The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_018661	Escherichia coli O104:H4 str. 2009EL-2071, complete sequence	5312586	67273	83899	5312586	transposase,integrase	Escherichia_phage(40.0%)	16	75068:75127	80321:81141
WP_001067855.1|67273_67978_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|68038_68875_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|68874_69678_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001043265.1|69738_70554_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000240536.1|70861_71713_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|72468_73173_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|73672_74533_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
75068:75127	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|75130_75835_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000454193.1|76031_76382_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|76584_77598_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000703418.1|77755_78229_+	trimethoprim-resistant dihydrofolate reductase DfrA7	NA	A0A1B2IBQ4	Erwinia_phage	32.0	8.4e-16
WP_000679427.1|78458_78806_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259029.1|78799_79579_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_001067855.1|79612_80317_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001137316.1|80375_80930_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|80932_83899_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
80321:81141	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGCGCATTGGGTATATCAGGGTCAGCACCTTCGACCAGAACCCGGAACGGCAACTGGAAGGCGTCAAGGTTGATCGCGCTTTTAGCGACAAGGCATCCGGCAAGGATGTCAAGCGTCCGCAACTGGAAGCGCTGATAAGCTTCGCCCGCACCGGCGACACCGTGGTGGTGCATAGCATGGATCGCCTGGCGCGCAATCTCGATGATTTGCGCCGGATCGTGCAAACGCTGACACAACGCGGCGTGCATATCGAATTCGTCAAGGAACACCTCAGTTTTACTGGCGAAGACTCTCCGATGGCGAACCTGATGCTCTCGGTGATGGGCGCGTTCGCCGAGTTCGAGCGCGCCCTGATCCGCGAGCGTCAGCGCGAGGGTATTGCGCTCGCCAAGCAACGCGGGGCTTACCGTGGCAGGAAGAAATCCCTGTCGTCTGAGCGTATTGCCGAACTGCGCCAACGTGTCGAGGCTGGCGAGCAAAAGACCAAGCTTGCTCGTGAATTCGGAATCAGTCGCGAAACCCTGTATCAATACTTGAGAACGGATCAGTAAATATGCCACGTCGTTCCATCCTGTCCGCCGCCGAGCGGGAAAGCCTGCTGGCGTTGCCGGACTCCAAGGACGACCTGATCCGACATTACACATTCAACGATACCGACCTCTCGATCATCCGACAGCGGCGCGGGCCAGCCAATCGGCTGGGCTTCGCGGTGCAGCTCTGTTACCTGCGCTTTCCCGGCGTCATCCTGGGCGTCGATGAACT	NA	NA	NA	NA
>prophage 2
NC_018661	Escherichia coli O104:H4 str. 2009EL-2071, complete sequence	5312586	884208	916942	5312586	transposase,plate,protease	Escherichia_phage(25.0%)	19	NA	NA
WP_001390300.1|884208_886011_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001173975.1|886001_886934_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000198270.1|886946_888929_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	35.6	2.2e-12
WP_000005080.1|888939_889407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001390299.1|889416_889716_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_001033155.1|889719_890796_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000152746.1|890803_891355_+	type VI secretion lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001154665.1|891373_892786_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001028113.1|893124_893715_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000914956.1|893720_897125_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_000029846.1|897128_899678_+	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	33.8	4.6e-92
WP_000587872.1|902843_903410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000359994.1|903888_905043_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_077577697.1|907532_907895_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	62.5	6.4e-40
WP_000019440.1|908262_909243_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_000080172.1|909426_911040_-|transposase	IS66-like element ISEc43 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
WP_000624736.1|911070_911421_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	3.6e-40
WP_001309734.1|911417_911852_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_001045650.1|912823_916942_-|protease	serine protease autotransporter toxin Pic	protease	Q9LA54	Enterobacteria_phage	45.8	0.0e+00
>prophage 3
NC_018661	Escherichia coli O104:H4 str. 2009EL-2071, complete sequence	5312586	1198528	1205668	5312586		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1198528_1199167_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1199163_1200426_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1200422_1201331_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1201526_1202294_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141316.1|1202344_1203001_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.8	1.5e-50
WP_001272924.1|1203106_1205668_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 4
NC_018661	Escherichia coli O104:H4 str. 2009EL-2071, complete sequence	5312586	1567471	1599429	5312586	terminase,portal,protease,integrase,head	Enterobacteria_phage(47.06%)	38	1565003:1565019	1602683:1602699
1565003:1565019	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000194515.1|1567471_1568905_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
WP_001274887.1|1569120_1570035_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001197025.1|1570106_1571354_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001163428.1|1571883_1572084_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001277767.1|1572215_1572395_-	Eag protein	NA	K7PL40	Enterobacteria_phage	100.0	2.5e-29
