The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017671	Stenotrophomonas maltophilia D457, complete genome	4769156	289680	306148	4769156	head,tail	Stenotrophomonas_phage(30.77%)	18	NA	NA
WP_014645595.1|289680_290193_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_014645596.1|290189_290540_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_014645597.1|290563_290920_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_014645598.1|290991_291651_+|tail	phage tail protein	tail	C4ML12	Xanthomonas_virus	56.6	1.2e-63
WP_014645599.1|291650_291959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014645600.1|292009_292267_+	DUF1799 domain-containing protein	NA	Q7Y5K1	Xanthomonas_virus	36.4	3.2e-09
WP_051007144.1|292342_293707_+|tail	phage tail protein	tail	K7PM62	Enterobacteria_phage	31.1	1.6e-19
WP_014645602.1|293703_294033_+|tail	phage tail protein	tail	C7BGC9	Burkholderia_phage	54.5	7.2e-22
WP_041862964.1|294035_295208_+	hypothetical protein	NA	A0A0H4IPB2	Stenotrophomonas_phage	32.1	2.7e-31
WP_014645603.1|295325_296477_+	hypothetical protein	NA	Q2PGC1	Xanthomonas_oryzae_phage	37.8	3.0e-30
WP_146257713.1|296508_297630_+	hypothetical protein	NA	A0A0H4IPB2	Stenotrophomonas_phage	33.7	1.1e-37
WP_014645605.1|297631_298084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014645606.1|298096_299236_+	hypothetical protein	NA	A0A0H4IPB2	Stenotrophomonas_phage	32.9	2.4e-32
WP_014645607.1|299276_300413_+	hypothetical protein	NA	A0A0H4IPB2	Stenotrophomonas_phage	50.5	2.1e-76
WP_014645608.1|300565_301261_+|tail	phage minor tail protein L	tail	A0A2R3UA90	Siphoviridae_environmental_samples	67.1	7.4e-93
WP_014645609.1|301324_302065_+	C40 family peptidase	NA	A0A2R3UAR4	Siphoviridae_environmental_samples	58.0	5.8e-80
WP_041862966.1|302057_302663_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	53.0	6.7e-50
WP_014645611.1|302659_306148_+	host specificity protein J	NA	A0A2R3UA88	Siphoviridae_environmental_samples	58.4	0.0e+00
>prophage 2
NC_017671	Stenotrophomonas maltophilia D457, complete genome	4769156	622164	630575	4769156		Enterobacteria_phage(42.86%)	9	NA	NA
WP_014645855.1|622164_623220_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.5	4.9e-80
WP_014645856.1|623234_624122_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	1.1e-96
WP_014645857.1|624118_624676_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	50.6	6.0e-45
WP_014645858.1|624672_625566_+	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	36.8	1.4e-27
WP_014645859.1|625668_627072_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.9	6.5e-48
WP_014645860.1|627083_628430_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.3	6.5e-29
WP_014645861.1|628570_629305_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_014645862.1|629306_629939_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_014645863.1|629987_630575_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	S4W3Y0	Pandoravirus	39.5	9.1e-28
>prophage 3
NC_017671	Stenotrophomonas maltophilia D457, complete genome	4769156	1746275	1787409	4769156	transposase,capsid,integrase,portal,terminase,tail	Stenotrophomonas_phage(88.89%)	48	1753273:1753321	1796290:1796338
WP_086009121.1|1746275_1747068_-|transposase	IS5-like element ISStma16 family transposase	transposase	NA	NA	NA	NA
WP_032959318.1|1747660_1749124_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_014646635.1|1749120_1750260_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_014646636.1|1750270_1750999_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.5	2.9e-39
WP_014646637.1|1750995_1751910_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014646638.1|1751912_1752362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014646639.1|1752354_1752756_-	hypothetical protein	NA	NA	NA	NA	NA
1753273:1753321	attL	CGGATTGCAAATCCGTTTACAGCGGTTCGATTCCGCTTGAGGCCTCCAA	NA	NA	NA	NA
