2587800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014117866.1|2587819_2589121_-|capsid	phage major capsid protein	capsid	A0A1B1IQC5	uncultured_Mediterranean_phage	30.1	1.3e-37
WP_014117865.1|2589143_2589851_-|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	34.6	4.5e-21
WP_014118585.1|2590819_2591023_-	ParA family protein	NA	NA	NA	NA	NA
WP_041615203.1|2591230_2592628_-	hypothetical protein	NA	A0A127KNK8	Pseudomonas_phage	29.5	2.7e-33
WP_014118587.1|2592624_2593407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118588.1|2593396_2593609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118589.1|2593861_2594092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118590.1|2594094_2594544_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014118591.1|2594598_2594796_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014118592.1|2594882_2595074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118593.1|2595098_2595260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041615205.1|2595476_2595830_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041615206.1|2596024_2596552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118595.1|2596627_2596936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083855586.1|2596981_2598103_+|integrase	tyrosine-type recombinase/integrase	integrase	H7BVI2	unidentified_phage	29.4	2.3e-27
WP_014118597.1|2598662_2599229_+	DUF3793 family protein	NA	NA	NA	NA	NA
WP_014118598.1|2599269_2599701_+	flavodoxin	NA	NA	NA	NA	NA
WP_014118599.1|2599863_2600043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118600.1|2600390_2601068_+	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_049801448.1|2601368_2603459_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	77.5	6.4e-07
WP_014118602.1|2603527_2603986_-	VOC family protein	NA	NA	NA	NA	NA
WP_014118603.1|2604018_2604657_-	stage II sporulation protein R	NA	NA	NA	NA	NA
WP_014118604.1|2604749_2605613_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_014118605.1|2605609_2606125_-	DUF1273 family protein	NA	A7KVA9	Bacillus_phage	33.5	4.6e-15
WP_014118578.1|2609060_2610266_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	42.6	1.9e-83
WP_014118611.1|2611483_2611771_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014118612.1|2612219_2612843_+	ECF transporter S component	NA	NA	NA	NA	NA
2610474:2612070	attR	TAAGCGCAAATGTGAAACGCCCGTCGGCGTCCTACACTTACGCTTTTTATAGTACCAAAAGGGGCCTCGCAAGAATGTGGTGGAGCAGTCAAGAACCGTGCAGAATGTGAACGCCCAAAATCTGCGGCTTATGCGGCCAGGCCTCTGGCGGCCTGACGATACGCGGCCGGCGGCAGGCCGCCGGGGTTGGCAGTGTAGATTTGCCGGCGGTTATAGTAGGTCATGATGTACCGGAACACGATGCTCTTCACCTGTGCCATGGGCATCTGCTCCGCCCTGATTCGATAGAGTTTTTCTTTCTTCAACGTAGCAAAAAAACTCTCCATTCTGGCGTTGTCGTAGCAGTGTCCCGTGCCGCTCATGCTTTGAACCGCGCCGTATTGCGCCAGCACCTTTTGAAATGAGGAGCTGGTAAATTGGTTTCCGCGGTCGCTGTGCAGGGTCATTCCATAGGCTCCCTGCGCCTGGCAGACAGGCCGGAAAGCCCGGATACACAGCTCCTTCTTCATGTTGTCATCCATGGCAAGACCGACGATCTCTCCGTTATAACAGTCCAGAACTGCCGCCAGGTACAGCTTGCCGTCCTGACACTGGATCTGCGTGATATCTGTCAGCCACTTCCGGTTAGGGGTGTCTGCGGTAAAATCCCGGTGAATCAGGTTCTCCGCCTTCTGCGCAGCCAAGTCTGCTTTTGTCAGACTGTTGGAGTGACGAGGAGCGCGATGGCAGGCCTTCACGCTTCATGGCCCGCCGTACGCTGCTGCGGCTTATCGCGATACCGCGCTGCGTAAGCGCCAGAAGGATTCGGCCAACACCATAATTGTCATTGTCCGGATTTTCATTGTAAATCTCTCGTATTTTGACCAGAAGCAGCTGCCACGGTTTTGGCTTGCCAGCCGACTGCAAAGAGCGGTAGTACCCGGATTCGCTGACTTTCACAACCCGGCACATGGCATGAACGCAGAACCGCTCACGGCGCAGCGTGATGTACTCATACAACCGCTCCGGCTTTACCGTTTCCGGTCTTTGGCGAAAAAGCCCAGCGCATCCTTGAGAATCTCATTGGCTTTCCGCTGTTCCGTGATTTCCTTCATCAGCCAGCGCTCGTTCTCGGAAAGCGGCGCGTCGCGGCGAATGCCGCTGCCGACGAAGGCGTGGTCTCCAAATGCCTTTCGCTTTTGCCGCCGCTCCGCCAGAGAGTAGTACGAAATGCCCAGCTGTGCCGCCGCCTGCTTCACGCCGATTTCATCGGACAGCTTGACCGCTTCTTCTTTGAATTCCTTGTCATATTTGCGCATTGCAAACACCACCTTGTTCTTCCTTTGATTCTATCACTTTTGGGGTGTTTGTCCTCTGCACTTCTATGATATCCCTCCAGAAGTTAAGCTTTCAACTCAAAATTGCGAAAAATAGCGGATTGTTCCCTCCGGTCATATTTTCCTCTTGCTTTTTTGTTTGAGGAGTCGTATACTGTTTGGCAGAAAGCAACTGAATACGTGTCTTCAGGGCGGGGTGTGACTCCCCACCGGCGGTATAGTCCGCGACCGGCCACCTGAAAGGGTGTCCGTTGACCCGGTGAGACTCCGGGACCGACAGT	NA	NA	NA	NA
WP_049801449.1|2612914_2614837_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_014118614.1|2614923_2615766_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	31.5	1.1e-26
WP_014118615.1|2615984_2617553_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_014118616.1|2617635_2619084_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	47.8	1.7e-120
WP_014118618.1|2619303_2620152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118619.1|2620347_2620575_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_014118620.1|2620571_2622572_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_145973959.1|2622584_2622716_+	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_041615862.1|2622831_2623011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145974096.1|2623145_2624135_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
>prophage 16
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	2696886	2761790	4410036	transposase	Bacillus_phage(50.0%)	52	NA	NA
WP_083855591.1|2696886_2697771_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	37.8	1.9e-40
WP_161603869.1|2698048_2698378_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014118707.1|2698368_2698578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118708.1|2698923_2700174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118709.1|2700158_2700896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118710.1|2700897_2701407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161603870.1|2701748_2702012_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_145973842.1|2702422_2703513_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.1	2.4e-50
WP_014118712.1|2703644_2704460_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_014118713.1|2704796_2705873_-	DUF4179 domain-containing protein	NA	NA	NA	NA	NA
WP_145974099.1|2705872_2706292_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_083855593.1|2707075_2707525_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014118718.1|2707525_2708977_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	49.9	4.9e-123