WP_000208008.1|1572491_1573121_-	DUF550 domain-containing protein	NA	K7P7E3	Enterobacteria_phage	58.6	1.1e-55
WP_000951713.1|1573117_1573327_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	91.2	1.3e-32
WP_000034245.1|1573689_1574361_-	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	73.2	3.0e-83
WP_001214454.1|1574357_1574525_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	8.6e-24
WP_032159494.1|1574521_1574803_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	98.9	9.7e-44
WP_001111297.1|1574822_1575119_-	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	98.0	1.9e-50
WP_000951329.1|1575142_1575526_-	hypothetical protein	NA	K7P7R8	Enterobacteria_phage	97.6	1.2e-65
WP_000031367.1|1575525_1576131_-	ERF family protein	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
WP_000050554.1|1576141_1576312_-	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_001243355.1|1576387_1576540_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000638547.1|1576524_1576656_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_000807788.1|1577702_1577945_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000113732.1|1577947_1578388_+	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	99.3	1.7e-79
WP_000200769.1|1578384_1579797_+|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.8	9.8e-278
WP_000852331.1|1579799_1581926_+|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.2	0.0e+00
WP_000426730.1|1581939_1582824_+	hypothetical protein	NA	Q716H1	Shigella_phage	99.0	2.0e-143
WP_001133485.1|1582835_1584107_+|head	head protein	head	Q9AYZ7	Salmonella_phage	99.5	1.2e-239
WP_000375637.1|1584149_1584335_+	hypothetical protein	NA	Q716G9	Shigella_phage	100.0	2.7e-26
WP_000246749.1|1584309_1584792_+	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	99.4	8.4e-88
WP_001122379.1|1584800_1586219_+	packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	98.9	3.9e-274
WP_000785547.1|1586218_1587067_+	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	97.5	3.4e-100
WP_000614045.1|1587066_1587522_+	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.7	5.7e-86
WP_000964882.1|1587524_1588217_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_000246924.1|1588226_1589693_+	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	62.0	8.4e-139
WP_001387755.1|1589692_1591537_+	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	73.8	4.0e-247
WP_000749286.1|1591551_1592037_-	lipoprotein	NA	NA	NA	NA	NA
WP_000820795.1|1592062_1592377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283829.1|1592373_1592625_-	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	93.9	1.5e-35
WP_000865490.1|1592730_1592871_+	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	56.8	7.5e-05
WP_000835342.1|1593103_1593982_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	78.1	5.8e-95
WP_000129924.1|1594082_1596062_+|head	phage head-binding domain-containing protein	head	A5VW57	Enterobacteria_phage	93.5	6.2e-60
WP_000178979.1|1596132_1598043_-	acyltransferase	NA	C6ZR20	Salmonella_phage	32.6	4.7e-57
WP_000958672.1|1598271_1599429_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.3e-221
1602683:1602699	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 5
NC_018661	Escherichia coli O104:H4 str. 2009EL-2071, complete sequence	5312586	1833231	1842673	5312586		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569326.1|1833231_1834158_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1834162_1834894_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1834874_1834982_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1835041_1835773_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1835994_1837680_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1837676_1838396_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1838442_1838913_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1838953_1839415_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001351453.1|1839539_1841540_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001292767.1|1841536_1842673_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
>prophage 6
NC_018661	Escherichia coli O104:H4 str. 2009EL-2071, complete sequence	5312586	2134029	2235029	5312586	transposase,terminase,portal,protease,capsid,lysis,holin,tRNA,head,tail	Enterobacteria_phage(44.12%)	111	NA	NA
WP_001025327.1|2134029_2135763_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_001326063.1|2135978_2136545_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185740.1|2136558_2137305_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214304.1|2137692_2138793_+	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_000176815.1|2138817_2141247_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000399648.1|2141516_2142497_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000564745.1|2142690_2143662_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|2143658_2144402_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252979.1|2144442_2144838_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_044713004.1|2144890_2145661_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000362003.1|2145642_2146953_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	95.4	3.0e-244
WP_000528718.1|2147008_2147245_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_001030156.1|2147253_2147400_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	1.6e-21
