The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_016784	Bacillus velezensis CAU B946, complete genome	4019861	589275	646635	4019861	tRNA,terminase,tail,integrase,holin,head,capsid,protease,portal	uncultured_Caudovirales_phage(36.96%)	81	599466:599484	640288:640306
WP_003155999.1|589275_589752_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_003155996.1|589732_590422_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_014304466.1|590432_590888_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_014304467.1|590880_591921_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.3	9.1e-63
WP_014304468.1|592144_594073_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.6	7.9e-60
WP_003155986.1|594212_594725_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_003155984.1|594721_595369_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003155981.1|595387_595558_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_088005343.1|595564_596323_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_003155975.1|596363_596555_-	YdiK family protein	NA	NA	NA	NA	NA
WP_003155972.1|596551_597286_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013351185.1|597522_597807_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	51.6	3.7e-19
WP_003155941.1|597848_599483_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.5	3.7e-159
599466:599484	attL	ATGGGCGGCATGATGTAAA	NA	NA	NA	NA
WP_014304470.1|599561_600773_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	41.5	2.6e-77
WP_041481826.1|600784_601258_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	35.1	1.3e-21
WP_014304471.1|601440_602001_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	46.7	2.1e-29
WP_014304472.1|602290_602671_-	helix-turn-helix domain-containing protein	NA	A8ATJ9	Listeria_phage	41.2	7.8e-12
WP_041481827.1|602840_603083_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014304473.1|603095_603401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014304474.1|603397_604126_+	Rha family transcriptional regulator	NA	A0A2H4J4N4	uncultured_Caudovirales_phage	63.3	3.1e-86
WP_003155916.1|604183_604756_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	55.0	1.3e-58
WP_014304475.1|604752_605010_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	38.0	3.0e-07
WP_014304476.1|605006_605204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481828.1|605306_605657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014304477.1|605656_605845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014304478.1|605844_606795_+	YqaJ viral recombinase family protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	70.5	2.3e-129
WP_014304479.1|606797_607640_+	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	83.0	4.0e-125
WP_014304480.1|607804_608521_+	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	45.4	2.7e-42
WP_014304481.1|608405_609353_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	1.8e-57
WP_014304482.1|609349_609493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014304483.1|609638_610100_+	hypothetical protein	NA	K4I239	Lactobacillus_phage	38.8	8.8e-18
WP_014304484.1|610086_610545_+	DUF1064 domain-containing protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	78.0	8.6e-58
WP_003155895.1|610664_610817_+	hypothetical protein	NA	A0A2H4J4N7	uncultured_Caudovirales_phage	68.3	4.2e-09
WP_003155894.1|610898_611102_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	75.4	3.4e-22
WP_014304485.1|611133_611499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014304486.1|611495_611750_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	39.8	8.5e-07
WP_014304487.1|611754_612168_+	hypothetical protein	NA	A0A1P8CWZ8	Bacillus_phage	94.7	5.2e-70
WP_041481831.1|612277_612601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481832.1|612642_612915_+	hypothetical protein	NA	F8WQ59	Bacillus_phage	46.7	2.8e-16
WP_051003490.1|612911_613400_+	hypothetical protein	NA	A0A2I6UHP7	Bacillus_phage	39.8	4.2e-18
WP_041481834.1|613605_613794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481835.1|613790_613973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014304490.1|613988_614423_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	69.3	2.6e-48
WP_014304491.1|614433_614616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014304493.1|614854_615370_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	43.2	4.0e-27
WP_014304494.1|615473_615611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155868.1|615907_616120_+	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	52.9	9.6e-12
WP_041481836.1|616252_616480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014304495.1|616644_617406_+	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	57.3	1.5e-67
WP_014304496.1|617392_618601_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J8B0	uncultured_Caudovirales_phage	87.0	4.4e-210
WP_014304497.1|618606_620010_+|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	59.8	1.8e-154
WP_014304498.1|619996_620920_+|head	head protein	head	A0A1Q1PVS0	Bacillus_phage	51.8	3.0e-81
WP_014304499.1|620923_621205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014304500.1|621295_621877_+	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	53.7	1.8e-52
WP_014304501.1|621891_622809_+|capsid	phage major capsid protein	capsid	A0A2H4JCG0	uncultured_Caudovirales_phage	68.9	9.0e-115
