The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_016860	Salmonella enterica subsp. enterica serovar Typhimurium str. T000240, complete genome	4954814	364980	409928	4954814	terminase,integrase,coat,protease,lysis,portal	Enterobacteria_phage(77.61%)	68	355750:355766	418519:418535
355750:355766	attL	GATATTGAAATTCGCGT	NA	NA	NA	NA
WP_001043675.1|364980_366033_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
WP_001285275.1|366315_367419_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893231.1|367430_368681_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_000051897.1|368886_370050_-|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	3.7e-230
WP_155675089.1|370279_370420_-	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	97.8	4.2e-16
WP_000002104.1|370488_370773_-	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
WP_000371199.1|370765_371050_-	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
WP_025617570.1|371049_371694_-	ead/Ea22-like family protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
WP_071533029.1|371680_371914_-	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_000812203.1|371910_372420_-	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
WP_001214777.1|372416_372587_-	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_001111291.1|372597_372891_-	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001253476.1|372937_373222_-	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001046968.1|373221_373929_-	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_000902092.1|373925_374069_-	hypothetical protein	NA	A0A2H5BFM6	Salmonella_phage	100.0	6.4e-20
WP_000156731.1|374058_374247_-	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000141641.1|374227_374386_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_000776963.1|374470_374785_-	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000713613.1|375060_375348_-	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
WP_015974224.1|375381_376026_-	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	100.0	6.5e-51
WP_000213982.1|376109_376304_-	Restriction inhibitor protein ral	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
WP_001066179.1|376517_377105_+	super-infection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
WP_000216178.1|377117_377420_-	hypothetical protein	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
WP_000834175.1|377783_377987_+	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_001532928.1|378025_379105_-	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_000712403.1|379269_379959_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_000182204.1|380069_380285_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_001103492.1|380395_380677_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000166961.1|380711_380873_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539342.1|380859_381681_+	replication protein	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
WP_001248410.1|381677_383054_+	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
WP_001036030.1|383050_383320_+	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
WP_000736891.1|383393_383831_+	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.5e-80
WP_000679703.1|383827_384001_+	hypothetical protein	NA	Q76H74	Enterobacteria_phage	100.0	2.3e-32
WP_000113770.1|383967_384144_+	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_001532927.1|384146_384488_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000950963.1|384480_384657_+	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_001108073.1|384649_385261_+	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
WP_000036320.1|385257_385482_+	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_000149882.1|385478_385682_+	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000219133.1|385662_385842_+	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_001047566.1|385838_386612_+	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_000286100.1|387042_387246_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_024136257.1|387223_387721_+	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_001687043.1|387717_388185_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_000877028.1|388397_388928_+	KilA-N domain-containing protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
WP_000808099.1|389150_389393_+	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_001140562.1|389396_389786_+	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_001687044.1|389785_390190_+	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_000729923.1|390193_390682_+	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_000417860.1|390659_392159_+|terminase	terminase	terminase	Q76H24	Enterobacteria_phage	100.0	2.8e-307
WP_000774652.1|392158_394336_+|portal	portal protein	portal	Q76H23	Enterobacteria_phage	100.0	0.0e+00
WP_000433855.1|394349_395261_+	scaffold protein	NA	Q76H22	Enterobacteria_phage	100.0	1.5e-162
WP_001196937.1|395260_396553_+|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_000538670.1|396593_397154_+	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_001166103.1|397137_397638_+	packaged DNA stabilization protein p27	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
WP_001122420.1|397597_399016_+	packaged DNA stabilization protein gp10	NA	Q76H18	Enterobacteria_phage	100.0	6.4e-277
WP_000774917.1|399019_399721_+	hypothetical protein	NA	Q76H17	Enterobacteria_phage	100.0	1.7e-76
WP_000627593.1|399720_400176_+	DUF2824 family protein	NA	Q76H16	Enterobacteria_phage	100.0	1.8e-87
WP_000964904.1|400178_400868_+	hypothetical protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
WP_000246977.1|400878_402315_+	DNA transfer protein	NA	Q76H14	Enterobacteria_phage	100.0	7.7e-246
WP_001029860.1|402314_404291_+	hypothetical protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
WP_071533035.1|404429_404723_+	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_000532177.1|404743_404992_-	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_000129933.1|405127_407131_+	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	100.0	0.0e+00
WP_000671496.1|407189_408647_-	glucosyltransferase domain-containing protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000703639.1|408636_409569_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|409565_409928_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
418519:418535	attR	GATATTGAAATTCGCGT	NA	NA	NA	NA
>prophage 2
NC_016860	Salmonella enterica subsp. enterica serovar Typhimurium str. T000240, complete genome	4954814	1016268	1025000	4954814	transposase,protease	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|1016268_1017387_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|1017383_1019330_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|1019459_1019681_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1020004_1020325_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1020355_1022632_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1022823_1023282_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_085983316.1|1023744_1025000_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 3
