The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_016943	Blastococcus saxobsidens DD2, complete genome	4875340	1404212	1472644	4875340	integrase,transposase,protease	Mycobacterium_phage(20.0%)	51	1403364:1403380	1456594:1456610
1403364:1403380	attL	GCGGAGCTGGCGGTGCT	NA	NA	NA	NA
WP_014375299.1|1404212_1405346_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A249XVB5	Mycobacterium_phage	35.3	1.0e-46
WP_051004873.1|1405657_1405879_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014375301.1|1406429_1406882_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_166486490.1|1407281_1407689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014375304.1|1407682_1408582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014375305.1|1408578_1409262_+	flagellar protein FlgA	NA	NA	NA	NA	NA
WP_014375306.1|1409276_1410077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041776207.1|1410093_1411488_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_014375308.1|1411484_1412396_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_014375309.1|1412392_1413307_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_014375310.1|1413337_1413535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014375311.1|1413663_1414008_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_014375312.1|1414004_1414430_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_014375313.1|1414426_1414873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014375314.1|1414869_1418106_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014375316.1|1418744_1419002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014375317.1|1419303_1420122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166486716.1|1420151_1420502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014375319.1|1420501_1421308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051004875.1|1421300_1422929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014375321.1|1422925_1424440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014375322.1|1424436_1425945_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_014375323.1|1425941_1427111_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	42.4	5.3e-19
WP_014375324.1|1427176_1429090_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_166486491.1|1429104_1429665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014375326.1|1429661_1430141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014375327.1|1430250_1430547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166486492.1|1430570_1431884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041776211.1|1432947_1434333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014375332.1|1435089_1435611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014375334.1|1436022_1437024_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	28.7	3.9e-10
WP_041775647.1|1437020_1438796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014374930.1|1438961_1440269_+|transposase	IS256-like element ISBsa1 family transposase	transposase	NA	NA	NA	NA
WP_166486418.1|1440347_1440803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041775648.1|1440959_1441469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166486493.1|1441609_1442539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041775650.1|1442884_1448380_-	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_041776212.1|1448794_1449517_+|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
WP_014375340.1|1449513_1451559_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_041776213.1|1451576_1452623_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_014375342.1|1452622_1453816_+	TniQ family protein	NA	NA	NA	NA	NA
WP_014375345.1|1454644_1456444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051004876.1|1456458_1458804_+	sensor histidine kinase	NA	NA	NA	NA	NA
1456594:1456610	attR	GCGGAGCTGGCGGTGCT	NA	NA	NA	NA
WP_014375347.1|1458800_1459937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166486494.1|1459998_1460544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014375349.1|1460719_1461799_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_014375350.1|1462106_1466870_+	DEAD/DEAH box helicase	NA	A0A1V0SHP4	Klosneuvirus	23.4	5.7e-27
WP_014375351.1|1467396_1468044_+	histidine kinase	NA	NA	NA	NA	NA
WP_166486495.1|1468040_1470053_+	DUF2306 domain-containing protein	NA	NA	NA	NA	NA
WP_014375353.1|1470308_1471757_+	trigger factor	NA	NA	NA	NA	NA
WP_051005141.1|1472044_1472644_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	49.7	3.0e-42
>prophage 2
NC_016943	Blastococcus saxobsidens DD2, complete genome	4875340	1717240	1783277	4875340	integrase,transposase	Mycobacterium_phage(50.0%)	55	1715491:1715508	1789049:1789066
1715491:1715508	attL	GGCGGCGATGGCGGCCAG	NA	NA	NA	NA
WP_014375595.1|1717240_1718548_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	76.8	5.1e-196
WP_014375596.1|1718928_1719159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166486724.1|1719271_1720093_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_014375599.1|1720361_1720601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014375602.1|1721704_1725322_+	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_014375603.1|1725553_1726660_+|integrase	site-specific integrase	integrase	A0A0E3XBN7	Gordonia_phage	38.7	1.4e-53
WP_014375604.1|1727564_1728518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166486725.1|1728667_1729306_-	peptidase	NA	NA	NA	NA	NA
WP_166486726.1|1729777_1730185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014375607.1|1730172_1731144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166486510.1|1731161_1731875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014375610.1|1731879_1732662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014375611.1|1732658_1734197_+	CpaF family protein	NA	NA	NA	NA	NA
WP_014375612.1|1734193_1735060_+	pilus assembly protein TadB	NA	NA	NA	NA	NA
WP_014375613.1|1735056_1735956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014375614.1|1735982_1736219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014375615.1|1736235_1736706_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_014375616.1|1736702_1737167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166486511.1|1737163_1737589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166486727.1|1737669_1740957_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014375619.1|1741371_1742448_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_014375620.1|1742444_1742753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051004909.1|1742930_1743209_+	multiubiquitin domain-containing protein	NA	NA	NA	NA	NA