WP_003155858.1|622813_623149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014304502.1|623150_623423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014304503.1|623431_623740_+|head,tail	phage head-tail connector protein	head,tail	R4IFL8	Staphylococcus_phage	39.6	4.8e-12
WP_014304504.1|623736_624075_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_014304505.1|624067_624484_+	HK97 gp10 family phage protein	NA	O48447	Bacillus_phage	55.0	1.5e-32
WP_014304506.1|624502_624901_+	DUF3168 domain-containing protein	NA	W8EK61	Geobacillus_phage	43.8	8.4e-25
WP_014304507.1|624914_625427_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_014304508.1|625368_625683_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	77.8	4.6e-26
WP_077199889.1|625696_625939_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_014304509.1|625995_626502_+	hypothetical protein	NA	I6T7F0	Staphylococcus_virus	32.7	5.1e-11
WP_041481949.1|626549_626858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014304511.1|626862_631938_+	hypothetical protein	NA	M9NRJ5	Staphylococcus_phage	26.0	6.1e-35
WP_014304512.1|631934_632699_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_014304513.1|632711_635906_+|tail	phage tail protein	tail	Q5YA57	Bacillus_phage	46.1	1.7e-131
WP_014304514.1|635917_636205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014304515.1|636223_636391_+	XkdX family protein	NA	NA	NA	NA	NA
WP_014304516.1|636404_636626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014304517.1|636660_637083_+|holin	phage holin family protein	holin	D6R405	Bacillus_phage	88.0	5.5e-59
WP_014304518.1|637129_638101_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	68.5	7.0e-65
WP_014304519.1|638425_639115_+	hypothetical protein	NA	Q0H269	Geobacillus_phage	52.2	2.1e-60
WP_014304520.1|639126_639876_+	DUF4065 domain-containing protein	NA	Q0H268	Geobacillus_phage	65.3	1.2e-93
WP_014304521.1|640536_640896_-	hypothetical protein	NA	NA	NA	NA	NA
640288:640306	attR	ATGGGCGGCATGATGTAAA	NA	NA	NA	NA
WP_014304522.1|640917_642810_-	EndoU domain-containing protein	NA	A0A1P8CWI7	Bacillus_phage	58.0	3.9e-128
WP_014304523.1|643227_643797_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_014304524.1|643817_645410_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	49.6	5.2e-118
WP_041481839.1|645399_646635_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	32.1	1.6e-18
>prophage 2
NC_016784	Bacillus velezensis CAU B946, complete genome	4019861	685021	694912	4019861		Synechococcus_phage(50.0%)	9	NA	NA
WP_003155764.1|685021_686314_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
WP_003155762.1|686389_687109_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	45.2	5.2e-49
WP_003155758.1|687108_687363_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_014304545.1|687359_688043_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003155755.1|688026_690255_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.4	3.2e-158
WP_003155754.1|690230_691661_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	1.6e-54
WP_003155753.1|691752_692793_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.1	2.4e-63
WP_014304546.1|692789_693377_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.3	2.7e-27
WP_014304547.1|693373_694912_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	3.9e-78
>prophage 3
NC_016784	Bacillus velezensis CAU B946, complete genome	4019861	1250596	1286171	4019861	terminase,tail,holin,plate,capsid,portal	Bacillus_phage(36.67%)	47	NA	NA
WP_003154898.1|1250596_1251955_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	1.2e-14
WP_014304836.1|1252416_1252608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014304837.1|1252683_1253448_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_014304838.1|1253596_1254064_-	DinB family protein	NA	NA	NA	NA	NA
WP_087920760.1|1254268_1255405_+	S9 family peptidase	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
WP_003154881.1|1255394_1255529_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_014304839.1|1255671_1256625_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	68.7	1.4e-62
WP_003154878.1|1256662_1257040_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	40.6	1.1e-15
WP_014304840.1|1257149_1257755_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	46.8	1.3e-40
WP_162885922.1|1257744_1257894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154873.1|1257909_1258500_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_003154871.1|1258648_1258987_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
WP_003154869.1|1259178_1259358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014304841.1|1259347_1260175_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	49.0	1.7e-19
WP_014304842.1|1260074_1260875_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.1	8.0e-59
WP_014304843.1|1260874_1261042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014304844.1|1261139_1261469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154859.1|1261470_1261674_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	5.4e-12
WP_012117362.1|1261786_1262299_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	44.6	2.9e-22
WP_003154855.1|1262411_1263209_+|terminase	terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	50.6	9.4e-60
WP_003154853.1|1263205_1264504_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.6	8.5e-151