NC_016860	Salmonella enterica subsp. enterica serovar Typhimurium str. T000240, complete genome	4954814	1075063	1173913	4954814	terminase,tail,tRNA,protease,lysis,holin,portal	Salmonella_phage(42.11%)	102	NA	NA
WP_001154025.1|1075063_1075867_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1075859_1077182_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1077162_1077867_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1077866_1082333_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925872.1|1082677_1084519_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1084778_1085327_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1085354_1086002_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1086063_1087254_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1087438_1088530_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1089136_1090537_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1090737_1091199_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1091515_1092730_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1092974_1094411_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1094488_1095691_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1095885_1097178_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1097222_1097471_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1097511_1097751_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_071892913.1|1097793_1098951_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_000017122.1|1098913_1101841_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	97.9	0.0e+00
WP_014344461.1|1101967_1102267_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	83.6	1.4e-48
WP_000917562.1|1102288_1102447_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_010989055.1|1102439_1102700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1102749_1103160_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1103279_1103519_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1103484_1103859_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1103943_1104927_+	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1104929_1105679_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1105689_1106037_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1106033_1106345_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_010989003.1|1106422_1106713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1107004_1107238_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1107349_1107571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929803.1|1107653_1108256_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001096550.1|1108464_1109076_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_001617856.1|1109072_1109219_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1109208_1110006_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|1110072_1110390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1110563_1110689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1110824_1111274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014344462.1|1111634_1112321_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_001574216.1|1112596_1112926_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_077907023.1|1112909_1113362_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	3.9e-79
WP_001541990.1|1113379_1113859_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1114066_1114600_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1114556_1116695_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1116691_1116898_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009207.1|1116894_1118442_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_010989008.1|1118365_1120447_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1120537_1120861_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1120853_1121153_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1121133_1121700_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1121696_1122098_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|1122109_1122859_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1122904_1123303_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1123299_1123629_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|1123708_1126696_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|1126692_1127025_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1127123_1127621_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1127737_1128271_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1128360_1129056_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1129065_1129803_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1129700_1130405_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_001541992.1|1130476_1132924_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	68.0	0.0e+00
WP_014344463.1|1132950_1133826_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_000178854.1|1133864_1134107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014344464.1|1134160_1136599_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000143167.1|1136598_1137180_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001533476.1|1137655_1138624_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000334547.1|1139271_1139898_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1139966_1140266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1140250_1140937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1141207_1141399_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1141825_1144438_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1144645_1145656_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1145821_1146364_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1146360_1147470_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1147568_1149677_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1149689_1151597_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333152.1|1151611_1152865_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1152869_1154510_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1154506_1155070_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1155325_1155493_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1155592_1156111_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1156179_1157940_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1158125_1158578_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1158649_1159702_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1160058_1160568_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1160784_1161390_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1161376_1163530_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1163548_1163995_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1164118_1166173_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1166208_1166667_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1166761_1167424_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1167597_1168011_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1168055_1168373_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1168430_1169642_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1169856_1170405_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1170430_1171210_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072884.1|1171258_1171540_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1171536_1171866_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1171952_1172612_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1173232_1173913_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NC_016860	Salmonella enterica subsp. enterica serovar Typhimurium str. T000240, complete genome	4954814	2069869	2077123	4954814		Morganella_phage(33.33%)	8	NA	NA