WP_000457723.1|2147403_2147646_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_000628772.1|2147730_2148489_-	phage protein	NA	A0A1U9AJ59	Stx1_converting_phage	82.0	2.7e-109
WP_000065512.1|2149002_2149551_-	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	97.5	1.4e-59
WP_000476207.1|2149547_2149787_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	9.1e-35
WP_000111289.1|2149779_2149983_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_001242713.1|2149979_2150342_-	phage protein	NA	K7PH61	Enterobacteria_phage	97.5	6.8e-66
WP_000008178.1|2150332_2150869_-	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
WP_000081306.1|2150996_2151821_-	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	98.9	1.1e-148
WP_000179185.1|2151886_2152249_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	94.2	7.5e-57
WP_001387485.1|2152951_2153644_-	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	96.1	6.4e-121
WP_001191669.1|2153741_2154002_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_000526669.1|2153994_2154552_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	94.1	5.3e-94
WP_001087340.1|2154548_2155694_+	Rha family phage regulatory protein	NA	A5LH69	Enterobacteria_phage	83.5	3.1e-173
WP_000620687.1|2155690_2155915_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	95.9	2.4e-37
WP_000061508.1|2155911_2156730_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.1	2.8e-123
WP_001387484.1|2156726_2157221_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.3	1.5e-84
WP_000066917.1|2157220_2157874_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210143.1|2157870_2158197_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	2.7e-53
WP_000767110.1|2158193_2158589_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_001072669.1|2158751_2159567_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_001358491.1|2159574_2160564_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
WP_001205470.1|2160581_2160938_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	92.0	2.3e-58
WP_000150292.1|2160917_2162132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000355468.1|2162134_2163310_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000917745.1|2163576_2163774_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	95.4	3.4e-27
WP_000301785.1|2163908_2164622_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874454.1|2165388_2167350_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.2	3.9e-240
WP_000142785.1|2167485_2167680_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	9.4e-22
WP_001289722.1|2167705_2167975_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	74.2	8.2e-08
WP_000284510.1|2168050_2168266_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000731267.1|2168270_2168615_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.4	7.2e-57
WP_001092883.1|2168665_2169199_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_001082546.1|2169497_2169965_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	99.4	3.4e-78
WP_000347013.1|2170315_2170456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015674556.1|2170588_2170774_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	81.4	4.1e-19
WP_000867568.1|2171175_2171724_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001390579.1|2171695_2173624_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.6	7.4e-260
WP_000259002.1|2173607_2173814_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001392493.1|2173810_2175403_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	1.9e-184
WP_001253917.1|2175392_2176898_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	2.7e-100
WP_000256796.1|2176934_2177282_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_000522644.1|2177339_2178368_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.7	7.3e-113
WP_001390684.1|2178420_2178789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204567.1|2178781_2179135_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000975015.1|2179150_2179729_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	90.6	4.9e-74
WP_000683112.1|2179725_2180121_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.2e-70
WP_001401350.1|2180128_2180869_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	5.0e-132
WP_000479153.1|2180884_2181307_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459468.1|2181288_2181723_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.7e-63
WP_000847379.1|2184274_2184604_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152493.1|2184603_2185302_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.8e-132
WP_000194780.1|2185306_2186050_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|2185986_2186619_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000515636.1|2186679_2190159_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_001228357.1|2190226_2190826_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_000216489.1|2190977_2194148_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	59.1	1.3e-83
WP_000885566.1|2194147_2194732_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	4.3e-102
WP_001217553.1|2194847_2195096_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000891610.1|2195450_2196017_-	hydrolase	NA	NA	NA	NA	NA