WP_099762611.1|1264552_1265932_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.4	5.1e-138
WP_014304846.1|1265963_1266812_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	57.6	4.4e-55
WP_003154848.1|1266838_1267774_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	62.8	2.5e-104
WP_003154846.1|1267790_1268174_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_003154844.1|1268170_1268527_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_014304847.1|1268523_1269027_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_014304848.1|1269023_1269470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154839.1|1269466_1269676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014304849.1|1269675_1271073_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7RTT5	Clostridium_phage	40.6	6.9e-82
WP_003154837.1|1271074_1271518_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003154836.1|1271593_1272040_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_015239684.1|1272081_1272234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014304850.1|1272221_1277348_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	46.6	2.0e-41
WP_007610816.1|1277340_1278000_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	45.3	1.8e-08
WP_014304851.1|1278013_1278991_+	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	30.9	3.7e-34
WP_007610818.1|1278990_1279257_+	DUF2577 family protein	NA	S6C459	Thermus_phage	38.6	1.2e-06
WP_003154825.1|1279360_1279786_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	1.5e-11
WP_003154824.1|1279778_1280825_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.1	7.7e-70
WP_014304854.1|1281384_1281657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014304855.1|1281659_1283282_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	39.3	5.3e-41
WP_014304856.1|1283294_1283666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154819.1|1283671_1283869_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	61.8	4.3e-14
WP_014304857.1|1283925_1284687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154815.1|1284738_1285002_+	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_003154813.1|1285015_1285279_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_014304858.1|1285292_1286171_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	60.5	2.8e-81
>prophage 4
NC_016784	Bacillus velezensis CAU B946, complete genome	4019861	1834199	1840412	4019861		Bacillus_phage(50.0%)	6	NA	NA
WP_014305044.1|1834199_1834592_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	6.5e-30
WP_003154060.1|1834551_1836654_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.0	0.0e+00
WP_003154059.1|1836671_1837661_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.6	8.7e-156
WP_003154057.1|1837709_1838330_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.4	2.7e-46
WP_014305045.1|1838378_1839137_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.4	6.2e-53
WP_015417523.1|1839443_1840412_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
>prophage 5
NC_016784	Bacillus velezensis CAU B946, complete genome	4019861	2023596	2066000	4019861	terminase,tail,integrase,holin,plate,head,capsid,protease,portal	Bacillus_phage(50.0%)	47	2052981:2052997	2075504:2075520
WP_014305123.1|2023596_2025423_+	HNH endonuclease	NA	A0A1P8CWI7	Bacillus_phage	41.1	4.4e-105
WP_041481866.1|2025438_2025879_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014305124.1|2026071_2026764_+	hypothetical protein	NA	Q9AZW5	Lactococcus_phage	31.9	4.1e-11
WP_014305125.1|2026870_2027884_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	96.4	1.4e-185
WP_014305126.1|2027940_2028204_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	69.0	1.1e-25
WP_003220204.1|2028218_2028431_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	59.4	1.4e-15
WP_014305127.1|2028482_2028671_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	96.8	4.1e-30
WP_014305128.1|2028667_2029030_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	90.8	7.1e-55
WP_014305129.1|2029026_2030304_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	77.9	2.6e-144
WP_014305130.1|2030316_2032881_-	peptidase G2	NA	D6R401	Bacillus_phage	57.0	7.2e-287
WP_014305131.1|2032931_2034635_-|tail	phage tail protein	tail	D6R400	Bacillus_phage	56.9	2.1e-181
WP_014305132.1|2034649_2035489_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	58.6	6.2e-94
WP_014305136.1|2040176_2040545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014305137.1|2040603_2041218_-|tail	tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	34.4	2.9e-24
WP_014305138.1|2041232_2041616_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_014305139.1|2041612_2042011_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_014305140.1|2042007_2042325_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	35.3	4.2e-11
WP_014305141.1|2042314_2042617_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	40.5	2.6e-10
WP_014305142.1|2042634_2043033_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	44.5	4.8e-12
WP_014305143.1|2043060_2044353_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	46.7	1.1e-89
WP_014305144.1|2044391_2045021_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	75.8	3.1e-82
WP_014305145.1|2044983_2046264_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	62.8	3.4e-152
WP_014305147.1|2046452_2048162_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.6	2.1e-205
