The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_020418	Morganella morganii subsp. morganii KT, complete sequence	3799539	434115	442962	3799539		Escherichia_phage(66.67%)	8	NA	NA
WP_004237914.1|434115_436071_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.0	5.7e-82
WP_004237912.1|436439_437060_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	55.5	3.0e-61
WP_015422349.1|437148_437835_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004237910.1|437962_438253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004237909.1|438320_438932_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.2	2.4e-23
WP_004237908.1|439017_439878_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	35.7	1.1e-26
WP_004237907.1|439879_440497_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	8.0e-75
WP_015422350.1|440508_442962_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.7	1.7e-216
>prophage 2
NC_020418	Morganella morganii subsp. morganii KT, complete sequence	3799539	1518296	1526351	3799539	tRNA	Mycobacterium_phage(33.33%)	8	NA	NA
WP_004235572.1|1518296_1519502_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.5	5.5e-27
WP_004235573.1|1520107_1521070_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	73.4	2.2e-135
WP_004235574.1|1521094_1523215_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	52.6	3.6e-207
WP_004235579.1|1523245_1523662_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	40.4	1.4e-11
WP_004235580.1|1523683_1523902_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	51.4	2.3e-16
WP_004235581.1|1524210_1525293_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_004235582.1|1525474_1525942_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004235583.1|1526141_1526351_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	4.5e-22
>prophage 3
NC_020418	Morganella morganii subsp. morganii KT, complete sequence	3799539	1710692	1720535	3799539	tRNA,protease	Planktothrix_phage(16.67%)	8	NA	NA
WP_004235797.1|1710692_1712639_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.9	1.2e-36
WP_004235798.1|1712725_1712956_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	56.7	2.6e-15
WP_015422570.1|1713214_1713535_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.7	2.6e-16
WP_004235801.1|1713568_1715854_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.5	2.8e-173
WP_002211347.1|1715930_1716149_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004235802.1|1716299_1717019_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004235803.1|1716996_1718763_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.9	5.8e-17
WP_015422571.1|1718765_1720535_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.6	2.2e-24
>prophage 4
NC_020418	Morganella morganii subsp. morganii KT, complete sequence	3799539	2084936	2130015	3799539	terminase,transposase,integrase,tail,holin,plate	Morganella_phage(61.11%)	48	2084849:2084905	2114076:2114132
2084849:2084905	attL	ACTGACTTGTAATCAGTAGGTCACCAGTTCGACTCCGGTAGCCGGCACCATATTAAA	NA	NA	NA	NA
WP_015422638.1|2084936_2086088_-|integrase	site-specific integrase	integrase	A0A2H5BFK7	Salmonella_phage	69.8	6.6e-155
WP_015422639.1|2086625_2087021_-	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	97.7	1.0e-70
WP_004236758.1|2087021_2087636_-	ERF family protein	NA	A0A1W6JP21	Morganella_phage	98.0	4.2e-108
WP_015422640.1|2087638_2088001_-	hypothetical protein	NA	A0A1W6JNZ2	Morganella_phage	85.8	6.4e-56
WP_004240098.1|2088158_2088335_-	hypothetical protein	NA	A0A1W6JNY7	Morganella_phage	100.0	6.3e-25
WP_004235553.1|2088766_2089699_+|transposase	IS5-like element ISKpn13 family transposase	transposase	Q38213	Escherichia_phage	55.7	5.2e-94
WP_004235553.1|2089886_2090819_-|transposase	IS5-like element ISKpn13 family transposase	transposase	Q38213	Escherichia_phage	55.7	5.2e-94
WP_004242341.1|2091065_2091278_+	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	100.0	2.0e-33
WP_015422641.1|2091503_2092433_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	98.5	1.1e-147
WP_079549287.1|2092504_2093266_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_015422642.1|2093594_2094035_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	54.0	5.2e-28
WP_004242347.1|2094341_2094800_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_015422643.1|2095569_2095779_+	hypothetical protein	NA	A0A1W6JNU4	Morganella_phage	67.2	8.5e-21
WP_004238694.1|2096450_2096642_+|holin	phage holin family protein	holin	A0A1W6JNY9	Morganella_phage	100.0	1.4e-30
WP_015422644.1|2096634_2097111_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	96.2	1.3e-85
WP_004238716.1|2097247_2097625_+	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	96.8	1.7e-59