WP_014117501.1|2710078_2711212_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_014116272.1|2711229_2712030_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_014116271.1|2712044_2713181_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_014116010.1|2713199_2714687_-	4-hydroxybutyryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_041615223.1|2714781_2715561_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_014118721.1|2715635_2719163_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_014118722.1|2719453_2720608_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_014118723.1|2720926_2722168_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_014118724.1|2722662_2723439_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041615884.1|2723613_2724048_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014118726.1|2724059_2724491_+	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_014118727.1|2724645_2725560_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.8	1.3e-17
WP_014118728.1|2725556_2726411_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_041615224.1|2726526_2726907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118730.1|2727063_2727513_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014118731.1|2727523_2729275_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.2	3.1e-39
WP_014118732.1|2729267_2731193_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.8	4.6e-36
WP_161603871.1|2731320_2731659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118733.1|2731688_2733494_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	25.1	9.4e-15
WP_014118734.1|2733490_2734294_+	response regulator	NA	NA	NA	NA	NA
WP_014118736.1|2734562_2744228_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_014118738.1|2745164_2745380_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_014118739.1|2745593_2746718_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014118740.1|2746731_2747322_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161603872.1|2748433_2748754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118746.1|2751076_2752450_-	citrate synthase	NA	NA	NA	NA	NA
WP_014118747.1|2752717_2753437_-	NAD-dependent protein deacylase	NA	S5M4R0	Bacillus_phage	33.5	1.0e-28
WP_014118748.1|2753485_2753821_+	ArsC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014118749.1|2754111_2755374_+	putative DNA modification/repair radical SAM protein	NA	NA	NA	NA	NA
WP_014118750.1|2755389_2756190_+	TIGR03915 family putative DNA repair protein	NA	NA	NA	NA	NA
WP_145973966.1|2756279_2757152_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.7	8.0e-28
WP_014118752.1|2757163_2757451_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014118753.1|2757666_2758377_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0Y0AU18	Bacillus_phage	37.6	5.0e-36
WP_014118754.1|2758373_2758820_-	anti-sigma F factor	NA	NA	NA	NA	NA
WP_014118755.1|2758816_2759137_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_014118757.1|2759711_2760680_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_014118758.1|2760781_2760979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161603873.1|2761159_2761402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118761.1|2761577_2761790_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	2962633	3032600	4410036	integrase,transposase	Bacillus_phage(20.0%)	64	2987331:2987361	3034728:3034742
WP_014119942.1|2962633_2963839_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	42.6	6.4e-84
WP_014116692.1|2964310_2965108_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	47.1	7.7e-54
WP_145974107.1|2966449_2967427_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_014118957.1|2967747_2968350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118958.1|2968390_2969749_-	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_014118960.1|2970021_2970513_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_014117418.1|2970590_2971520_+	DUF4367 domain-containing protein	NA	NA	NA	NA	NA
WP_014117419.1|2971526_2971952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014117420.1|2972087_2972498_+	RNA polymerase subunit sigma-72	NA	NA	NA	NA	NA
WP_014117421.1|2972844_2973045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118961.1|2973182_2973329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041615252.1|2973408_2973840_+	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	34.0	7.2e-06
WP_161603876.1|2973985_2974885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041615256.1|2974868_2975387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041615258.1|2975565_2976168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118965.1|2976164_2976770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083855604.1|2976828_2977182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118966.1|2977281_2977992_-	DUF4367 domain-containing protein	NA	NA	NA	NA	NA
WP_014118967.1|2977988_2978513_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_014118968.1|2978550_2979504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041615260.1|2980030_2980339_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_014118971.1|2982049_2984116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118972.1|2984096_2986343_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_014118973.1|2986526_2987111_+	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
2987331:2987361	attL	TTGTTTGGATAATTCCATAGCACGAAACCGC	NA	NA	NA	NA
WP_014116732.1|2987541_2988636_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
2987331:2987361	attL	TTGTTTGGATAATTCCATAGCACGAAACCGC	NA	NA	NA	NA
WP_014116731.1|2988691_2989507_-|integrase	site-specific integrase	integrase	W8EHC2	Mycobacterium_phage	31.1	5.9e-09
WP_014118974.1|2989987_2991316_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_014116319.1|2992128_2992416_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014118976.1|2992698_2994267_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.6	4.3e-24
WP_145973975.1|2994493_2995584_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.1	9.9e-52
WP_014118981.1|2996788_2996983_-|transposase	transposase	transposase	NA	NA	NA	NA
2995880:2995910	attR	TTGTTTGGATAATTCCATAGCACGAAACCGC	NA	NA	NA	NA
WP_014118143.1|2997131_2997929_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	48.3	1.4e-55
2995880:2995910	attR	TTGTTTGGATAATTCCATAGCACGAAACCGC	NA	NA	NA	NA
WP_145973862.1|2997925_2998159_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014118982.1|2998146_2998434_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014118983.1|2998414_2998873_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	40.0	4.9e-21