WP_001258662.1|2196326_2198099_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077221229.1|2198091_2198544_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907234.1|2198572_2199313_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|2199347_2199869_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024930.1|2199870_2200473_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001386853.1|2200543_2200609_+	stress response small protein YobI	NA	NA	NA	NA	NA
WP_000580323.1|2200747_2201359_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|2201367_2202378_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571465.1|2202524_2203310_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|2203306_2204062_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001342995.1|2204140_2205073_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|2205088_2206411_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_000448381.1|2206530_2207502_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000091176.1|2207632_2209075_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_001056706.1|2209202_2210072_-	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000301720.1|2210409_2211885_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
WP_001069467.1|2212119_2213931_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000800512.1|2213967_2214609_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000173474.1|2214664_2215843_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000257738.1|2215976_2216267_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_001295500.1|2216333_2216690_+	protein YebF	NA	NA	NA	NA	NA
WP_000024745.1|2217016_2217676_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000936951.1|2217884_2219945_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_000944256.1|2219941_2220604_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011658.1|2220627_2221284_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|2221385_2221616_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204699.1|2221754_2222129_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879280.1|2222132_2223005_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976472.1|2223017_2223359_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812712.1|2223754_2224411_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	3.6e-57
WP_001296140.1|2224411_2224603_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|2224707_2224944_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000057022.1|2225061_2226501_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001297532.1|2226580_2229214_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207283.1|2229182_2230466_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|2230595_2231093_+	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_000431370.1|2231189_2231888_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001315679.1|2231907_2233956_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000984517.1|2234147_2235029_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 7
NC_018661	Escherichia coli O104:H4 str. 2009EL-2071, complete sequence	5312586	2304405	2393509	5312586	transposase,terminase,portal,plate,capsid,integrase,holin,tRNA,head,tail	Enterobacteria_phage(73.08%)	103	2297645:2297661	2392701:2392717
2297645:2297661	attL	TCTTCCGGCGTCATATC	NA	NA	NA	NA
WP_000019440.1|2304405_2305386_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_000373043.1|2306188_2307532_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000085233.1|2307767_2308040_+	YnjH family protein	NA	NA	NA	NA	NA
WP_000781892.1|2308005_2308413_-	CTP pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_001307237.1|2308499_2309120_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_001351355.1|2309128_2310436_-	thiosulfate sulfurtransferase YnjE	NA	NA	NA	NA	NA
WP_000882826.1|2310502_2311156_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.0	9.9e-15
WP_000258524.1|2311155_2312691_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001215298.1|2312663_2313830_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000524080.1|2313839_2314388_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_000977124.1|2314387_2315095_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_000077942.1|2315108_2315786_-	protein YdjY	NA	NA	NA	NA	NA
WP_001351354.1|2315790_2316501_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_000673924.1|2316667_2317474_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_000082041.1|2317919_2319140_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	1.5e-27
WP_000989416.1|2319136_2320171_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_000177212.1|2320167_2321646_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000995007.1|2321642_2322986_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_000368485.1|2322978_2323947_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_001228991.1|2324276_2324762_+	ATP-independent periplasmic protein-refolding chaperone	NA	NA	NA	NA	NA
WP_001351353.1|2324964_2325540_+	environmental stress-induced protein Ves	NA	NA	NA	NA	NA
WP_000252388.1|2325499_2326387_-	excinuclease Cho	NA	NA	NA	NA	NA
WP_000175037.1|2326616_2327444_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
WP_001039044.1|2327645_2327984_+	osmotically-inducible lipoprotein OsmE	NA	NA	NA	NA	NA
WP_000412169.1|2328282_2328603_+	PTS N,N'-diacetylchitobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_000073041.1|2328687_2330046_+	PTS N,N'-diacetylchitobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000968911.1|2330096_2330447_+	PTS N,N'-diacetylchitobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000983653.1|2330454_2331297_+	transcriptional regulator ChbR	NA	NA	NA	NA	NA