WP_014305148.1|2048158_2048674_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	44.0	2.2e-33
WP_041481868.1|2048902_2049268_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	54.2	3.9e-29
WP_014305150.1|2049553_2050948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014305151.1|2051357_2052293_-	hypothetical protein	NA	A0A1S5S8Z0	Streptococcus_phage	27.3	2.4e-14
WP_014305152.1|2052532_2053075_-|integrase	site-specific integrase	integrase	H0USV4	Bacillus_phage	64.4	3.4e-61
2052981:2052997	attL	ACAAACAGCATGTAATT	NA	NA	NA	NA
WP_014305153.1|2053071_2053524_-	DUF1492 domain-containing protein	NA	S6AVV9	Thermus_phage	57.4	4.9e-37
WP_173363165.1|2053542_2053719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014305154.1|2053810_2054494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014305155.1|2054483_2055629_-	DUF3578 domain-containing protein	NA	NA	NA	NA	NA
WP_041481869.1|2055930_2056353_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.2	4.7e-50
WP_041481870.1|2056472_2056823_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_014305157.1|2056974_2057232_-	hypothetical protein	NA	F8WQ54	Bacillus_phage	43.6	5.6e-06
WP_014305158.1|2057228_2057591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041481871.1|2057731_2057935_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	58.5	5.8e-14
WP_014305160.1|2058184_2058325_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_014305162.1|2058964_2059123_-	hypothetical protein	NA	A8ATM6	Listeria_phage	55.6	2.9e-05
WP_154018700.1|2059119_2059281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014305163.1|2059267_2060119_-	ATP-binding protein	NA	A8ATL1	Listeria_phage	30.2	1.3e-22
WP_014305164.1|2060069_2060918_-	phage replisome organizer N-terminal domain-containing protein	NA	V9QKF6	Oenococcus_phage	42.1	4.2e-50
WP_014305165.1|2061146_2061470_-	DUF771 domain-containing protein	NA	Q9MC19	Lactococcus_phage	40.7	4.6e-13
WP_032858779.1|2061533_2061740_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014305167.1|2061904_2062303_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014305168.1|2062734_2063835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003153850.1|2065454_2066000_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	48.6	2.1e-42
2075504:2075520	attR	ACAAACAGCATGTAATT	NA	NA	NA	NA
>prophage 6
NC_016784	Bacillus velezensis CAU B946, complete genome	4019861	2321576	2327829	4019861		Staphylococcus_phage(66.67%)	9	NA	NA
WP_003153378.1|2321576_2322170_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
WP_003153377.1|2322159_2322915_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.3	6.5e-10
WP_003153376.1|2323122_2323212_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003153375.1|2323299_2323821_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153373.1|2323886_2324261_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003153372.1|2324377_2324842_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_003153371.1|2324874_2326071_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	2.1e-116
WP_003153370.1|2326085_2326733_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	1.5e-39
WP_014305330.1|2326713_2327829_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	1.5e-55
>prophage 7
NC_016784	Bacillus velezensis CAU B946, complete genome	4019861	2679266	2739171	4019861	tRNA,coat,protease	uncultured_Mediterranean_phage(25.0%)	60	NA	NA
WP_014305497.1|2679266_2679710_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_003152716.1|2679722_2681927_-	GTP diphosphokinase	NA	A0A2I2L310	Orpheovirus	34.8	1.5e-09
WP_003152714.1|2682084_2682597_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.2	5.5e-29
WP_014305498.1|2682602_2684963_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.8	6.2e-91
WP_003152709.1|2685018_2685345_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_014305499.1|2685408_2685906_-	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_003152704.1|2686037_2688257_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	31.7	2.0e-27
WP_003152702.1|2688293_2688590_-	post-transcriptional regulator	NA	NA	NA	NA	NA
WP_003152700.1|2688705_2690262_+	stage V sporulation protein B	NA	NA	NA	NA	NA
WP_003152699.1|2690269_2690926_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_003152697.1|2691092_2691479_+	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
WP_003152695.1|2691530_2691791_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.9	1.5e-06
WP_014305500.1|2691821_2692967_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.8	8.1e-89
WP_003152692.1|2692994_2694023_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003152687.1|2694048_2694249_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003152685.1|2694241_2695246_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.0	4.0e-07
WP_003152683.1|2695256_2695862_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_014305501.1|2695996_2696506_-	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_014305502.1|2696638_2696878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003152677.1|2696891_2697485_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_014305504.1|2697632_2698838_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_003152673.1|2698964_2700068_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_041481889.1|2700069_2700918_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_014305506.1|2700899_2702465_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014305507.1|2702570_2703722_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	27.2	4.6e-31