WP_041863243.1|1753481_1754597_+|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	27.8	3.5e-20
WP_041863244.1|1754584_1754935_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_148277515.1|1755051_1755690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041863247.1|1755710_1755971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041863249.1|1755967_1756540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014646642.1|1756542_1757193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041864125.1|1757189_1757399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014646644.1|1757521_1759666_-	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	42.7	3.7e-151
WP_041863250.1|1759658_1760357_-	hypothetical protein	NA	B7SYG5	Stenotrophomonas_phage	84.8	3.3e-109
WP_041863252.1|1760353_1760746_-	hypothetical protein	NA	B7SYG6	Stenotrophomonas_phage	70.0	1.7e-46
WP_014646646.1|1760753_1761242_-	hypothetical protein	NA	B7SYG7	Stenotrophomonas_phage	96.9	1.5e-84
WP_014646647.1|1761238_1761478_-	hypothetical protein	NA	B7SYG8	Stenotrophomonas_phage	89.9	2.8e-36
WP_014646648.1|1761474_1761801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041863253.1|1761797_1762070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173390337.1|1762408_1762558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041863254.1|1762554_1762854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014646649.1|1762850_1763075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041863255.1|1763354_1763648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148277516.1|1763657_1764011_-	hypothetical protein	NA	B7SYH3	Stenotrophomonas_phage	33.0	6.5e-05
WP_041863260.1|1764575_1764902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041863262.1|1764888_1765227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041863264.1|1765223_1765754_+	hypothetical protein	NA	B7SYH6	Stenotrophomonas_phage	93.2	9.9e-90
WP_041863265.1|1765755_1765986_+	hypothetical protein	NA	B7SYH7	Stenotrophomonas_phage	85.5	3.9e-27
WP_041863267.1|1766161_1768594_+	DNA primase	NA	B7SYD0	Stenotrophomonas_phage	92.4	0.0e+00
WP_014646652.1|1768936_1769581_+	hypothetical protein	NA	B7SYD2	Stenotrophomonas_phage	85.0	8.4e-83
WP_014646653.1|1769577_1771503_+|terminase	phage terminase large subunit family protein	terminase	B7SYD3	Stenotrophomonas_phage	97.7	0.0e+00
WP_041863268.1|1771496_1771817_+	hypothetical protein	NA	B7SYD4	Stenotrophomonas_phage	98.1	4.6e-50
WP_148277517.1|1771842_1772142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041863270.1|1772113_1773604_+|portal	phage portal protein	portal	B7SYD6	Stenotrophomonas_phage	97.8	6.5e-280
WP_041863272.1|1773600_1775583_+	peptidase S14	NA	B7SYD7	Stenotrophomonas_phage	96.2	0.0e+00
WP_014646657.1|1775605_1775971_+	DUF2190 family protein	NA	B7SYD8	Stenotrophomonas_phage	94.2	4.6e-54
WP_014646658.1|1776051_1776483_+|capsid	phage capsid protein	capsid	B7SYD9	Stenotrophomonas_phage	88.1	3.3e-67
WP_014646659.1|1776482_1776824_+	hypothetical protein	NA	B7SYE0	Stenotrophomonas_phage	54.5	1.6e-24
WP_014646660.1|1776820_1777312_+	hypothetical protein	NA	B7SYE1	Stenotrophomonas_phage	71.2	1.9e-50
WP_014646661.1|1777308_1777632_+	hypothetical protein	NA	B7SYE3	Stenotrophomonas_phage	95.3	1.4e-49
WP_041863274.1|1777624_1778107_+	hypothetical protein	NA	B7SYE4	Stenotrophomonas_phage	94.9	5.9e-65
WP_014646662.1|1778120_1778921_+	hypothetical protein	NA	B7SYE5	Stenotrophomonas_phage	95.9	2.0e-142
WP_080052974.1|1778973_1779642_+	hypothetical protein	NA	B7SYE6	Stenotrophomonas_phage	95.5	9.2e-117
WP_014646664.1|1779634_1783384_+|tail	phage tail length tape measure family protein	tail	B7SYE7	Stenotrophomonas_phage	77.3	0.0e+00
WP_041863276.1|1783383_1783800_+	hypothetical protein	NA	B7SYE8	Stenotrophomonas_phage	98.6	4.7e-71