WP_000078722.1|2331401_2332754_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_000440450.1|2332766_2333525_+	chitin disaccharide deacetylase	NA	NA	NA	NA	NA
WP_000077825.1|2333571_2335833_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	2.3e-143
WP_001241561.1|2336015_2336279_+	cell division activator CedA	NA	NA	NA	NA	NA
WP_001326040.1|2336555_2336924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000183004.1|2336933_2337371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001010722.1|2337374_2338766_-	cystine/sulfocysteine:cation symporter	NA	NA	NA	NA	NA
WP_001295408.1|2338898_2339489_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000106834.1|2339651_2340320_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_000222172.1|2340466_2341003_+	YniB family protein	NA	NA	NA	NA	NA
WP_000267645.1|2341043_2341904_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_000146159.1|2342009_2342300_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000251735.1|2342400_2343330_-	6-phosphofructokinase II	NA	NA	NA	NA	NA
WP_000771396.1|2343616_2344375_+	YdiY family protein	NA	NA	NA	NA	NA
WP_001142445.1|2344427_2344535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144190.1|2347132_2349061_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	5.5e-130
WP_001700733.1|2349064_2349607_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|2349703_2349901_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|2349953_2350310_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|2350432_2350477_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018588.1|2350759_2351743_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_000672359.1|2351757_2354145_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|2354149_2354449_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000078916.1|2354750_2354891_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488099.1|2355081_2355342_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000965749.1|2355661_2356744_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000132828.1|2356835_2357945_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.8	3.7e-195
WP_000005414.1|2358102_2359287_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	3.8e-222
WP_000290443.1|2359286_2359799_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.8	2.7e-92
WP_000665305.1|2359853_2360219_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.4e-55
WP_000333498.1|2360227_2360383_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	3.3e-22
WP_001390260.1|2360369_2363177_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.5	0.0e+00
WP_000979946.1|2363189_2363678_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_000954195.1|2363834_2364407_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144016.1|2364450_2365029_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	7.7e-96
WP_000108557.1|2365028_2367161_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.4	1.2e-130
WP_000071739.1|2367163_2367694_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_001111965.1|2367686_2368583_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	5.7e-154
WP_001067548.1|2368586_2368916_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001342219.1|2368933_2369500_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.3	2.5e-99
WP_000356370.1|2369511_2370147_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	5.3e-114
WP_000921128.1|2370139_2370607_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	96.1	2.1e-83
WP_000202135.1|2370630_2372511_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	81.0	3.8e-301
WP_000780558.1|2372649_2373057_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	1.2e-63
WP_000072317.1|2373053_2373446_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	6.4e-70
WP_000104350.1|2373442_2373766_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864897.1|2373768_2373969_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000063103.1|2373968_2374463_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000632318.1|2374564_2375365_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_001055094.1|2375410_2376463_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
WP_001262665.1|2376486_2377323_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	1.8e-149
WP_000613796.1|2377477_2379229_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
WP_000087812.1|2379228_2380275_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000224219.1|2380786_2381050_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	1.1e-30
WP_000201251.1|2381051_2381483_-	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	43.3	4.7e-21
WP_000211292.1|2381502_2381817_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	51.9	3.5e-18
WP_000686540.1|2381821_2382781_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	1.3e-180
WP_001272076.1|2382857_2385698_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	89.4	0.0e+00
WP_000564228.1|2385694_2386084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157847544.1|2386080_2386698_-	ash family protein	NA	S5MQL6	Escherichia_phage	49.4	1.5e-09
WP_000104300.1|2386709_2387009_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	6.2e-41
WP_000153687.1|2387005_2387251_-	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	87.7	8.4e-36