WP_014116262.1|3001001_3001160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118987.1|3001304_3001814_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_041615264.1|3001859_3003161_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_014118989.1|3003529_3004213_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014118990.1|3004190_3005387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014118991.1|3005663_3006008_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_014118992.1|3006020_3006311_+	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_014118993.1|3006548_3007364_+|integrase	site-specific integrase	integrase	W8EHC2	Mycobacterium_phage	30.5	1.7e-08
WP_014118995.1|3008789_3010373_-	hypothetical protein	NA	F2QAF9	Pyramimonas_orientalis_virus	24.1	2.1e-10
WP_161603877.1|3011358_3012261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118998.1|3012703_3013609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014118999.1|3013665_3014184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041615270.1|3014235_3014808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014119001.1|3015063_3015516_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014119002.1|3015512_3016847_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_041615272.1|3016984_3017494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145973976.1|3017696_3018032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083855605.1|3018039_3018438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119006.1|3019696_3020596_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	21.0	1.5e-05
WP_014119007.1|3021370_3022084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145973978.1|3022109_3022532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119010.1|3023173_3024421_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_014119011.1|3024407_3025316_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_014119012.1|3025781_3027239_+	DUF2828 family protein	NA	A0A218KCC5	Bacillus_phage	40.7	6.3e-94
WP_014119013.1|3027260_3028469_+	RNA-splicing ligase RtcB	NA	A0A223LGY9	Bacillus_phage	51.0	1.2e-111
WP_014119014.1|3028820_3029828_-	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_014119015.1|3029981_3030605_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_014119016.1|3030918_3031890_-|integrase	site-specific integrase	integrase	S5MBZ0	Brevibacillus_phage	24.4	4.1e-17
WP_014119017.1|3031886_3032600_-|integrase	site-specific integrase	integrase	A0A2P1JS61	Mycobacterium_phage	29.0	2.8e-07
3034728:3034742	attR	AATTTACTGAAGAAG	NA	NA	NA	NA
>prophage 18
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	3097282	3157840	4410036	transposase	Bacillus_phage(60.0%)	56	NA	NA
WP_014118564.1|3097282_3098242_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.0	3.8e-47
WP_014119114.1|3098320_3098530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014119115.1|3098553_3099345_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_154652488.1|3099672_3099927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014119118.1|3099923_3100652_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014119120.1|3101138_3101723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041615949.1|3101819_3103217_-	2-hydroxycarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_014119122.1|3103308_3104484_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_014119123.1|3104819_3106427_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_145973985.1|3106377_3107109_+	response regulator	NA	W8CYM9	Bacillus_phage	27.9	2.9e-07
WP_014119125.1|3107809_3108274_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_014119127.1|3108848_3109718_-	radical SAM protein	NA	NA	NA	NA	NA
WP_161603883.1|3109880_3110132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119129.1|3110131_3110350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119130.1|3110434_3110821_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_014119132.1|3111389_3112535_+	radical SAM protein	NA	NA	NA	NA	NA
WP_014119133.1|3112531_3113155_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014119134.1|3113311_3114445_+	DUF5050 domain-containing protein	NA	NA	NA	NA	NA
WP_014119135.1|3114557_3115175_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014119136.1|3115670_3116786_-	alanine racemase	NA	NA	NA	NA	NA
WP_145974109.1|3116809_3118231_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_014119138.1|3118524_3119748_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	24.4	2.0e-24
WP_014119139.1|3119731_3120652_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_014119140.1|3120664_3121885_-	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_014119141.1|3121933_3123007_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_014119142.1|3123193_3124087_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_145973986.1|3125400_3126252_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.2	7.3e-26
WP_014119146.1|3126263_3126551_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145973987.1|3126617_3126800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161603884.1|3127025_3127211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014119149.1|3127456_3128737_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_014119150.1|3128733_3129264_-	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
WP_014119151.1|3129308_3130373_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014119152.1|3130400_3131279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119153.1|3131535_3133521_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014116271.1|3133822_3134959_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_014116010.1|3134977_3136465_-	4-hydroxybutyryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_014119155.1|3136579_3137497_-	AEC family transporter	NA	NA	NA	NA	NA
WP_014119156.1|3137506_3138439_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_161603885.1|3138356_3138668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119157.1|3138902_3139379_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_014119160.1|3140140_3140833_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_014119162.1|3141255_3142776_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_161603886.1|3142886_3143597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119164.1|3144044_3144806_+	DUF169 domain-containing protein	NA	NA	NA	NA	NA