WP_001157322.1|2069869_2071300_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2071373_2072069_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2072160_2072460_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2073109_2074306_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2074566_2074755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2074765_2074978_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2075432_2076701_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2076703_2077123_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 5
NC_016860	Salmonella enterica subsp. enterica serovar Typhimurium str. T000240, complete genome	4954814	2166466	2176972	4954814		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2166466_2167780_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2167806_2168886_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2168890_2169664_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2169660_2170653_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2170658_2171210_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2171210_2172089_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2172136_2173036_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697839.1|2173056_2174121_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	9.2e-103
WP_000981469.1|2174497_2175391_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2175568_2176972_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 6
NC_016860	Salmonella enterica subsp. enterica serovar Typhimurium str. T000240, complete genome	4954814	2245280	2254451	4954814	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2245280_2247314_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2247554_2248013_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2248184_2248715_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2248771_2249239_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2249285_2250005_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2250001_2251687_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2251909_2252641_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2252700_2252808_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2252788_2253520_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2253503_2254451_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 7
NC_016860	Salmonella enterica subsp. enterica serovar Typhimurium str. T000240, complete genome	4954814	2273858	2340254	4954814	tail,lysis,holin	Salmonella_phage(28.57%)	60	NA	NA
WP_000989296.1|2273858_2274554_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2274707_2275592_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2275768_2276488_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2276484_2276730_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2276934_2278176_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|2278169_2279405_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2279479_2280490_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2280505_2282026_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2282159_2283158_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2283656_2284679_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2284828_2285971_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2285985_2286654_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2286983_2287841_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2287829_2288219_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2288223_2289591_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2289807_2290695_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2290727_2292050_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2292093_2294085_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2294430_2295900_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2296089_2296953_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137960.1|2297073_2298123_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2298201_2299059_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2299123_2300812_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2300828_2301767_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2301766_2302897_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2303265_2304447_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2304511_2305177_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2305178_2305301_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2305688_2305943_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2306266_2306839_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2307051_2308038_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2308067_2308787_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2309200_2309773_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2310098_2311655_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561747.1|2311761_2313567_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2313576_2314671_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2314670_2315696_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2315697_2317287_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2317290_2317635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2318025_2319216_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2319243_2319939_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2320090_2321851_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2321975_2322260_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033437.1|2322368_2322989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2323016_2324024_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2324203_2324431_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2324462_2326223_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2326503_2327007_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2327034_2327325_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2327672_2329502_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2329555_2329999_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2330376_2330904_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2330906_2332148_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2332740_2333070_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894639.1|2333366_2334698_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2334726_2335095_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2335109_2336099_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2336427_2338794_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2338962_2339166_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2339462_2340254_-|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 8