WP_015422646.1|2098244_2098544_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	100.0	3.3e-50
WP_004235553.1|2098679_2099612_-|transposase	IS5-like element ISKpn13 family transposase	transposase	Q38213	Escherichia_phage	55.7	5.2e-94
WP_071823269.1|2100020_2100374_+	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	94.0	8.4e-61
WP_015422647.1|2100520_2100991_+|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	92.9	1.3e-80
WP_015422648.1|2100994_2102725_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	93.1	0.0e+00
WP_048884220.1|2102876_2103164_+|tail	phage tail protein	tail	A0A1W6JP11	Morganella_phage	92.6	2.3e-48
WP_015422649.1|2103160_2103919_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	94.0	3.8e-143
WP_015422650.1|2103921_2104623_+	C40 family peptidase	NA	A0A1W6JP31	Morganella_phage	95.6	1.2e-135
WP_048884221.1|2104655_2105258_+|tail	tail assembly protein	tail	A0A1W6JNY8	Morganella_phage	92.0	7.0e-100
WP_015422652.1|2105290_2109379_+	DUF1983 domain-containing protein	NA	A0A1W6JNZ7	Morganella_phage	67.1	0.0e+00
WP_015422653.1|2109847_2111485_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015422654.1|2111494_2111752_-	YjhX family toxin	NA	NA	NA	NA	NA
WP_015422655.1|2112197_2112614_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	94.2	4.1e-67
WP_015422656.1|2112613_2113876_+	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	96.9	1.2e-234
WP_004237458.1|2114183_2114843_+	hypothetical protein	NA	NA	NA	NA	NA
2114076:2114132	attR	ACTGACTTGTAATCAGTAGGTCACCAGTTCGACTCCGGTAGCCGGCACCATATTAAA	NA	NA	NA	NA
WP_105212818.1|2114940_2116062_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_015422658.1|2116286_2116973_+	DUF4431 domain-containing protein	NA	NA	NA	NA	NA
WP_015422659.1|2117184_2117616_+	hypothetical protein	NA	B6SCU4	Bacteriophage	47.8	4.1e-25
WP_004237452.1|2117764_2118328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004237451.1|2118478_2118994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004237450.1|2119003_2120491_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.3	9.6e-82
WP_004237449.1|2120506_2120959_+	hypothetical protein	NA	I7ATP4	Escherichia_phage	37.8	8.3e-21
WP_004237448.1|2121000_2121459_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	49.3	1.3e-26
WP_004237447.1|2121541_2123512_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	22.6	4.9e-17
WP_004237446.1|2123508_2124048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004237445.1|2124044_2124338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004237444.1|2124330_2125146_+	hypothetical protein	NA	B5M9T8	Pseudomonas_phage	27.5	2.9e-16
WP_004237442.1|2125162_2125855_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	42.0	4.8e-36
WP_004237440.1|2125851_2126196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004237439.1|2126188_2127376_+|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	38.9	2.4e-75
WP_004237438.1|2127372_2128035_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	38.3	7.1e-37
WP_004237433.1|2129388_2130015_+|tail	tail assembly chaperone	tail	A0A218M4J2	Erwinia_phage	33.0	5.4e-26
>prophage 5
NC_020418	Morganella morganii subsp. morganii KT, complete sequence	3799539	2216574	2314757	3799539	terminase,integrase,tail,capsid,portal,lysis,tRNA,head,plate	Salmonella_phage(31.11%)	105	2254021:2254040	2308313:2308332
WP_004239475.1|2216574_2217165_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_004237330.1|2217468_2217738_+	DUF2583 family protein	NA	NA	NA	NA	NA
WP_004239474.1|2217835_2218783_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.2	7.8e-45
WP_004237327.1|2218859_2219735_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_032098297.1|2219719_2220340_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_015422676.1|2220629_2221892_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_004237324.1|2221928_2223011_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	3.0e-08
WP_004237323.1|2223010_2223847_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004237322.1|2223843_2224650_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004237321.1|2224716_2225568_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.2	4.0e-48
WP_015422677.1|2225574_2226477_+	TIGR01212 family radical SAM protein	NA	NA	NA	NA	NA
WP_004237319.1|2226484_2226934_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_004237318.1|2227015_2228737_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	29.2	1.9e-20
WP_004237316.1|2229430_2230372_+	glyoxylate/hydroxypyruvate reductase GhrA	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	28.2	5.4e-06