WP_145973988.1|3144863_3145661_+	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_014119166.1|3145944_3147138_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_014119167.1|3147152_3148562_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_014119169.1|3149065_3150277_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_014119172.1|3151322_3152012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041615310.1|3152953_3154552_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_014119175.1|3154566_3155529_+	D-2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_014119176.1|3155530_3156709_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_014116576.1|3156793_3157141_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_161603825.1|3157137_3157383_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_014116578.1|3157321_3157840_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.2	1.8e-43
>prophage 19
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	3182850	3245993	4410036	transposase,protease	Bacillus_phage(20.0%)	57	NA	NA
WP_173387024.1|3182850_3183651_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_014119201.1|3183892_3188722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014119202.1|3188718_3189357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014119203.1|3189361_3190609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014119204.1|3190621_3191662_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014119205.1|3191699_3192386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119206.1|3192382_3193123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119207.1|3193128_3193470_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014119208.1|3193589_3194540_-	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_014119209.1|3194562_3195771_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_014119210.1|3195944_3197144_+	acetate kinase	NA	NA	NA	NA	NA
WP_014119211.1|3197405_3198383_+	serine hydrolase	NA	NA	NA	NA	NA
WP_014119212.1|3198632_3199085_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_014119213.1|3199211_3200147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161603887.1|3200322_3201249_-	DUF4179 domain-containing protein	NA	NA	NA	NA	NA
WP_014119215.1|3201352_3201841_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_014119216.1|3202076_3203597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119217.1|3203805_3204198_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_014119218.1|3204194_3207251_+	peptidase M56 family protein	NA	NA	NA	NA	NA
WP_014119219.1|3207679_3207910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119220.1|3208015_3208303_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_083855685.1|3208362_3208611_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_083855611.1|3208568_3209138_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.8	6.6e-23
WP_154652489.1|3209182_3209323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041615314.1|3209339_3209822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119224.1|3210333_3210687_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_014119225.1|3210673_3211000_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_014119226.1|3211113_3212277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070107709.1|3214374_3214953_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_014119230.1|3215254_3216424_-	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_014119231.1|3216467_3217799_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_014119232.1|3217795_3220591_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_014119233.1|3220609_3221212_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_154652490.1|3221267_3221408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041615316.1|3221428_3223471_-	serine/threonine-protein kinase	NA	A0A1V0SBS0	Catovirus	35.4	7.9e-10
WP_014119235.1|3223496_3223781_-	DUF4176 domain-containing protein	NA	NA	NA	NA	NA
WP_145973989.1|3223843_3224962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119237.1|3225086_3225401_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_014119238.1|3225431_3225734_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_014119239.1|3225793_3226111_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_014119240.1|3226124_3226460_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_014119241.1|3226461_3226779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041615317.1|3226795_3227137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119243.1|3227234_3227483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119244.1|3227507_3228173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119245.1|3228169_3228886_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014119246.1|3228889_3233842_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	22.8	1.2e-24
WP_014119247.1|3233854_3235108_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_014119248.1|3235104_3236250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119249.1|3236246_3237455_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014119250.1|3237469_3239182_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_041615318.1|3239251_3239929_-	ABC transporter ATP-binding protein	NA	A0A2I4R674	Erysipelothrix_phage	28.4	4.8e-12
WP_014119252.1|3239904_3240333_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_083855614.1|3240382_3242521_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_014119258.1|3244116_3245115_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_161603888.1|3245038_3245581_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.4	7.6e-37
WP_014119260.1|3245684_3245993_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 20
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	3269333	3310292	4410036	integrase,transposase	Bacillus_phage(20.0%)	37	3283126:3283141	3316622:3316637
WP_014117314.1|3269333_3270389_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	39.4	1.1e-31
WP_049801467.1|3270491_3271904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014119285.1|3271927_3272347_+	TerB family tellurite resistance protein	NA	NA	NA	NA	NA
WP_014119286.1|3272363_3273737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014119287.1|3274106_3274490_+	DUF3846 domain-containing protein	NA	A0A2K9V361	Faecalibacterium_phage	45.1	6.0e-20