WP_014646665.1|1783803_1787409_+	hypothetical protein	NA	B7SYE9	Stenotrophomonas_phage	98.3	0.0e+00
1796290:1796338	attR	CGGATTGCAAATCCGTTTACAGCGGTTCGATTCCGCTTGAGGCCTCCAA	NA	NA	NA	NA
>prophage 4
NC_017671	Stenotrophomonas maltophilia D457, complete genome	4769156	2418452	2429823	4769156		Stenotrophomonas_phage(77.78%)	14	NA	NA
WP_041863429.1|2418452_2419571_-	sensor histidine kinase	NA	A0A1B0VMK3	Pseudomonas_phage	38.6	3.5e-60
WP_014647142.1|2420260_2420488_+	hypothetical protein	NA	S0F3S0	Stenotrophomonas_phage	64.3	8.1e-09
WP_158454141.1|2420484_2420661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014647143.1|2420650_2421757_+	replication initiation factor domain-containing protein	NA	S0F3I3	Stenotrophomonas_phage	96.5	4.0e-210
WP_014647144.1|2421763_2422066_+	single-stranded DNA-binding protein	NA	B1NI78	Stenotrophomonas_phage	92.7	4.7e-44
WP_041863430.1|2422069_2422327_+	hypothetical protein	NA	S0F2C2	Stenotrophomonas_phage	98.8	2.7e-40
WP_051007159.1|2422374_2422509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148277524.1|2423163_2424075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014647145.1|2424071_2424470_+	hypothetical protein	NA	S0F3B3	Stenotrophomonas_phage	96.2	8.6e-62
WP_014647146.1|2424474_2425767_+	Zona occludens toxin	NA	S0F2C3	Stenotrophomonas_phage	96.7	4.2e-243
WP_041863434.1|2426225_2426576_-	hypothetical protein	NA	S0F2N2	Stenotrophomonas_phage	72.4	7.3e-41
WP_158454142.1|2426995_2427451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080052986.1|2427452_2428274_+	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_158454143.1|2428488_2429823_-	protein kinase	NA	G9BWE0	Planktothrix_phage	31.1	5.2e-10
>prophage 5
NC_017671	Stenotrophomonas maltophilia D457, complete genome	4769156	3338965	3354301	4769156	tail	Xanthomonas_virus(57.14%)	12	NA	NA
WP_014647903.1|3338965_3347254_-|tail	phage tail protein	tail	I7HDJ4	Xanthomonas_virus	47.8	4.9e-10
WP_014647904.1|3347244_3347640_-	hypothetical protein	NA	Q2NPH1	Xanthomonas_virus	47.4	5.2e-27
WP_014647905.1|3347639_3348101_-	DUF1833 family protein	NA	I7GYA2	Xanthomonas_virus	50.3	1.1e-36
WP_014647906.1|3348097_3348451_-	hypothetical protein	NA	I7H418	Xanthomonas_virus	39.0	4.8e-16
WP_069116152.1|3348447_3350763_-|tail	phage tail tape measure protein	tail	A0A2R3UAA7	Siphoviridae_environmental_samples	33.2	5.0e-37
WP_041863668.1|3350857_3351076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014647908.1|3351180_3351525_-	hypothetical protein	NA	G9FHI3	Rhodococcus_phage	50.0	7.5e-22
WP_014037992.1|3351524_3351983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014647909.1|3352348_3353020_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_014647910.1|3353016_3353439_+	HIT family protein	NA	NA	NA	NA	NA
WP_005418011.1|3353454_3353622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014037995.1|3353728_3354301_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.2	4.5e-72
>prophage 6
NC_017671	Stenotrophomonas maltophilia D457, complete genome	4769156	3610374	3694313	4769156	plate,capsid,integrase,portal,holin,tRNA,protease,terminase,tail,head,lysis	Stenotrophomonas_phage(77.27%)	89	3641519:3641567	3676953:3677001
WP_014648096.1|3610374_3611088_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_014648097.1|3611097_3613146_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	5.0e-89
WP_014648099.1|3613751_3614288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014648100.1|3614284_3616723_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_014648101.1|3616819_3618919_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_014648102.1|3618915_3620481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041863711.1|3620511_3622668_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_014648104.1|3622798_3623323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014648105.1|3623398_3627481_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	2.2e-51