WP_004237315.1|2230435_2230996_+	molecular chaperone	NA	NA	NA	NA	NA
WP_004237314.1|2231060_2232374_-	citrate transporter	NA	NA	NA	NA	NA
WP_004237313.1|2232744_2233302_-	lipoprotein	NA	NA	NA	NA	NA
WP_004237312.1|2233366_2234566_-	multidrug efflux MFS transporter MdtH	NA	NA	NA	NA	NA
WP_004239462.1|2234733_2235318_+	ribosomal protein S5-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_004237309.1|2235392_2236928_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_004237307.1|2236997_2237873_+	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_015422678.1|2237946_2239677_-|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	34.8	3.1e-84
WP_004237304.1|2239845_2240400_+	VOC family protein	NA	NA	NA	NA	NA
WP_004237303.1|2240561_2241314_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_004237302.1|2241369_2243556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004237300.1|2243682_2244657_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_004237299.1|2244649_2245414_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	NA	NA	NA	NA
WP_004237298.1|2245498_2245897_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_015422679.1|2246154_2247924_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	25.7	2.4e-07
WP_004237296.1|2247929_2248382_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_004237295.1|2248433_2249177_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004237294.1|2249266_2249791_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	31.5	3.7e-12
WP_004239448.1|2249890_2250505_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_004237292.1|2250542_2251553_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.3	6.9e-07
WP_004237291.1|2251752_2252505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004237290.1|2252566_2253352_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_004237289.1|2253344_2254154_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	29.8	8.5e-16
2254021:2254040	attL	GTGGATTTTCCCGCGCCGTT	NA	NA	NA	NA
WP_004237288.1|2254230_2255145_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_048884223.1|2255167_2256544_+	murein DD-endopeptidase MepM	NA	A0A2D0ZM66	Rhodococcus_phage	37.9	1.9e-15
WP_004239444.1|2256701_2257682_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_015422681.1|2257809_2258790_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	62.0	1.3e-114
WP_048884171.1|2258856_2259156_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	80.8	2.8e-41
WP_004237284.1|2259258_2259537_+	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	55.9	9.3e-23
WP_004237283.1|2259548_2259752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004237282.1|2259776_2260205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004237281.1|2260205_2260415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015422682.1|2260539_2260947_+	DUF5347 domain-containing protein	NA	NA	NA	NA	NA
WP_004237277.1|2261015_2261237_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_004237276.1|2261229_2261451_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004237275.1|2261452_2262262_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	51.5	1.9e-63
WP_004237274.1|2262261_2264979_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	36.0	3.9e-113
WP_015422683.1|2265163_2265757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015422684.1|2265772_2266888_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	26.9	7.5e-31
WP_004237272.1|2267342_2268377_-|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	57.6	6.8e-111
WP_004237270.1|2268379_2270098_-|terminase	terminase	terminase	A0A0M4S6K7	Salmonella_phage	62.2	4.4e-195
WP_004237268.1|2270244_2271090_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	34.2	1.5e-26
WP_004237267.1|2271102_2272158_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	52.6	1.4e-98
WP_004237266.1|2272209_2273016_+	hypothetical protein	NA	A0A0M4R523	Salmonella_phage	46.4	1.4e-50
WP_004237265.1|2273111_2273597_+|head	head completion/stabilization protein	head	A0A0M4QWR7	Salmonella_phage	45.6	9.2e-26
WP_004237264.1|2273596_2273797_+|tail	tail protein X	tail	A0A0M4RTN6	Salmonella_phage	59.1	2.3e-15
WP_004237263.1|2273799_2274060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004237262.1|2274059_2274605_+	lysozyme	NA	K7PM52	Enterobacteria_phage	70.5	7.3e-72
WP_048884172.1|2274594_2275104_+|lysis	lysis protein	lysis	A0A1B0VMJ3	Pseudomonas_phage	40.7	1.8e-16
WP_004237260.1|2275100_2275256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004237259.1|2275255_2275672_+|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	45.9	2.6e-29