WP_014305508.1|2703718_2704261_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_003152668.1|2704290_2705148_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_007408173.1|2705161_2705605_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_003152665.1|2705658_2706945_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_003152664.1|2706976_2707555_-	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_003152662.1|2707872_2708157_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_012118103.1|2708169_2708511_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003152660.1|2708513_2708822_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_014305510.1|2708967_2709834_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_007408168.1|2709826_2710630_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003152655.1|2710757_2711561_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_003152653.1|2711563_2712244_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003152650.1|2712297_2712816_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003152649.1|2712812_2713676_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003152647.1|2713706_2714720_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_003152646.1|2714811_2715507_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_014305513.1|2715538_2716108_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_003152644.1|2716248_2717250_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_014305514.1|2717376_2718129_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_014305515.1|2718268_2719561_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_014305516.1|2719619_2722262_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.2	3.7e-161
WP_003152639.1|2722714_2722906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003152637.1|2722920_2723943_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_014305517.1|2723976_2725893_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003152633.1|2726025_2727315_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_095315573.1|2727343_2728318_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_014305519.1|2728320_2729103_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003152630.1|2729092_2730034_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003152629.1|2730068_2730899_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_003152628.1|2730906_2732274_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_014305520.1|2732468_2732960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003152626.1|2732992_2733580_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003152624.1|2733576_2735901_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.3	8.0e-184
WP_003152622.1|2736100_2737759_-|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	32.7	1.9e-14
WP_003152620.1|2737908_2739171_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.3	4.2e-147
>prophage 8
NC_016784	Bacillus velezensis CAU B946, complete genome	4019861	2976670	3056275	4019861	terminase,tail,integrase,holin,plate,head,capsid,protease,portal	Bacillus_phage(50.0%)	84	3016084:3016131	3056447:3056494
WP_003152243.1|2976670_2977075_-|holin	holin family protein	holin	NA	NA	NA	NA
WP_003152242.1|2977226_2977664_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	6.5e-47
WP_003152241.1|2977788_2977938_+	YtzI protein	NA	NA	NA	NA	NA
WP_003152240.1|2977934_2978378_-	FixH family protein	NA	NA	NA	NA	NA
WP_003152237.1|2978492_2978966_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_003152235.1|2979090_2979318_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	66.2	6.9e-24
WP_003152233.1|2979314_2979884_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_003152229.1|2980002_2980251_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_041481970.1|2980448_2981780_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003152225.1|2981802_2982843_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003152224.1|2982900_2983059_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_014305634.1|2983429_2984545_-	o-succinylbenzoate synthase	NA	Q6A202	Oenococcus_phage	21.9	7.1e-13
WP_014305635.1|2984541_2986005_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	35.2	1.6e-76
WP_003152221.1|2986092_2986911_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_014305636.1|2986969_2987794_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_014305637.1|2987781_2989518_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_003152215.1|2989514_2990930_-	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_003152213.1|2991212_2991932_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_014305638.1|2992088_2992559_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_014305639.1|2999967_3000549_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_014305640.1|3000579_3002109_-	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.5	2.1e-07
WP_003152186.1|3002128_3002659_-	NfeD family protein	NA	NA	NA	NA	NA
WP_014305641.1|3002805_3003294_+	DinB family protein	NA	NA	NA	NA	NA
WP_003152182.1|3003295_3003877_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_014305643.1|3003948_3005157_-|holin	choline dehydrogenase	holin	NA	NA	NA	NA