WP_005410730.1|3627567_3628116_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	33.8	5.7e-16
WP_032958973.1|3628687_3630493_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	34.9	1.8e-82
WP_014648107.1|3630697_3631078_+	CopL family metal-binding regulatory protein	NA	NA	NA	NA	NA
WP_014648108.1|3631153_3632965_+	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_014648109.1|3632961_3633957_+	copper resistance protein B	NA	NA	NA	NA	NA
WP_014648110.1|3634038_3634551_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014648111.1|3634629_3634935_-	zf-TFIIB domain-containing protein	NA	NA	NA	NA	NA
WP_014648112.1|3635084_3635852_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014648113.1|3635944_3636367_+	response regulator	NA	NA	NA	NA	NA
WP_014648114.1|3636375_3637314_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014648115.1|3637398_3638262_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014648116.1|3638311_3638776_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_014648117.1|3638779_3639316_-	glycoside hydrolase family protein	NA	I6NW41	Burkholderia_virus	54.4	1.5e-45
WP_014038210.1|3639312_3639510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014038211.1|3639635_3640064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148277546.1|3640053_3640344_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041863715.1|3640399_3640906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032958956.1|3640994_3641228_+	hypothetical protein	NA	NA	NA	NA	NA
3641519:3641567	attL	TGGTGGGCCGTGAAGGATTCGAACCTTCGACCAAAAGATTAAAAGTCTT	NA	NA	NA	NA
WP_041863717.1|3641762_3642545_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_148277529.1|3642580_3643162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080053042.1|3643259_3643718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041863722.1|3644797_3645763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041863724.1|3645759_3646287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014648120.1|3646340_3647348_-|portal	phage portal protein	portal	V9IQW4	Stenotrophomonas_phage	98.1	7.0e-177
WP_014648121.1|3647347_3649105_-|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	97.2	0.0e+00
WP_041863728.1|3649256_3650117_+|capsid	GPO family capsid scaffolding protein	capsid	V9IQG8	Stenotrophomonas_phage	99.1	2.1e-121
WP_014648123.1|3650150_3651167_+|capsid	phage major capsid protein, P2 family	capsid	V9IQV7	Stenotrophomonas_phage	88.5	9.9e-163
WP_014648124.1|3651169_3651877_+|terminase	terminase	terminase	V9IQK3	Stenotrophomonas_phage	98.8	2.2e-84
WP_014648125.1|3651981_3652449_+|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	94.8	7.9e-75
WP_014648126.1|3652448_3652664_+|tail	tail protein X	tail	V9IQL8	Stenotrophomonas_phage	80.3	1.1e-23
WP_041863730.1|3652666_3653020_+	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	96.6	1.1e-52
WP_014648128.1|3653012_3653288_+|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	100.0	5.5e-44
WP_041863732.1|3653289_3653925_+	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	98.8	7.7e-89
WP_014648130.1|3653924_3654449_+	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	70.6	4.4e-50
WP_014648131.1|3654445_3654931_+|tail	phage tail protein	tail	V9IQM0	Stenotrophomonas_phage	79.6	1.6e-62
WP_014648132.1|3654927_3655389_+	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	96.7	6.6e-74
WP_014648133.1|3655475_3656366_+|plate	baseplate J/gp47 family protein	plate	V9IQV9	Stenotrophomonas_phage	99.3	1.4e-160
WP_014648134.1|3656358_3656916_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	98.4	1.2e-101
WP_014648135.1|3656925_3658773_+	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	74.3	4.2e-228
WP_014648137.1|3659499_3660066_+|plate	phage baseplate assembly protein V	plate	V9IQH1	Stenotrophomonas_phage	96.8	1.4e-62