WP_015422687.1|2275681_2276323_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	48.1	2.1e-41
WP_004237257.1|2276319_2276949_+|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	56.9	5.0e-56
WP_004237256.1|2276945_2277284_+	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	52.3	1.9e-25
WP_015422688.1|2277286_2278195_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	67.5	1.9e-109
WP_015422689.1|2278187_2278796_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	68.4	1.5e-73
WP_004237465.1|2278792_2279995_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	67.5	5.2e-54
WP_004237466.1|2280063_2280375_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	48.7	2.4e-11
WP_004237467.1|2280443_2281565_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_004237468.1|2281600_2282608_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_004237469.1|2282730_2283174_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.9	1.1e-46
WP_004237470.1|2283179_2286065_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	39.6	8.8e-132
WP_071823271.1|2286061_2286190_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	53.8	1.1e-05
WP_004237471.1|2286213_2286513_-	hypothetical protein	NA	A0A0M4RCV2	Salmonella_phage	46.9	1.8e-11
WP_015422692.1|2286574_2287087_-|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	62.4	1.5e-55
WP_004237473.1|2287090_2288281_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0M4S6M1	Salmonella_phage	65.5	1.7e-150
WP_004237474.1|2288430_2289555_+	phage late control D family protein	NA	A0A0M4REC6	Salmonella_phage	68.1	9.0e-125
WP_048884174.1|2289605_2289866_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_004237476.1|2290047_2291067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004239443.1|2291450_2292893_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_004237479.1|2293145_2293994_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004237480.1|2294324_2295800_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	9.9e-79
WP_004237482.1|2296308_2296698_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_004237484.1|2296699_2297032_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_015422693.1|2297144_2297813_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.5	6.3e-33
WP_004237487.1|2297809_2299186_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_004237488.1|2299282_2300287_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_004237490.1|2300286_2300901_+	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
WP_015422694.1|2300928_2301786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004237492.1|2302122_2302413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015422695.1|2302597_2302897_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_004237494.1|2302900_2303782_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_015422696.1|2303847_2304864_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_004237496.1|2304905_2305910_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_004237497.1|2305906_2306911_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_004237498.1|2306904_2308467_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	32.9	3.9e-25
2308313:2308332	attR	GTGGATTTTCCCGCGCCGTT	NA	NA	NA	NA
WP_046024608.1|2308776_2309727_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_004237500.1|2309812_2311408_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_004237501.1|2311600_2311945_-	RidA family protein	NA	NA	NA	NA	NA
WP_015422697.1|2312045_2313971_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.2	1.4e-88
WP_004237504.1|2314055_2314757_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 6
NC_020418	Morganella morganii subsp. morganii KT, complete sequence	3799539	2860175	2927544	3799539	integrase,protease,tail,terminase,transposase,capsid,portal,tRNA,head,holin	Morganella_phage(74.55%)	85	2875523:2875539	2922881:2922897
WP_036417780.1|2860175_2860373_-	hypothetical protein	NA	A0A1W6JP52	Morganella_phage	67.9	1.1e-12
WP_004235070.1|2860344_2860722_-	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	38.4	7.7e-12
WP_004239826.1|2860718_2860877_-	hypothetical protein	NA	A0A1W6JP30	Morganella_phage	67.4	1.8e-10
WP_004235069.1|2860858_2861335_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	77.7	6.2e-67
WP_004235068.1|2861324_2861519_-|holin	phage holin family protein	holin	A0A1W6JNY9	Morganella_phage	73.0	2.6e-24
WP_004235065.1|2861591_2862029_-	hypothetical protein	NA	A0A1W6JNY5	Morganella_phage	47.5	5.2e-28
WP_004235063.1|2862394_2863102_+	helix-turn-helix domain-containing protein	NA	K7P8B2	Enterobacteria_phage	56.1	4.4e-69