WP_014305644.1|3005174_3006647_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014305645.1|3006847_3007402_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003152178.1|3007561_3008101_+	DUF1016 domain-containing protein	NA	NA	NA	NA	NA
WP_014305646.1|3008264_3008933_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_014305647.1|3008966_3009812_-	glucosaminidase domain-containing protein	NA	A0A0K2CP65	Brevibacillus_phage	45.2	1.5e-26
WP_041481971.1|3009954_3011130_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_003152172.1|3011347_3011989_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_014305649.1|3012041_3012362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014305650.1|3013623_3014754_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	40.1	2.0e-63
WP_015387806.1|3015073_3015277_+	hypothetical protein	NA	NA	NA	NA	NA
3016084:3016131	attL	GTATGGAGCCAAGGGGGCTCGAACCCCTGACCTCTACGCTGCCAGCGT	NA	NA	NA	NA
WP_014305652.1|3016282_3016561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014305653.1|3016870_3017290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014305654.1|3017308_3017812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014305656.1|3019378_3019774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041481897.1|3019788_3020100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051003492.1|3020248_3020476_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014305657.1|3020600_3020903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481898.1|3020954_3021197_-	helix-turn-helix domain-containing protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	54.4	2.5e-16
WP_014305659.1|3021660_3022665_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	81.1	5.0e-151
WP_014305660.1|3022706_3023114_-|holin	phage holin family protein	holin	D6R405	Bacillus_phage	67.7	9.4e-40
WP_014305661.1|3023152_3023395_-	XkdX family protein	NA	M4ZS22	Bacillus_phage	86.0	6.2e-15
WP_014305662.1|3023397_3023679_-	hypothetical protein	NA	O64053	Bacillus_phage	48.4	6.3e-19
WP_041481899.1|3023675_3024953_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	54.1	6.1e-85
WP_014305664.1|3024966_3027555_-	peptidase G2	NA	D6R401	Bacillus_phage	52.9	4.8e-254
WP_014305665.1|3027566_3029255_-|tail	phage tail protein	tail	D6R400	Bacillus_phage	53.4	2.3e-164
WP_041481973.1|3029266_3030109_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	51.6	1.3e-80
WP_014305667.1|3030134_3034520_-|tail	phage tail tape measure protein	tail	A0A2H4JA91	uncultured_Caudovirales_phage	45.7	3.2e-69
WP_014305668.1|3034780_3035131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014305669.1|3035200_3035803_-|tail	tail protein	tail	A0A2H4J5N7	uncultured_Caudovirales_phage	29.7	9.1e-15
WP_014305670.1|3035816_3036203_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_014305671.1|3036199_3036598_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_041481900.1|3036597_3036942_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_014305672.1|3036931_3037240_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_051003499.1|3037254_3038454_-|capsid	phage major capsid protein	capsid	A0A2H4J387	uncultured_Caudovirales_phage	42.1	6.8e-70
WP_021494517.1|3038508_3039183_-|protease	Clp protease ClpP	protease	A0A0B5A796	Paenibacillus_phage	52.0	4.2e-53
WP_014305675.1|3039166_3040465_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.9	7.0e-105
WP_041481901.1|3040465_3040654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041481902.1|3040664_3042386_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	59.3	8.8e-196
WP_014305677.1|3042414_3042891_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	38.7	1.0e-21
WP_041481903.1|3043120_3043489_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	50.0	1.7e-27
WP_014305678.1|3043741_3044314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021494511.1|3044313_3044637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014305679.1|3044676_3045147_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_014305680.1|3045216_3045438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157824481.1|3045434_3045584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041481904.1|3045584_3045767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041481905.1|3045826_3046081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014305681.1|3046303_3046945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481906.1|3046973_3047153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470883.1|3047333_3047504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041481908.1|3047574_3047844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014305682.1|3047847_3048384_-	DNA endonuclease I-HmuI	NA	Q38137	Bacillus_phage	29.9	5.8e-05
WP_014305683.1|3048828_3051507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014305684.1|3051719_3052355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021495004.1|3052869_3053004_-	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
WP_014305687.1|3053042_3054005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041481909.1|3054211_3054391_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014305688.1|3054575_3055124_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014305689.1|3055123_3056275_+|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	35.2	2.6e-42
3056447:3056494	attR	GTATGGAGCCAAGGGGGCTCGAACCCCTGACCTCTACGCTGCCAGCGT	NA	NA	NA	NA