WP_014648138.1|3660062_3660422_+	GPW/gp25 family protein	NA	V9IQW0	Stenotrophomonas_phage	98.3	1.1e-60
WP_014648139.1|3660438_3661608_+|tail	phage tail sheath protein	tail	V9IQK9	Stenotrophomonas_phage	96.0	3.2e-181
WP_014648140.1|3661631_3662141_+|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	98.8	3.3e-90
WP_014648141.1|3662200_3662527_+|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	93.6	8.3e-47
WP_014648142.1|3662535_3662652_+|tail	GpE family phage tail protein	tail	V9IQH2	Stenotrophomonas_phage	100.0	8.0e-13
WP_014648143.1|3662824_3665689_+|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	84.8	0.0e+00
WP_014648144.1|3665700_3666099_+|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	97.7	1.2e-66
WP_014648145.1|3666095_3667091_+	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	79.9	4.1e-137
WP_041863735.1|3667087_3668464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041863737.1|3668963_3669395_-	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	38.2	1.6e-13
WP_041863739.1|3669465_3669798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041863741.1|3669794_3670139_+	ogr/Delta-like zinc finger family protein	NA	V9IQW3	Stenotrophomonas_phage	73.7	5.7e-46
WP_014648147.1|3670207_3670414_+	hypothetical protein	NA	V9IQL4	Stenotrophomonas_phage	91.2	7.9e-27
WP_014648148.1|3670737_3670980_+	hypothetical protein	NA	V9IQX5	Stenotrophomonas_phage	91.2	2.4e-35
WP_014648149.1|3670979_3671288_+	hypothetical protein	NA	V9IQM8	Stenotrophomonas_phage	68.9	3.9e-30
WP_014648150.1|3671287_3671533_+	hypothetical protein	NA	V9IQH4	Stenotrophomonas_phage	91.4	2.3e-33
WP_014648151.1|3671641_3674332_+	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	99.1	0.0e+00
WP_051007168.1|3674417_3674843_+	hypothetical protein	NA	V9IQL6	Stenotrophomonas_phage	94.7	3.0e-65
WP_041863743.1|3674835_3675021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041863745.1|3675013_3675199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041863749.1|3675470_3675689_+	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	79.3	6.2e-22
WP_014648153.1|3675688_3676885_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	53.2	3.0e-110
WP_014648154.1|3677205_3678162_+	hypothetical protein	NA	NA	NA	NA	NA
3676953:3677001	attR	TGGTGGGCCGTGAAGGATTCGAACCTTCGACCAAAAGATTAAAAGTCTT	NA	NA	NA	NA
WP_014648155.1|3678301_3678967_-	7-cyano-7-deazaguanine synthase QueC	NA	M1PKZ7	Cellulophaga_phage	33.3	5.3e-24
WP_014648156.1|3679045_3679747_-	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	42.9	2.3e-38
WP_014648157.1|3679953_3680772_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_014648158.1|3680775_3681294_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_014038220.1|3681358_3682678_-	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_014648159.1|3682963_3684019_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_006438804.1|3684008_3684437_-	protein TolR	NA	NA	NA	NA	NA
WP_005410752.1|3684461_3685241_-	protein TolQ	NA	NA	NA	NA	NA
WP_014648160.1|3685251_3685683_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_014648161.1|3685672_3686713_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	28.2	7.8e-06
WP_172412065.1|3686849_3688700_-	KUP/HAK/KT family potassium transporter	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	33.3	1.9e-79
WP_014648163.1|3688818_3689412_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_014648164.1|3689425_3689947_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_014648165.1|3690052_3690784_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_032958946.1|3690960_3691593_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_014648167.1|3691668_3692190_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014648169.1|3692561_3694313_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