WP_014119288.1|3274482_3274755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014119290.1|3275054_3276002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161603889.1|3276115_3277702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119292.1|3277893_3279456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014119293.1|3279507_3280776_+	ATP-dependent DNA helicase RecQ	NA	Q9DSV4	Diadromus_pulchellus_ascovirus	33.1	5.2e-44
WP_145973994.1|3280783_3281002_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014119295.1|3281076_3282285_+|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	32.7	9.0e-38
WP_014119296.1|3283102_3283987_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
3283126:3283141	attL	GCACCTCCAATTCTGC	NA	NA	NA	NA
WP_014119297.1|3283983_3284766_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014119298.1|3284762_3285053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119299.1|3285304_3286024_+	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_014119300.1|3286049_3286691_+	cytidylate kinase-like family protein	NA	NA	NA	NA	NA
WP_014119301.1|3286704_3287262_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014119302.1|3287392_3288049_+	DUF4230 domain-containing protein	NA	NA	NA	NA	NA
WP_014119303.1|3288193_3292099_-	PAS domain-containing hybrid sensor histidine kinase/response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	29.3	4.2e-36
WP_014119304.1|3292213_3292873_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_014119306.1|3293222_3294566_+	putative aminohydrolase SsnA	NA	NA	NA	NA	NA
WP_014119307.1|3294658_3297607_+	putative selenate reductase subunit YgfK	NA	NA	NA	NA	NA
WP_014119308.1|3297966_3299172_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	29.5	4.7e-10
WP_014119309.1|3299273_3301382_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.4	5.2e-57
WP_173387015.1|3301393_3301864_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_014119311.1|3301991_3302408_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_041615323.1|3302510_3302753_-	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_014119313.1|3302818_3303046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014119314.1|3303224_3303620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014119315.1|3303693_3304389_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	33.0	3.9e-25
WP_083855617.1|3304951_3305464_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.0	3.2e-21
WP_083855686.1|3305421_3305670_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014119319.1|3305729_3306017_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014116730.1|3307327_3308143_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041615980.1|3308326_3309142_+|integrase	tyrosine-type recombinase/integrase	integrase	W8EHC2	Mycobacterium_phage	31.1	5.9e-09
WP_014116732.1|3309197_3310292_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
3316622:3316637	attR	GCACCTCCAATTCTGC	NA	NA	NA	NA
>prophage 21
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	3318352	3354267	4410036	transposase	Bacillus_phage(14.29%)	29	NA	NA
WP_083855619.1|3318352_3318652_+|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_014119332.1|3319166_3320756_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_083855620.1|3320992_3321562_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.2	7.3e-22
WP_014117545.1|3321519_3321789_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_014119334.1|3321848_3322136_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014119337.1|3324324_3325515_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_014119338.1|3325663_3327097_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_014119339.1|3327198_3328674_-	4-hydroxybutyryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_014119340.1|3328687_3332194_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_014119341.1|3333263_3333911_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161603890.1|3334447_3334927_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	37.7	4.4e-20
WP_014116336.1|3334877_3335324_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	39.6	1.2e-19
WP_014119344.1|3335493_3335691_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014119345.1|3336009_3336450_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_014119346.1|3336409_3336739_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	37.5	2.5e-11
WP_014119347.1|3337247_3338009_-	type I 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_014119348.1|3338052_3338913_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_014119349.1|3338949_3340470_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_014119350.1|3340486_3341029_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_014119351.1|3341117_3342149_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_161603891.1|3342568_3343468_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014119353.1|3343564_3344386_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_014117464.1|3344773_3345961_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_014117465.1|3345965_3346775_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_014117466.1|3346966_3348403_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_014119354.1|3348677_3350513_-	thiamine pyrophosphate-binding protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	28.0	2.3e-45
WP_014119355.1|3350609_3351527_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041615326.1|3352408_3353050_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	54.3	1.9e-47
WP_014119357.1|3353037_3354267_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	33.5	4.5e-45
>prophage 22
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	3389023	3456136	4410036	integrase,transposase,protease	Bacillus_phage(27.78%)	58	3446679:3446693	3463669:3463683
WP_014119396.1|3389023_3390304_+|protease	serine protease	protease	NA	NA	NA	NA
WP_014119397.1|3390434_3390869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014119398.1|3390924_3392094_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.5	1.4e-56
WP_041615329.1|3392372_3392984_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_014119400.1|3392993_3393248_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014119401.1|3393366_3394821_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	50.6	5.6e-127