WP_000985715.1|2387247_2387451_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	94.0	3.4e-30
WP_001038613.1|2387440_2387761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021658.1|2387849_2387963_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.4e-09
WP_000514277.1|2387959_2388202_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159452.1|2388213_2388501_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.9	2.7e-33
WP_000917807.1|2388511_2388850_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	85.3	2.2e-50
WP_000163908.1|2388864_2389143_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000094527.1|2389234_2389546_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	55.9	8.8e-22
WP_001247218.1|2389634_2390570_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.5	4.8e-79
WP_000416308.1|2390580_2390976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956518.1|2391165_2392146_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154183.1|2392208_2392760_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
2392701:2392717	attR	GATATGACGCCGGAAGA	NA	NA	NA	NA
WP_000029466.1|2392759_2393509_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
>prophage 8
NC_018661	Escherichia coli O104:H4 str. 2009EL-2071, complete sequence	5312586	2513253	2587886	5312586	terminase,portal,protease,capsid,lysis,integrase,holin,tail	Shigella_phage(43.48%)	85	2517357:2517374	2545407:2545424
WP_001260841.1|2513253_2514075_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2514174_2514258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|2514350_2514686_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091806.1|2515082_2516336_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019532.1|2516442_2517336_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
2517357:2517374	attL	CCCGAAAAATGTGCTGTT	NA	NA	NA	NA
WP_000225276.1|2517470_2518691_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2518815_2519511_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071820512.1|2519526_2520756_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2520914_2521529_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|2521571_2522426_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_001387389.1|2523019_2524183_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	99.7	3.8e-227
WP_000497813.1|2524444_2524696_-	DUF4222 domain-containing protein	NA	A0A088CBN9	Shigella_phage	100.0	1.3e-39
WP_000186868.1|2524743_2525424_-	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	98.2	1.5e-130
WP_000100829.1|2525420_2526206_-	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	97.3	9.4e-145
WP_000995032.1|2526211_2526508_-	host-nuclease inhibitor protein Gam	NA	V5URU8	Shigella_phage	93.9	5.8e-47
WP_001271588.1|2526504_2528577_-	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	87.4	0.0e+00
WP_000660961.1|2528684_2529071_-	hypothetical protein	NA	V5USC5	Shigella_phage	78.9	9.5e-50
WP_000560214.1|2529154_2529376_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	94.4	1.1e-34
WP_000189936.1|2529832_2530042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005963.1|2530010_2530370_-	hypothetical protein	NA	A0A088CBI5	Shigella_phage	72.6	2.3e-37
WP_000211196.1|2530401_2531115_-	hypothetical protein	NA	A0A088CC14	Shigella_phage	98.7	1.8e-126
WP_000198438.1|2531118_2531502_-	antitermination protein	NA	G9L671	Escherichia_phage	99.2	6.7e-64
WP_000528776.1|2531996_2532773_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001074607.1|2532760_2533303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001274758.1|2533349_2534063_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.6	4.1e-131
WP_000437871.1|2534163_2534364_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	97.0	1.3e-29
WP_000438525.1|2534502_2534799_+	hypothetical protein	NA	A0A088CBI6	Shigella_phage	98.0	3.4e-47
WP_000438870.1|2534813_2535032_+	hypothetical protein	NA	A0A088CC17	Shigella_phage	100.0	1.1e-21
WP_001390256.1|2535052_2536135_+	hypothetical protein	NA	V5URT9	Shigella_phage	96.4	2.8e-200
WP_000790392.1|2536141_2536882_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	87.4	2.3e-121
WP_000450864.1|2536907_2537678_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	82.4	8.1e-109
WP_001118163.1|2537693_2538089_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	52.9	2.0e-31
WP_000206792.1|2538145_2538730_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
WP_001278450.1|2538845_2538950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887482.1|2539138_2539351_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	62.9	8.4e-16
WP_000119356.1|2539560_2539740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818160.1|2539758_2540244_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000042397.1|2540294_2540612_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000211990.1|2541318_2541990_+	ORF6N domain-containing protein	NA	A0A088CD42	Shigella_phage	82.6	9.0e-96
WP_001076834.1|2542044_2542455_+	recombination protein NinB	NA	A0A088CBP6	Shigella_phage	98.5	3.9e-70
WP_001254268.1|2542451_2542643_+	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	87.7	8.9e-25
WP_000002252.1|2542666_2542957_+	DUF1364 domain-containing protein	NA	A0A088CE53	Shigella_phage	96.9	9.3e-50
WP_001008115.1|2542953_2543316_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A088CBJ1	Shigella_phage	98.3	9.2e-63
WP_000992060.1|2543315_2543510_+	protein ninH	NA	A0A088CC23	Shigella_phage	100.0	1.4e-30