WP_004235059.1|2863468_2863720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015422793.1|2864139_2864955_+	lipoprotein NlpA	NA	NA	NA	NA	NA
WP_004235054.1|2864995_2865670_-	CerR family C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_160312183.1|2867004_2867151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004235050.1|2867281_2867452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004235049.1|2867697_2867916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036417816.1|2868280_2869087_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_004235045.1|2869263_2869449_-	YegP family protein	NA	NA	NA	NA	NA
WP_015422796.1|2869567_2870056_-	acetyltransferase	NA	NA	NA	NA	NA
WP_004239807.1|2870124_2870346_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_004235037.1|2870499_2870766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004239806.1|2871323_2871632_-	DUF3088 family protein	NA	NA	NA	NA	NA
WP_015422798.1|2871962_2872535_-	serine hydrolase family protein	NA	NA	NA	NA	NA
WP_004235032.1|2872636_2873350_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004235031.1|2873349_2874396_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004235029.1|2874686_2875043_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_080654119.1|2875272_2875548_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	97.8	4.7e-43
2875523:2875539	attL	ACAATAAAATTAATATC	NA	NA	NA	NA
WP_004235028.1|2876025_2876874_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004239793.1|2876963_2877344_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_105212831.1|2877480_2877876_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	69.0	1.4e-43
WP_127554766.1|2877868_2878513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004235019.1|2878523_2879594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004235018.1|2879747_2879912_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-22
WP_015422804.1|2881227_2881533_-	Error-prone repair protein UmuD	NA	A0A1W6JNS2	Morganella_phage	92.9	9.5e-37
WP_015422805.1|2881734_2882283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004238651.1|2883179_2884913_+	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	29.7	6.5e-13
WP_080654114.1|2885168_2885708_-	hypothetical protein	NA	A0A1W6JNW0	Morganella_phage	95.6	8.8e-86
WP_004242380.1|2886861_2887128_-	hypothetical protein	NA	A0A1W6JNS1	Morganella_phage	98.9	5.7e-46
WP_004238648.1|2887130_2887817_-	hypothetical protein	NA	A0A1W6JNU1	Morganella_phage	98.2	1.3e-134
WP_004238646.1|2887813_2888134_-	hypothetical protein	NA	A0A1W6JNW9	Morganella_phage	99.1	6.9e-62
WP_015422806.1|2888135_2891312_-	host specificity protein J	NA	A0A1W6JNZ7	Morganella_phage	94.4	0.0e+00
WP_048884221.1|2891344_2891947_-|tail	tail assembly protein	tail	A0A1W6JNY8	Morganella_phage	92.0	7.0e-100
WP_015422650.1|2891979_2892681_-	C40 family peptidase	NA	A0A1W6JP31	Morganella_phage	95.6	1.2e-135
WP_015422649.1|2892683_2893442_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	94.0	3.8e-143
WP_015422807.1|2893438_2893774_-|tail	phage tail protein	tail	A0A1W6JP11	Morganella_phage	94.6	6.7e-60
WP_015422808.1|2893770_2897028_-|tail	phage tail tape measure protein	tail	A0A1W6JP49	Morganella_phage	98.8	0.0e+00
WP_004238683.1|2897052_2897337_-	DUF4035 domain-containing protein	NA	A0A1W6JP68	Morganella_phage	100.0	7.2e-47
WP_015422810.1|2897348_2897732_-|tail	phage tail assembly chaperone	tail	A0A1W6JP08	Morganella_phage	100.0	1.6e-65
WP_004238669.1|2897735_2898203_-	hypothetical protein	NA	A0A1W6JP06	Morganella_phage	100.0	1.0e-82
WP_004238668.1|2898262_2898598_-	hypothetical protein	NA	A0A1W6JP05	Morganella_phage	94.6	4.5e-56
WP_015422811.1|2898594_2899044_-	HK97 gp10 family phage protein	NA	A0A1W6JP15	Morganella_phage	98.7	4.5e-75
WP_004238666.1|2899036_2899363_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	83.3	2.7e-45
WP_004238665.1|2899373_2899667_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	39.8	6.2e-09
WP_004238664.1|2899708_2900920_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	62.3	3.7e-140
WP_170950667.1|2900929_2901580_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	77.3	5.6e-95
WP_004238662.1|2901569_2902790_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	74.0	5.9e-178
WP_004238661.1|2902789_2902969_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	62.5	4.4e-10
WP_015422812.1|2902978_2904709_-|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	93.1	0.0e+00
WP_015422813.1|2904712_2905183_-|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	90.4	4.5e-78
WP_036422667.1|2905329_2905683_-	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	95.7	5.3e-63
WP_004238718.1|2906660_2907038_-	hypothetical protein	NA	A0A1W6JNV2	Morganella_phage	88.8	2.4e-53