WP_014119402.1|3394891_3397324_-	glycogen/starch/alpha-glucan phosphorylase	NA	NA	NA	NA	NA
WP_014119403.1|3397320_3399123_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_014119404.1|3399189_3400305_-	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_014119405.1|3400301_3401510_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_049801480.1|3401522_3403550_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_014119407.1|3403822_3404251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119408.1|3404512_3406405_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	33.2	9.3e-90
WP_049801481.1|3406703_3407699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014119410.1|3407826_3408348_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_014119411.1|3408354_3409671_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_145974111.1|3409767_3410352_-	RecX family transcriptional regulator	NA	NA	NA	NA	NA
WP_014119413.1|3410389_3411511_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	65.2	2.5e-119
WP_014119414.1|3411631_3412498_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_014119415.1|3412527_3413493_-	DUF1385 domain-containing protein	NA	NA	NA	NA	NA
WP_014119416.1|3413641_3415087_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	28.2	1.7e-14
WP_014119417.1|3415123_3415810_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.3	3.3e-29
WP_145973998.1|3415837_3417187_-	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_014119419.1|3418349_3419657_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.0	3.7e-61
WP_014119421.1|3420968_3421256_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014119422.1|3421590_3421803_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	58.2	2.7e-14
WP_014119423.1|3421913_3422432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014119424.1|3422433_3422778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014119942.1|3422854_3424060_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	42.6	6.4e-84
WP_014119425.1|3424409_3426086_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.3	2.4e-57
WP_041615330.1|3426887_3428525_-	recombinase family protein	NA	A0A0U4IB69	Exiguobacterium_phage	22.2	8.8e-12
WP_014116832.1|3428660_3428840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119427.1|3429370_3429796_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_014119429.1|3430535_3431180_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.6	1.6e-33
WP_014119430.1|3431191_3431908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145974000.1|3431916_3432780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119432.1|3432769_3433312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119434.1|3434570_3435368_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	49.2	3.7e-56
WP_014119437.1|3437007_3437946_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	4.7e-26
WP_014119438.1|3437958_3438699_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014119439.1|3438695_3439676_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014119440.1|3439751_3442373_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041615331.1|3442460_3443732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041616015.1|3443886_3444654_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_145974112.1|3444950_3445526_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_014119444.1|3445614_3446148_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014119445.1|3446368_3446809_+	response regulator	NA	W8CYM9	Bacillus_phage	61.5	1.3e-42
3446679:3446693	attL	AACCGGCAGAGCTTA	NA	NA	NA	NA
WP_014119446.1|3446805_3447900_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	48.4	3.1e-69
WP_014119447.1|3447979_3448363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014119448.1|3448366_3448771_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_041616017.1|3448789_3449281_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014119450.1|3449420_3450797_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_041616018.1|3450938_3451550_+	cytidylate kinase-like family protein	NA	NA	NA	NA	NA
WP_145974002.1|3451607_3452996_+	radical SAM protein	NA	NA	NA	NA	NA
WP_014119453.1|3453220_3453460_+	DegV family protein	NA	NA	NA	NA	NA
WP_014119457.1|3454777_3455575_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	47.5	2.7e-54
WP_014119458.1|3455636_3455753_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2I6AZV9	Macacine_betaherpesvirus	72.7	3.3e-06
WP_083855687.1|3455962_3456136_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
3463669:3463683	attR	AACCGGCAGAGCTTA	NA	NA	NA	NA
>prophage 23
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	3599678	3607757	4410036	transposase	Bacillus_phage(100.0%)	12	NA	NA
WP_083855627.1|3599678_3600110_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_083855628.1|3600186_3600369_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_145974009.1|3600414_3601287_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.9	1.8e-27
WP_014119615.1|3601298_3601586_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014119616.1|3601964_3602438_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014119617.1|3602434_3604201_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	20.3	1.3e-16
WP_014119618.1|3604190_3605843_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_014119619.1|3606007_3606355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119620.1|3606303_3606642_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_145974010.1|3606652_3607165_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	38.7	2.5e-21
WP_145974117.1|3607161_3607410_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_014119220.1|3607469_3607757_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 24
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	3617442	3648077	4410036	integrase,transposase	Bacillus_phage(33.33%)	27	3635161:3635176	3652072:3652087
WP_014119638.1|3617442_3617730_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014117565.1|3617789_3618059_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_083855630.1|3618016_3618586_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	38.4	3.9e-23
WP_014119640.1|3618789_3619656_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_014119641.1|3619675_3620536_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_161603899.1|3622516_3622699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014119644.1|3622834_3623818_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	47.0	8.6e-79