WP_001204886.1|2543502_2543937_+	antitermination protein	NA	G9L695	Escherichia_phage	98.6	2.4e-81
WP_000874468.1|2544702_2546613_+	SASA family carbohydrate esterase	NA	A0A0N7CGH9	Escherichia_phage	74.8	6.4e-280
2545407:2545424	attR	CCCGAAAAATGTGCTGTT	NA	NA	NA	NA
WP_000142783.1|2546751_2546934_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	91.7	1.6e-23
WP_001290236.1|2546959_2547205_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	87.7	1.1e-14
WP_000284506.1|2547281_2547497_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087450.1|2547501_2548035_+	lysozyme	NA	A0A088CC28	Shigella_phage	91.5	5.6e-93
WP_000675931.1|2548255_2548369_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001082713.1|2548370_2548829_+|lysis	lysis protein	lysis	A0A2L1IV55	Escherichia_phage	99.3	6.4e-77
WP_000934362.1|2548909_2549491_-	lipopolysaccharide core heptose(II)-phosphate phosphatase	NA	A0A2L1IV13	Escherichia_phage	100.0	6.7e-47
WP_001086085.1|2550093_2550909_+|terminase	terminase	terminase	A0A2L1IV66	Escherichia_phage	99.6	6.6e-125
WP_001387707.1|2550889_2552596_+|terminase	terminase	terminase	A0A2L1IV76	Escherichia_phage	99.1	0.0e+00
WP_000787512.1|2552595_2554740_+|portal	portal protein	portal	A0A088CE71	Shigella_phage	99.6	0.0e+00
WP_000344999.1|2554897_2555905_+	hypothetical protein	NA	A0A2L1IV47	Escherichia_phage	93.4	1.2e-168
WP_000214480.1|2555927_2557142_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2L1IV46	Escherichia_phage	99.0	1.8e-232
WP_001140435.1|2557196_2557586_+	hypothetical protein	NA	V5UT93	Shigella_phage	97.7	1.9e-61
WP_001290749.1|2557636_2558098_+	hypothetical protein	NA	A0A2L1IV43	Escherichia_phage	99.3	6.9e-71
WP_000829400.1|2558081_2558645_+	hypothetical protein	NA	A0A2L1IV64	Escherichia_phage	99.5	8.3e-103
WP_000207910.1|2558644_2559295_+	hypothetical protein	NA	A0A2L1IV63	Escherichia_phage	99.1	1.5e-119
WP_000117962.1|2559291_2561199_+|tail	tail fiber protein	tail	V5USF3	Shigella_phage	66.0	4.2e-82
WP_000537686.1|2561281_2561827_+	hypothetical protein	NA	A0A088CD67	Shigella_phage	99.4	2.0e-93
WP_000276176.1|2561839_2562067_+	hypothetical protein	NA	A0A088CBQ7	Shigella_phage	98.7	2.6e-39
WP_001146337.1|2562407_2564033_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	96.7	0.0e+00
WP_000038927.1|2564029_2565298_+	host specificity protein J	NA	A0A0N7C124	Escherichia_phage	94.3	1.6e-218
WP_000455633.1|2565312_2565591_+	outer membrane protein	NA	A0A2L1IV69	Escherichia_phage	100.0	2.6e-49
WP_001390575.1|2565596_2566214_+	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	98.0	6.3e-120
WP_000836186.1|2566293_2567031_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	80.8	1.2e-109
WP_000078908.1|2567265_2567406_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	97.8	2.0e-18
WP_001387532.1|2567462_2567864_+	hypothetical protein	NA	Q08J75	Stx2-converting_phage	98.5	5.0e-70
WP_000509022.1|2567955_2568612_+	hypothetical protein	NA	A0A0H4IPM7	Shigella_phage	99.1	7.4e-103
WP_000455643.1|2568614_2569061_+	hypothetical protein	NA	A0A2L1IV89	Escherichia_phage	100.0	4.0e-76
WP_000540395.1|2569070_2569322_+	hypothetical protein	NA	A0A0P0ZDW9	Stx2-converting_phage	97.5	7.9e-13
WP_000012439.1|2569332_2570598_+	hypothetical protein	NA	A0A2L1IV65	Escherichia_phage	95.0	1.5e-192
WP_000331660.1|2570666_2579018_+	hypothetical protein	NA	Q08J70	Stx2-converting_phage	95.8	0.0e+00
WP_000481378.1|2579141_2579417_+	hypothetical protein	NA	A0A088CD78	Shigella_phage	89.3	4.0e-18
WP_000628768.1|2579418_2579922_-	DUF551 domain-containing protein	NA	V5UT79	Shigella_phage	98.2	2.6e-95
WP_001290012.1|2580435_2581272_-	ead/Ea22-like family protein	NA	A0A2I6TD51	Escherichia_phage	87.7	6.1e-126
WP_000020909.1|2581258_2581543_-	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	98.9	6.1e-46
WP_000763355.1|2581539_2581761_-	TraR/DksA family transcriptional regulator	NA	V5USD3	Shigella_phage	98.6	2.9e-35
WP_000184488.1|2581808_2582444_-	phage antirepressor Ant	NA	A0A088CBR4	Shigella_phage	81.0	2.8e-91
WP_001342404.1|2582975_2585399_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	9.8e-209
WP_000041536.1|2585459_2587886_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.3e-213
>prophage 9
NC_018661	Escherichia coli O104:H4 str. 2009EL-2071, complete sequence	5312586	2876933	2938742	5312586	portal,terminase,protease,capsid,integrase,holin,head,tail	Enterobacteria_phage(42.31%)	74	2921974:2921988	2942913:2942927
WP_000422045.1|2876933_2877983_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559283.1|2878202_2878961_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
WP_001278904.1|2878957_2879548_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2879587_2880460_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|2880560_2881181_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|2881177_2882059_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001386774.1|2882196_2882241_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194599.1|2882332_2883895_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|2883894_2885490_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_000983912.1|2885490_2886852_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000209520.1|2886863_2888057_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443069.1|2888056_2888863_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2889243_2889423_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2889508_2890009_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|2890054_2890561_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000251936.1|2891049_2891220_-	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_000926528.1|2891334_2891604_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	77.8	2.7e-19