WP_015422816.1|2907174_2907651_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	95.6	8.6e-85
WP_004238694.1|2907643_2907835_-|holin	phage holin family protein	holin	A0A1W6JNY9	Morganella_phage	100.0	1.4e-30
WP_015422817.1|2908382_2909312_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	95.8	1.2e-143
WP_004242341.1|2909537_2909750_-	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	100.0	2.0e-33
WP_004238671.1|2910124_2910562_-	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	90.3	8.5e-71
WP_004238672.1|2910592_2911609_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	88.8	6.2e-181
WP_004238674.1|2911608_2912400_-	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	85.9	1.0e-122
WP_004238675.1|2912442_2912838_-	hypothetical protein	NA	A0A1W6JP58	Morganella_phage	37.2	2.1e-15
WP_015422818.1|2912837_2913722_-	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	86.4	1.0e-131
WP_004238677.1|2913718_2913913_-	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	82.8	1.5e-24
WP_144079368.1|2913905_2914106_-	hypothetical protein	NA	A0A1W6JP45	Morganella_phage	69.7	4.3e-22
WP_004238678.1|2914169_2914634_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	48.7	2.7e-35
WP_046025056.1|2914663_2914864_-	helix-turn-helix domain-containing protein	NA	A0A1W6JP24	Morganella_phage	71.2	2.4e-20
WP_015422819.1|2914961_2915621_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	55.3	6.4e-62
WP_015422820.1|2915750_2915963_+	hypothetical protein	NA	A0A1W6JP89	Morganella_phage	75.7	2.1e-22
WP_015422822.1|2916218_2916683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015422824.1|2917168_2917396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015422825.1|2917458_2917701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004235553.1|2918688_2919621_-|transposase	IS5-like element ISKpn13 family transposase	transposase	Q38213	Escherichia_phage	55.7	5.2e-94
WP_080654116.1|2919673_2919961_+|integrase	tyrosine-type recombinase/integrase	integrase	O21927	Phage_21	66.3	3.8e-27
WP_004238121.1|2920089_2921517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015422826.1|2921509_2922061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015422827.1|2922768_2923446_-	hypothetical protein	NA	NA	NA	NA	NA
2922881:2922897	attR	ACAATAAAATTAATATC	NA	NA	NA	NA
WP_004238119.1|2923773_2925027_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	8.0e-21
WP_004238117.1|2925171_2925852_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_046025126.1|2925805_2926270_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_004238115.1|2926440_2927544_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 7
NC_020418	Morganella morganii subsp. morganii KT, complete sequence	3799539	3035218	3086053	3799539	terminase,integrase,tail,capsid,portal,tRNA,head,holin,plate	Salmonella_phage(41.94%)	58	3030852:3030868	3094289:3094305
3030852:3030868	attL	AGAATATTTTTCAGCAG	NA	NA	NA	NA
WP_015422847.1|3035218_3036232_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.1	6.3e-109
WP_015422848.1|3036246_3036588_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_015422849.1|3036624_3036993_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048884242.1|3037053_3037266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004904234.1|3037840_3038188_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	38.9	5.2e-15
WP_015422853.1|3038256_3038508_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_004904230.1|3038500_3038722_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004904227.1|3038723_3039533_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	52.1	3.2e-63
WP_004904226.1|3039529_3039853_+	DUF5405 family protein	NA	NA	NA	NA	NA
WP_004904223.1|3039849_3042162_+	replication endonuclease	NA	S4TTC1	Salmonella_phage	45.8	5.7e-166
WP_004904221.1|3042262_3044857_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_004904219.1|3045482_3046502_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	70.1	9.0e-140
WP_004904218.1|3046501_3048259_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	75.6	2.1e-269
WP_004238506.1|3048412_3049252_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	45.5	6.7e-56
WP_004238505.1|3049283_3050372_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	68.2	3.2e-135
WP_004238504.1|3050371_3051097_+|terminase	terminase	terminase	F1BUQ7	Erwinia_phage	47.7	1.3e-47
WP_004238503.1|3051133_3051598_+|head	head completion/stabilization protein	head	E5FFI4	Burkholderia_phage	45.0	1.4e-23
WP_004238501.1|3051594_3051798_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	61.2	6.1e-16