NC_016860	Salmonella enterica subsp. enterica serovar Typhimurium str. T000240, complete genome	4954814	2679010	2783851	4954814	terminase,integrase,tail,head,tRNA,holin,transposase,lysis,capsid,portal	Salmonella_phage(37.1%)	111	2703555:2703571	2791755:2791771
WP_000940032.1|2679010_2679742_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2679860_2680664_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2680808_2681687_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2681868_2682912_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2682915_2683734_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2683744_2684758_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2684758_2685745_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2685735_2686374_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2686499_2687777_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2687771_2688911_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2689106_2690360_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883149.1|2690684_2691875_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2692056_2693601_+	lysine decarboxylation/transport transcriptional activator CadC	NA	NA	NA	NA	NA
WP_000100008.1|2693961_2695293_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2695375_2697520_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2697575_2699036_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2699084_2699423_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2699499_2700837_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2700833_2701598_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2701599_2703030_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
2703555:2703571	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970045.1|2703679_2707567_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|2707588_2707822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2707822_2709367_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2709417_2709969_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2709993_2710629_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2710632_2711994_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2712004_2712898_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2713013_2713862_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2713900_2714818_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276365.1|2714839_2716036_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2716151_2717078_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2717115_2717376_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2717487_2717868_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2717867_2718599_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2718610_2719339_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2719350_2720256_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2720252_2720933_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2721206_2722181_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2722197_2723997_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2724401_2725895_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2726379_2726517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2727229_2727394_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001738443.1|2728101_2728314_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2728420_2728648_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2728744_2729323_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2729312_2730137_-	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144677.1|2730133_2732506_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	65.7	4.8e-91
WP_000178853.1|2732559_2732802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514916.1|2732840_2736203_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2736264_2736912_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2736809_2737547_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2737553_2738252_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2738261_2738591_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372072.1|2738593_2741689_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_010989052.1|2741660_2741999_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2741995_2742391_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2742441_2743188_-	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2743195_2743597_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2743705_2744836_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2744884_2745463_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2745490_2745874_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2745884_2746244_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522566.1|2746301_2747330_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2747384_2747732_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2747744_2749241_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|2749230_2750811_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2750807_2751011_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2750994_2752926_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2752897_2753443_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2753729_2754131_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001533543.1|2754366_2754819_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000984579.1|2754836_2755289_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	96.6	2.0e-78
WP_001574216.1|2755272_2755602_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_014344470.1|2755877_2756564_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.1	2.0e-130