WP_014119645.1|3624152_3624440_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_161603900.1|3627113_3627467_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_161603901.1|3627438_3627756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119648.1|3627792_3628488_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_014119649.1|3628586_3629990_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_083855632.1|3630135_3630405_-	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_014119650.1|3631099_3631825_-	DUF4428 domain-containing protein	NA	NA	NA	NA	NA
WP_014119651.1|3631849_3633178_-	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_014119652.1|3633657_3634131_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_014119653.1|3634132_3634966_-	FAD binding domain-containing protein	NA	NA	NA	NA	NA
3635161:3635176	attL	CAAAGCCCACCAAATA	NA	NA	NA	NA
WP_041616041.1|3638516_3638978_+	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_014119660.1|3639301_3641446_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_014119661.1|3641461_3641698_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_041616042.1|3641807_3642230_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_014119665.1|3644128_3644416_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145974015.1|3644822_3645176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119667.1|3645177_3646803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145974118.1|3646904_3647273_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6J1X2	Lactobacillus_phage	34.6	4.6e-09
WP_014119669.1|3647731_3647917_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_014119670.1|3647927_3648077_-|transposase	transposase	transposase	NA	NA	NA	NA
3652072:3652087	attR	TATTTGGTGGGCTTTG	NA	NA	NA	NA
>prophage 25
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	3883483	3948022	4410036	integrase,capsid,terminase,transposase,head,protease,portal,tRNA,tail	Erysipelothrix_phage(57.58%)	63	3903948:3903963	3915024:3915039
WP_014119894.1|3883483_3885349_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_014119895.1|3885432_3886107_+	cyclase family protein	NA	NA	NA	NA	NA
WP_014119896.1|3886103_3887438_+	Mur ligase family protein	NA	NA	NA	NA	NA
WP_014119897.1|3887439_3888174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014119898.1|3888258_3888894_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_014119899.1|3888890_3889781_-	diacylglycerol kinase family lipid kinase	NA	NA	NA	NA	NA
WP_014119900.1|3889958_3891194_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_041615362.1|3891360_3892920_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014119902.1|3892967_3893912_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014119903.1|3893908_3894742_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014119904.1|3894734_3895520_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	2.4e-15
WP_014119905.1|3895598_3896333_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	3.3e-19
WP_014119906.1|3896337_3897426_+	DUF3810 domain-containing protein	NA	NA	NA	NA	NA
WP_014119908.1|3897969_3899736_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_014119910.1|3899877_3903471_-	response regulator	NA	A0A1V0SGX0	Hokovirus	26.9	9.9e-40
WP_014119911.1|3903731_3905930_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.1	2.5e-09
3903948:3903963	attL	AGGCATTACGGCCACG	NA	NA	NA	NA
WP_145974123.1|3906475_3907423_-|integrase	tyrosine-type recombinase/integrase	integrase	H7BVI2	unidentified_phage	28.2	7.3e-19
WP_014119913.1|3907655_3907874_-	DUF4368 domain-containing protein	NA	NA	NA	NA	NA
WP_014119914.1|3907902_3908847_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	29.3	3.6e-26
WP_014119915.1|3909089_3910361_+	SLC13/DASS family transporter	NA	NA	NA	NA	NA
WP_014119916.1|3910382_3911426_+	C-terminal binding protein	NA	NA	NA	NA	NA
WP_014119917.1|3911447_3912131_+	RraA family protein	NA	NA	NA	NA	NA
WP_041615364.1|3912365_3912983_-	helix-turn-helix domain-containing protein	NA	A0A2K9V3G4	Faecalibacterium_phage	26.1	6.5e-16
WP_014119919.1|3913133_3913343_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041615365.1|3913364_3913592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014119920.1|3913729_3914290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161603906.1|3914382_3914979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014119922.1|3914994_3915714_+	hypothetical protein	NA	NA	NA	NA	NA
3915024:3915039	attR	AGGCATTACGGCCACG	NA	NA	NA	NA
WP_014119923.1|3915803_3917486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041615367.1|3917502_3917853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145974021.1|3917875_3918226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083855646.1|3918129_3918678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119928.1|3919210_3921127_-	siphovirus ReqiPepy6 Gp37-like family protein	NA	A0A0K2CZQ1	Paenibacillus_phage	32.5	9.6e-42
WP_014119929.1|3921129_3921981_-|tail	phage tail family protein	tail	A0A2K9V3G8	Faecalibacterium_phage	27.7	3.2e-13
WP_014119932.1|3924483_3924660_-	hypothetical protein	NA	A0A2K5B296	Erysipelothrix_phage	65.9	2.6e-10
WP_014119933.1|3924671_3925079_-	hypothetical protein	NA	A0A2K5B295	Erysipelothrix_phage	69.8	2.6e-42
WP_014119934.1|3925091_3925682_-|tail	phage tail protein	tail	A0A2K5B294	Erysipelothrix_phage	70.5	6.5e-74
WP_014119935.1|3925685_3926027_-	hypothetical protein	NA	A0A2K5B293	Erysipelothrix_phage	52.3	2.6e-27
WP_041616105.1|3926023_3926455_-	HK97 gp10 family phage protein	NA	A0A2K5B292	Erysipelothrix_phage	65.0	1.1e-46
WP_014119937.1|3926460_3926796_-|head,tail	head-tail adaptor protein	head,tail	A0A2K5B291	Erysipelothrix_phage	59.1	4.6e-32
WP_014119938.1|3926797_3927148_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2K5B290	Erysipelothrix_phage	71.8	8.4e-37
WP_014119939.1|3927166_3928375_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	82.6	6.0e-191
WP_014119940.1|3928394_3929084_-|protease	Clp protease ClpP	protease	Q6DMU1	Streptococcus_phage	62.4	2.9e-73
WP_014119941.1|3929080_3930337_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	71.9	1.7e-172
WP_014119942.1|3930482_3931688_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	42.6	6.4e-84