WP_014375622.1|1743183_1744416_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_014375623.1|1744405_1744810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014375625.1|1745499_1747788_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_014375626.1|1748183_1748735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014375628.1|1749126_1749720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166486512.1|1750070_1750847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051004913.1|1751299_1751956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014375631.1|1751964_1752327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014375632.1|1752326_1753133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166486728.1|1753173_1754742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014375634.1|1754738_1756253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014375635.1|1756249_1757758_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_014375636.1|1757754_1758921_+	M23 family metallopeptidase	NA	A0A2D0ZM66	Rhodococcus_phage	34.5	2.8e-28
WP_014375637.1|1759028_1759595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014375638.1|1759591_1759900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014375639.1|1759899_1761192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014375640.1|1761204_1762725_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_166486513.1|1762721_1763201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014375642.1|1763385_1764033_+	Abi family protein	NA	NA	NA	NA	NA
WP_166486514.1|1764227_1764956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041775678.1|1765057_1766140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166486729.1|1766398_1772011_-	relaxase domain-containing protein	NA	V5UQN3	Mycobacterium_phage	24.9	6.9e-32
WP_166486710.1|1772186_1773485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014375253.1|1773637_1773982_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_166486711.1|1773978_1775055_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_041776212.1|1775530_1776253_+|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
WP_014375340.1|1776249_1778295_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_041776213.1|1778312_1779359_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_014375342.1|1779358_1780552_+	TniQ family protein	NA	NA	NA	NA	NA
WP_166486515.1|1780738_1781134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051004915.1|1781437_1781773_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014375649.1|1782227_1783277_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
1789049:1789066	attR	GGCGGCGATGGCGGCCAG	NA	NA	NA	NA
>prophage 3
NC_016943	Blastococcus saxobsidens DD2, complete genome	4875340	4226714	4267817	4875340	integrase,transposase,protease	Bacillus_virus(50.0%)	39	4235718:4235737	4276913:4276932
WP_014378067.1|4226714_4228376_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_166486602.1|4228441_4228693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014378068.1|4228783_4228993_-	biotin/lipoyl-binding carrier protein	NA	NA	NA	NA	NA
WP_014378069.1|4229004_4230348_-	biotin carboxylase	NA	NA	NA	NA	NA
WP_014378070.1|4230426_4231890_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_014378071.1|4231886_4232651_-	acetate--CoA ligase family protein	NA	NA	NA	NA	NA
WP_041776776.1|4232775_4234311_-	methylmalonyl-CoA carboxyltransferase	NA	NA	NA	NA	NA
WP_014378073.1|4234468_4235764_-	TRAP transporter large permease	NA	NA	NA	NA	NA
4235718:4235737	attL	GCCAGCAGCAGCACCAGCAG	NA	NA	NA	NA
WP_166486603.1|4235815_4236289_-	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
WP_014378075.1|4236500_4237592_-	TRAP transporter substrate-binding protein DctP	NA	NA	NA	NA	NA
WP_014378076.1|4237883_4238843_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014378077.1|4239154_4239769_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_014378080.1|4240570_4241056_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014378081.1|4241028_4241523_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_166486604.1|4241519_4241942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014378083.1|4241938_4242688_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	48.4	4.7e-53
WP_014378085.1|4243202_4244087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051005083.1|4244086_4244869_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014378088.1|4245249_4245843_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	34.2	1.5e-17
WP_014378089.1|4245839_4246661_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.0	4.9e-19
WP_014378090.1|4246675_4248208_-	methylmalonyl-CoA carboxyltransferase	NA	NA	NA	NA	NA
WP_014378091.1|4248311_4249061_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_014378092.1|4249094_4251329_-	acetate--CoA ligase family protein	NA	NA	NA	NA	NA
WP_014378093.1|4251377_4252226_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014378094.1|4252222_4253059_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.2	2.0e-28
WP_166486605.1|4253063_4254071_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_166486606.1|4254256_4255342_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_193345667.1|4255457_4256513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014378098.1|4257001_4257247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166486710.1|4257764_4259063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014375253.1|4259215_4259560_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_166486711.1|4259556_4260633_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_014378100.1|4261507_4261939_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_014378101.1|4261938_4262199_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_014378102.1|4262320_4263688_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_166486607.1|4264111_4264984_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014378105.1|4264953_4266120_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	NA	NA	NA	NA
WP_014378106.1|4266213_4266918_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014378107.1|4266938_4267817_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
4276913:4276932	attR	GCCAGCAGCAGCACCAGCAG	NA	NA	NA	NA