WP_000657897.1|2756778_2756967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211409.1|2757473_2758037_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|2758309_2758987_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2758983_2759124_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|2759120_2759732_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000929803.1|2759940_2760543_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_000807548.1|2760625_2760847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|2760958_2761192_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_010989003.1|2761483_2761774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|2761851_2762163_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|2762159_2762507_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|2762517_2763267_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|2763269_2764253_-	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|2764337_2764712_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|2764677_2764917_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|2765036_2765447_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_010989055.1|2765496_2765757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917562.1|2765749_2765908_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_014344461.1|2765929_2766229_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	83.6	1.4e-48
WP_000017122.1|2766355_2769283_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	97.9	0.0e+00
WP_071892913.1|2769245_2770403_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|2770445_2770685_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2770725_2771010_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|2770987_2772217_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|2772714_2773194_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2773190_2774147_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|2774146_2774797_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2774828_2775404_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2775400_2775565_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989177.1|2775828_2777451_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2777435_2778173_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2778303_2779638_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|2779655_2780555_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2780657_2781245_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2781306_2781690_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2782008_2782698_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2782813_2783851_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
2791755:2791771	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 9
NC_016860	Salmonella enterica subsp. enterica serovar Typhimurium str. T000240, complete genome	4954814	2804984	2839594	4954814	terminase,integrase,capsid,tail,plate,head,tRNA,holin,portal	Cronobacter_phage(68.97%)	39	2803437:2803452	2831602:2831617
2803437:2803452	attL	CCTTCGGGCGCGTTTT	NA	NA	NA	NA
WP_000977528.1|2804984_2806688_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	3.8e-223
WP_000200792.1|2806687_2807233_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_000267951.1|2807204_2807930_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000122989.1|2807919_2808474_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	97.2	4.6e-98
WP_001001823.1|2810741_2811329_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	8.4e-90
WP_000136921.1|2811321_2812506_-|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001002797.1|2812502_2812832_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000811099.1|2812828_2814796_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	1.9e-271
WP_000411498.1|2814983_2815241_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	3.1e-20
WP_000376377.1|2815387_2815720_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	2.2e-34
WP_000175558.1|2815719_2816061_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154426.1|2816057_2816354_-|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_000166745.1|2816366_2816822_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	71.5	1.7e-58
WP_000220185.1|2816818_2817946_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	82.9	1.6e-174
WP_000606932.1|2817942_2818647_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.5	2.0e-69
WP_000080872.1|2818643_2819126_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	4.0e-37
WP_000491223.1|2819122_2819575_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
WP_000505908.1|2819668_2819860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001177275.1|2819878_2820577_-|terminase	terminase endonuclease subunit	terminase	F1BUM0	Cronobacter_phage	52.6	6.1e-63
WP_001176504.1|2820588_2821617_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	1.7e-133
WP_031603163.1|2821651_2822491_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.0	4.8e-46
WP_001151938.1|2822701_2824486_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	69.7	1.8e-247
WP_000746493.1|2824482_2825502_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.5	1.0e-135
WP_001264830.1|2825555_2825825_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	78.4	5.1e-34
WP_000994502.1|2825852_2828510_-	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	47.5	4.6e-244
WP_000681786.1|2828769_2829339_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.2e-43
WP_000645096.1|2829348_2829681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000661530.1|2829706_2830045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085723.1|2830153_2830453_+	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	53.2	3.8e-22
WP_024136262.1|2830519_2831512_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.5	4.7e-109
WP_010989056.1|2831675_2831723_+	hypothetical protein	NA	NA	NA	NA	NA
2831602:2831617	attR	CCTTCGGGCGCGTTTT	NA	NA	NA	NA
WP_000200080.1|2831822_2832983_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210995.1|2832943_2833852_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225191.1|2833909_2835031_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|2835040_2836111_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|2836550_2837069_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|2837061_2838282_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|2838438_2838786_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|2838826_2839594_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 10
NC_016860	Salmonella enterica subsp. enterica serovar Typhimurium str. T000240, complete genome	4954814	2867993	2901406	4954814	terminase,integrase,tail,plate,head,lysis,capsid,portal	Salmonella_phage(97.56%)	45	2867832:2867878	2901524:2901570
2867832:2867878	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_000980498.1|2867993_2868212_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_001010543.1|2868280_2869381_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.1	3.4e-193
WP_000980418.1|2869377_2869863_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	98.5	2.4e-66
WP_001282773.1|2869859_2872667_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	99.7	0.0e+00
WP_000763317.1|2872659_2872779_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
WP_001280967.1|2872793_2873096_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
WP_001207652.1|2873150_2873666_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	98.8	7.9e-92
WP_000046109.1|2873675_2874848_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.7	5.7e-223
WP_001165559.1|2874950_2875508_-	serine-type DNA invertase Fin	NA	A0A1S6L009	Salmonella_phage	97.8	8.0e-98