WP_014119943.1|3932014_3932767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041615369.1|3932861_3934463_-|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	90.5	3.7e-289
WP_041615370.1|3934593_3934821_-	hypothetical protein	NA	A0A2K5B284	Erysipelothrix_phage	51.4	1.3e-19
WP_041615371.1|3934834_3935020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119946.1|3935175_3935352_-	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_014119947.1|3935341_3935587_-	DUF4314 domain-containing protein	NA	A0A2K5B281	Erysipelothrix_phage	63.9	3.2e-19
WP_014119949.1|3936416_3938117_-	DNA cytosine methyltransferase	NA	A0A2K9V3X0	Faecalibacterium_phage	58.7	4.0e-31
WP_014119950.1|3938109_3939351_-	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	75.2	7.0e-187
WP_014119952.1|3939884_3940607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014119953.1|3940639_3941191_-|terminase	P27 family phage terminase small subunit	terminase	A0A2K5B277	Erysipelothrix_phage	90.7	1.2e-93
WP_041615372.1|3941371_3941755_-	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	77.6	2.6e-55
WP_014119955.1|3941890_3942304_-	DUF1492 domain-containing protein	NA	A0A2K5B275	Erysipelothrix_phage	39.7	1.3e-20
WP_014119956.1|3942300_3942522_-	hypothetical protein	NA	A0A2K5B274	Erysipelothrix_phage	60.0	4.3e-15
WP_014119957.1|3942518_3943733_-	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	64.2	1.1e-149
WP_014119958.1|3943874_3944171_-	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	61.3	4.8e-25
WP_014119959.1|3944151_3944655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014119960.1|3944817_3947685_-	DUF927 domain-containing protein	NA	A0A2K9V2Z1	Faecalibacterium_phage	32.6	8.6e-71
WP_014119961.1|3947662_3948022_-	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	49.0	3.4e-25
>prophage 26
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	4065620	4075857	4410036		unidentified_phage(33.33%)	9	NA	NA
WP_014120097.1|4065620_4067963_-	virulence-associated E family protein	NA	A0A2K9VBU9	Staphylococcus_phage	33.4	2.8e-112
WP_014120098.1|4068037_4068883_+	DUF2806 domain-containing protein	NA	NA	NA	NA	NA
WP_014120099.1|4068887_4070906_-	hypothetical protein	NA	H7BVQ1	unidentified_phage	59.6	2.3e-227
WP_014116084.1|4070953_4071760_-	DUF2815 family protein	NA	A0A0A7RVM4	Clostridium_phage	35.8	7.9e-22
WP_014116085.1|4071777_4072962_-	DUF2800 domain-containing protein	NA	H7BVP9	unidentified_phage	44.6	7.6e-82
WP_014116086.1|4072948_4073512_-	HNH endonuclease	NA	K7PL64	Enterobacteria_phage	50.6	8.8e-12
WP_014120100.1|4073508_4074015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014120101.1|4074007_4074391_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145974127.1|4074759_4075857_-	hypothetical protein	NA	A0A2H4JC51	uncultured_Caudovirales_phage	56.1	1.5e-119
>prophage 27
NC_016048	Oscillibacter valericigenes Sjm18-20, complete genome	4410036	4129712	4175726	4410036	transposase	Acinetobacter_phage(37.5%)	41	NA	NA
WP_014120014.1|4129712_4130000_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014120157.1|4130059_4130329_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_083855653.1|4130286_4130856_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	36.4	3.9e-23
WP_014120159.1|4131321_4132416_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_161603913.1|4132429_4132588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014120161.1|4132599_4134345_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_014120162.1|4134899_4136363_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_014120163.1|4136359_4136950_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	42.0	9.8e-38
WP_014120164.1|4136942_4137962_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.9	1.2e-59
WP_014120165.1|4137958_4138756_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	39.2	2.3e-34
WP_014120166.1|4138742_4139345_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_014120167.1|4140073_4141156_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_014120168.1|4141152_4141653_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_014120169.1|4141649_4142918_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_014120170.1|4142921_4144451_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	36.1	4.0e-06
WP_014116317.1|4145260_4146577_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	31.6	5.1e-18
WP_014120171.1|4147247_4148132_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014120172.1|4148409_4149132_+	creatininase family protein	NA	NA	NA	NA	NA
WP_014120173.1|4149149_4149644_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_014120174.1|4149647_4150928_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_014120175.1|4150986_4152024_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014120176.1|4152109_4153288_+	amidohydrolase	NA	NA	NA	NA	NA
WP_041616146.1|4153448_4154009_+	DUF3793 family protein	NA	NA	NA	NA	NA
WP_014120178.1|4154135_4154771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070107647.1|4155195_4156602_-	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_041615388.1|4157053_4158847_-	WG repeat-containing protein	NA	NA	NA	NA	NA
WP_014120182.1|4159310_4160669_-	purine/pyrimidine permease	NA	H9YQ34	environmental_Halophage	29.4	2.4e-07
WP_014120184.1|4161135_4162644_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_014120185.1|4162659_4163130_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_014120186.1|4163224_4164223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014120187.1|4164645_4165650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014120188.1|4165703_4166639_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014120189.1|4166768_4168046_+	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
WP_041615389.1|4168222_4168549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014120193.1|4169810_4171067_-	radical SAM protein	NA	NA	NA	NA	NA
WP_014120195.1|4171728_4172127_+	VOC family protein	NA	NA	NA	NA	NA
WP_014120196.1|4172187_4172457_+	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_014120197.1|4172481_4172700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014120199.1|4174290_4174521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145974030.1|4174572_4175427_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.8	7.8e-20
WP_014120201.1|4175438_4175726_-|transposase	transposase	transposase	NA	NA	NA	NA