WP_046025130.1|3051833_3052136_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	52.6	4.5e-23
WP_004238498.1|3052139_3052574_+	hypothetical protein	NA	A0A0D4DAE2	Escherichia_phage	47.9	2.7e-29
WP_015422856.1|3052570_3053119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004238495.1|3053096_3053534_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	44.9	1.1e-30
WP_004238494.1|3053520_3054138_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	32.2	1.3e-13
WP_004238493.1|3054207_3054846_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	56.9	3.7e-59
WP_004238492.1|3054842_3055184_+	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	54.1	1.4e-28
WP_004237255.1|3055186_3056095_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	67.5	9.6e-109
WP_015422857.1|3056087_3056696_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	67.2	8.7e-74
WP_015422858.1|3056692_3057790_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	65.3	1.4e-53
WP_048884188.1|3057771_3058173_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	47.4	3.4e-10
WP_004904035.1|3058221_3059343_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004904033.1|3059511_3060684_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	73.7	6.7e-171
WP_004904031.1|3060686_3061202_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	58.7	5.5e-53
WP_004904028.1|3061216_3061525_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	51.6	1.4e-19
WP_075206546.1|3061521_3061656_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	60.5	5.3e-08
WP_004904024.1|3061652_3064466_+|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	42.5	3.5e-109
WP_015422860.1|3064468_3064957_+|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	51.3	2.7e-41
WP_004904021.1|3064953_3066063_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	59.6	1.9e-114
WP_015422861.1|3066146_3066365_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	59.7	3.9e-16
WP_004240294.1|3066934_3067483_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_004240292.1|3067691_3069539_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_004240290.1|3069572_3070232_-	response regulator	NA	NA	NA	NA	NA
WP_004240289.1|3070449_3071070_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_004904012.1|3071216_3072545_-	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_004240287.1|3072577_3073564_-	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004240285.1|3074894_3075650_+	3-oxoacyl-ACP reductase FabG	NA	F2NZ40	Diadromus_pulchellus_ascovirus	27.4	1.5e-11
WP_004904008.1|3075687_3076977_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_004904007.1|3076973_3077873_-	EfeM/EfeO family lipoprotein	NA	NA	NA	NA	NA
WP_004240281.1|3077862_3078702_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_015422862.1|3078725_3079061_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_004240274.1|3079145_3079700_-	iron transporter	NA	NA	NA	NA	NA
WP_004904005.1|3079940_3080522_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004240271.1|3080587_3080851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004240270.1|3080843_3081362_-	YgjV family protein	NA	NA	NA	NA	NA
WP_015422863.1|3081523_3081751_-	stationary-phase-induced ribosome-associated protein	NA	NA	NA	NA	NA
WP_004904003.1|3081912_3082377_+	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	36.1	3.6e-19
WP_004240267.1|3082414_3083521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155275760.1|3084341_3084491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004240265.1|3084637_3086053_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
3094289:3094305	attR	CTGCTGAAAAATATTCT	NA	NA	NA	NA
>prophage 8
NC_020418	Morganella morganii subsp. morganii KT, complete sequence	3799539	3112196	3147994	3799539	integrase,portal,coat,lysis,holin	Salmonella_phage(35.14%)	56	3107329:3107388	3147995:3148054
3107329:3107388	attL	CTCTTTGATAAGTAATGGTGCCGGATACCGGATTCGAACTGGTGACCTTTTCATTACGAA	NA	NA	NA	NA
WP_015422867.1|3112196_3112451_+	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	65.8	6.1e-21
WP_015422868.1|3112559_3112739_+	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	81.4	2.3e-22
WP_004904197.1|3112744_3113116_-	hypothetical protein	NA	E7C9U7	Salmonella_phage	59.3	3.6e-38
WP_015422870.1|3113220_3113808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004904196.1|3113814_3116001_-	hypothetical protein	NA	A0A088CQ71	Enterobacteria_phage	47.1	2.3e-148
WP_004904193.1|3116003_3117392_-	DNA transfer protein	NA	Q716G3	Shigella_phage	45.4	1.1e-55
WP_004904191.1|3117391_3118072_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	72.0	4.9e-65