WP_010989058.1|2875477_2876557_+	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	92.1	5.4e-183
WP_001287105.1|2876563_2876971_+|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	84.4	2.2e-60
WP_010989059.1|2876974_2877592_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	84.6	4.1e-95
WP_001274647.1|2877561_2879136_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	60.7	2.1e-156
WP_001086807.1|2879132_2879738_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.0	4.1e-116
WP_000268333.1|2879730_2880639_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	99.0	7.7e-159
WP_000177403.1|2880625_2880985_-	GPW/gp25 family protein	NA	E5G6N7	Salmonella_phage	98.3	8.0e-59
WP_000993751.1|2880981_2881560_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	98.4	3.3e-107
WP_000343947.1|2881628_2882075_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.0	1.9e-65
WP_001039961.1|2882067_2882499_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_001648763.1|2882594_2883023_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	95.0	2.6e-64
WP_000871617.1|2883019_2883394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069932.1|2883398_2883908_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.6	3.5e-92
WP_000171565.1|2883888_2884104_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868168.1|2884107_2884311_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	98.5	1.1e-33
WP_000673534.1|2884310_2884775_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	1.9e-84
WP_000059178.1|2884868_2885522_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	98.6	4.6e-113
WP_000730755.1|2885525_2886608_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	97.7	1.6e-190
WP_000216276.1|2886624_2887458_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_001098444.1|2887600_2889367_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.3	0.0e+00
WP_001292071.1|2889366_2890407_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	93.0	2.4e-188
WP_071892914.1|2890492_2892244_-	AIPR family protein	NA	NA	NA	NA	NA
WP_014344476.1|2892457_2893135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|2893248_2893482_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154433.1|2893492_2893681_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_000301161.1|2893833_2896263_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	91.8	0.0e+00
WP_000104125.1|2896253_2897111_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	80.4	2.7e-129
WP_000785509.1|2897107_2897335_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
WP_001244234.1|2897334_2897568_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
WP_000963195.1|2897635_2897977_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
WP_000166366.1|2898196_2898655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957775.1|2898602_2898836_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
WP_000460862.1|2898843_2899353_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.9	5.1e-83
WP_000102104.1|2899388_2899628_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
WP_000052560.1|2899744_2900377_+	helix-turn-helix domain-containing protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_001536726.1|2900380_2901406_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	100.0	9.9e-203
2901524:2901570	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 11
NC_016860	Salmonella enterica subsp. enterica serovar Typhimurium str. T000240, complete genome	4954814	4033545	4081862	4954814	transposase,integrase	Escherichia_phage(33.33%)	47	4043832:4043846	4082976:4082990
WP_001066953.1|4033545_4034286_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_042344623.1|4034406_4034589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072355.1|4035731_4036901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105060.1|4037096_4037390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421272.1|4037495_4037771_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001387467.1|4037770_4038055_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000562172.1|4038659_4039412_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001022265.1|4039457_4040423_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_000710783.1|4040455_4040836_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
WP_001077068.1|4040860_4041751_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_000338039.1|4042722_4043601_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_001271561.1|4043590_4044478_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
4043832:4043846	attL	GGAACAGCGCCGACT	NA	NA	NA	NA
WP_000922702.1|4044488_4045313_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_000950177.1|4045318_4046392_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	2.6e-28
WP_000476108.1|4046384_4047695_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001067834.1|4049614_4050319_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000874189.1|4051028_4051514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267177.1|4051538_4052024_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|4052010_4052706_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.2	1.3e-17
WP_000729220.1|4052710_4053841_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000964653.1|4053830_4055114_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|4055116_4056496_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000178050.1|4056599_4057127_-	iron transporter	NA	NA	NA	NA	NA
WP_000118029.1|4057167_4059054_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_012372823.1|4059400_4060216_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000949452.1|4060398_4060905_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_000449408.1|4060894_4061053_-	DsbA family protein	NA	NA	NA	NA	NA
WP_000428546.1|4062379_4062973_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089068.1|4063085_4064291_-	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000088605.1|4064372_4064996_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001284954.1|4064973_4065660_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000460651.1|4065667_4066054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049802299.1|4066046_4066310_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000412211.1|4067282_4067942_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|4068142_4068520_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|4068586_4071553_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|4071555_4072116_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|4072241_4072592_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|4072794_4073808_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001334766.1|4074017_4074848_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001209508.1|4074960_4075752_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|4075915_4076263_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|4076256_4077096_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|4077223_4077724_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000983249.1|4077899_4078685_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	3.3e-33
WP_001324342.1|4078671_4080195_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000287615.1|4080317_4081862_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
4082976:4082990	attR	GGAACAGCGCCGACT	NA	NA	NA	NA
>prophage 12
NC_016860	Salmonella enterica subsp. enterica serovar Typhimurium str. T000240, complete genome	4954814	4523003	4543423	4954814	plate,tail	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4523003_4523732_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4523928_4524219_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4524467_4524923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4524919_4525525_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4525529_4527275_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4527277_4527910_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4527902_4529018_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4529008_4529368_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4529531_4531079_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4531078_4532008_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4532004_4532367_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4532694_4533417_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4533426_4534470_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4534457_4534667_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4534666_4535620_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|4535619_4537974_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4538070_4538199_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4538158_4538476_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4538527_4539052_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4539051_4540479_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4540468_4540666_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4540662_4541118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4541277_4541592_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270442.1|4541604_4542210_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	4.2e-60
WP_001226442.1|4542212_4542500_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4543075_4543423_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NC_016861	Salmonella enterica subsp. enterica serovar Typhimurium str. T000240 plasmid pSTMDT12_L, complete sequence	106510	21464	49605	106510	transposase,integrase	Escherichia_phage(44.44%)	32	41793:41852	49609:50428
WP_000082169.1|21464_22247_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
WP_001541544.1|22972_23482_+	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000905606.1|23475_23961_+	membrane protein	NA	NA	NA	NA	NA
WP_071530243.1|24237_24525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000900095.1|24680_25241_+	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_001541541.1|25307_25658_-	helix-turn-helix domain-containing protein	NA	A0A077SLN2	Escherichia_phage	80.5	1.9e-44
WP_001575489.1|26265_26916_-	SPI-2 type III secretion system effector cysteine hydrolase SpvD	NA	NA	NA	NA	NA
WP_001122242.1|27176_27902_-	type III secretion system effector phosphothreonine lyase SpvC	NA	NA	NA	NA	NA
WP_001676648.1|28183_29959_-	SPI-2 type III secretion system effector NAD(+)--protein-arginine ADP-ribosyltransferase SpvB	NA	NA	NA	NA	NA
WP_001526987.1|30010_30178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526990.1|30140_30908_-	virulence protein SpvA	NA	NA	NA	NA	NA
WP_001576629.1|31081_31246_-	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
WP_000346691.1|31419_32313_-	virulence genes transcriptional activator SpvR	NA	NA	NA	NA	NA
WP_001121399.1|32921_33959_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_001576625.1|34147_35173_-	ExeA family protein	NA	NA	NA	NA	NA
WP_000098783.1|35105_36770_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|37105_37810_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000080861.1|38096_39233_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000248278.1|39283_39511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|39534_39726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|40207_40750_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|40762_41623_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
41793:41852	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|41855_42560_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000184001.1|42735_43941_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|44096_44300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|44427_45267_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|45260_45608_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|45771_46563_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|46568_46859_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|46970_47468_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|47612_48626_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|48900_49605_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
49609:50428	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTGAGCGTTACGCCCTGTTGATTCAGGGCATACACAATGTCCTGCAGGTCCTTAATGCTGCGGGCCAGGCGATCCACGCGTGTCACCATCAACGTATCACCAGGGCGCAGGAACTCCAGCAGCAGCTGCAACTCGCTCCTTCCGGTCCGGCCGCTTCCGCTGGCTTTTTCTGCACGAATAATTTCACAACCAGCAGCGCGGAGAATTTGTGTCTGCAGAGTAAGATCCTGATCGCTGGTTGAAACGCGGGCATAGCCGTAAAGTGCCATAATGGTGAAAACTGTCTCGTTTAACTCTAGATGATGAAAACGTAACACCGGAATGGGATAAAAACAACCCAAATGAGACAGAAAAACTGTCTCACCAGACTGTGCGTTTTGGGTGTACTCAAAAAATACATTTTCATTCCAGAGAAAATTTAATGAGCTCTTAATGTAATGCGAGGCTGACTGTATTCGGACTCGGACTGCTTCAGTTATACTTCGAAAAACTCAACCTTACCGCCAGTAAGGTGATACATACTGCCAACGATTTTAATTTTCTTCTCATCTTCCAGTTGTTTCAGCACCGGGCTGTTTTTGCGGATGTTTTCGATAGTCAGCTCGACATTTTTTCGTGCCACCGCATCGACAAAATCATAATTGCTACCTTTACGCTCACCGCTATACTCCGTTTTTGCAATCGCGGGTTTAATTTCATCCAGCAGCCCCGTCAGGTTACCCAGTTCAGCATTATCAATAGCACAGCGTACTGCGCCACA	NA	NA	NA	NA
>prophage 2
NC_016861	Salmonella enterica subsp. enterica serovar Typhimurium str. T000240 plasmid pSTMDT12_L, complete sequence	106510	53486	62782	106510	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_001541564.1|53486_53903_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|54086_54422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001541562.1|54478_55045_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728917.1|55076_56018_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_000427676.1|56432_57638_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000064274.1|57637_58612_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.1e-84
WP_000457541.1|58693_59968_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_000925627.1|59967_60390_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000490265.1|60900_61371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369839.1|61363_61720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088645.1|62101_62782_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