WP_015422871.1|3118065_3118527_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.0	1.7e-61
WP_004904189.1|3118526_3119270_-	hypothetical protein	NA	C6ZR14	Salmonella_phage	64.7	6.5e-39
WP_015422872.1|3119269_3120688_-	packaged DNA stabilization protein gp10	NA	I1TEJ1	Salmonella_phage	69.9	7.2e-204
WP_004904185.1|3120659_3121157_-	packaged DNA stabilization gp4 family protein	NA	Q76H19	Enterobacteria_phage	60.3	8.2e-46
WP_015422873.1|3121134_3121407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004904183.1|3121459_3122743_-|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	65.0	1.5e-163
WP_004904180.1|3122742_3123657_-	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	75.0	9.0e-115
WP_004904179.1|3123671_3125759_-|portal	portal protein	portal	G5DA97	Enterobacteria_phage	68.5	3.0e-238
WP_004904177.1|3125758_3127195_-	DNA packaging protein	NA	Q2A0C1	Sodalis_phage	75.7	6.6e-221
WP_048884193.1|3127172_3127649_-	hypothetical protein	NA	A0A2K8HN72	Pseudomonas_phage	53.6	1.7e-32
WP_004904175.1|3127702_3127927_-	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	57.5	5.9e-12
WP_004904172.1|3128127_3128334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015422876.1|3128703_3129153_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	56.7	9.1e-36
WP_004904167.1|3129149_3129542_-	M15 family metallopeptidase	NA	E7C9S9	Salmonella_phage	86.0	4.3e-58
WP_015422877.1|3129538_3129847_-|holin	phage holin family protein	holin	E7C9S8	Salmonella_phage	47.5	1.6e-20
WP_071823276.1|3130210_3130489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048884248.1|3130949_3131339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004904161.1|3131530_3131731_-	NINH	NA	NA	NA	NA	NA
WP_048884194.1|3131720_3132086_-	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	65.3	8.4e-40
WP_071823277.1|3132082_3132373_-	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	75.0	7.7e-36
WP_048884195.1|3132454_3132664_-	hypothetical protein	NA	Q5G8S1	Enterobacteria_phage	59.4	1.4e-15
WP_015422880.1|3132750_3133182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015422881.1|3133178_3133622_-	recombination protein NinB	NA	A0A1P8DTD8	Proteus_phage	83.6	8.1e-29
WP_015422883.1|3133830_3134133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015422884.1|3134129_3134483_-	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	33.3	4.8e-08
WP_004904153.1|3134482_3134677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004904152.1|3134697_3134862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112550122.1|3134894_3136259_-	replicative DNA helicase	NA	Q9MCP7	Enterobacteria_phage	65.7	2.4e-164
WP_004904150.1|3136264_3137101_-	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	56.3	1.1e-66
WP_004904149.1|3137090_3137261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015422886.1|3137287_3137614_-	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	92.6	2.1e-50
WP_015422887.1|3137733_3137925_-	hypothetical protein	NA	A0A2K8HL98	Pseudomonas_phage	50.8	9.9e-08
WP_004904144.1|3138020_3138731_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	65.3	3.3e-80
WP_015422888.1|3138780_3139701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004904140.1|3140361_3140646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015422890.1|3140712_3140889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015422891.1|3140890_3141079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015422892.1|3141352_3141541_+	hypothetical protein	NA	A0A1W6JP47	Morganella_phage	90.7	7.4e-24
WP_015422893.1|3141518_3141905_+	hypothetical protein	NA	A0A1W6JNZ6	Morganella_phage	51.9	3.9e-27
WP_015422894.1|3141933_3142167_+	DUF551 domain-containing protein	NA	A0A088F844	Salmonella_phage	53.2	5.4e-16
WP_015422895.1|3142333_3142534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004904137.1|3142530_3142740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004904136.1|3142736_3143474_+	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	69.8	1.3e-68
WP_004904133.1|3143454_3144051_+	YqaJ viral recombinase family protein	NA	A0A0S2SY31	Pseudomonas_phage	55.8	1.4e-52
WP_015422897.1|3144658_3144934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004238489.1|3145140_3145506_+	DUF2528 family protein	NA	NA	NA	NA	NA
WP_015422898.1|3145509_3145788_+	DUF2591 family protein	NA	A0A075B8G3	Enterobacteria_phage	54.3	4.5e-09
WP_004238488.1|3145856_3146396_+	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	64.7	3.2e-59
WP_004238729.1|3146830_3147994_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	70.3	4.0e-168
3147995:3148054	attR	CTCTTTGATAAGTAATGGTGCCGGATACCGGATTCGAACTGGTGACCTTTTCATTACGAA	NA	NA	NA	NA