WP_000240999.1|2891660_2892329_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885576.1|2892383_2892968_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	1.7e-103
WP_000216488.1|2892967_2896138_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	58.8	5.4e-82
WP_001228317.1|2896289_2896889_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.0	5.9e-107
WP_000515777.1|2896956_2900436_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001332187.1|2900502_2900841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000090879.1|2900914_2901517_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_000140761.1|2901453_2902197_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	1.8e-145
WP_001152522.1|2902201_2902900_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000847379.1|2902899_2903229_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000082359.1|2903225_2905799_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.9	0.0e+00
WP_000533402.1|2905779_2906193_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479095.1|2906219_2906651_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000235040.1|2906664_2907417_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	6.7e-132
WP_000683079.1|2907424_2907820_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974999.1|2907816_2908392_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.3	9.2e-49
WP_001204198.1|2908406_2908760_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	3.0e-42
WP_000201506.1|2908752_2909121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522596.1|2909172_2910201_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.4	2.8e-112
WP_000256823.1|2910258_2910606_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253926.1|2910642_2912148_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	52.8	3.0e-99
WP_000831759.1|2912137_2913733_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.6	9.3e-184
WP_000259002.1|2913729_2913936_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001390573.1|2913919_2915848_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	1.6e-262
WP_000867569.1|2915819_2916368_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000240372.1|2916768_2917173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343118.1|2917626_2917914_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	58.9	4.0e-29
WP_001390467.1|2917992_2918145_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	98.0	2.8e-21
WP_001228710.1|2918173_2918380_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	95.6	2.9e-29
WP_032159578.1|2918601_2918688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092853.1|2919242_2919776_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	8.7e-102
WP_000731197.1|2919818_2920625_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	94.8	3.3e-145
WP_000284510.1|2920629_2920845_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000874307.1|2920995_2922849_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.5	0.0e+00
2921974:2921988	attL	ACCGTGTTCTTGTTT	NA	NA	NA	NA
WP_000871291.1|2923109_2923445_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_001438304.1|2923725_2923857_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	1.1e-05
WP_000935536.1|2924655_2925705_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	8.8e-199
WP_000917746.1|2925855_2926053_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	96.9	1.4e-28
WP_000762880.1|2926279_2927101_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000904106.1|2927097_2927472_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.8e-36
WP_001265083.1|2927484_2928531_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	5.9e-110
WP_001329966.1|2928532_2928805_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_000018429.1|2928972_2929185_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_000150294.1|2929365_2930031_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151211.1|2930205_2930631_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	1.3e-63
WP_000095671.1|2930671_2931634_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693888.1|2931656_2932082_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|2932078_2932333_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|2932412_2932832_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_000379548.1|2933128_2933281_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_000394541.1|2933292_2933631_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
WP_001295058.1|2933619_2933814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2934380_2934569_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2934565_2934757_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048530.1|2934849_2937321_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.2	1.8e-56
WP_000113189.1|2937385_2937634_+	excisionase	NA	NA	NA	NA	NA
WP_000113686.1|2937611_2938742_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	4.4e-103
2942913:2942927	attR	ACCGTGTTCTTGTTT	NA	NA	NA	NA
>prophage 10
NC_018661	Escherichia coli O104:H4 str. 2009EL-2071, complete sequence	5312586	3042760	3101448	5312586	portal,terminase,capsid,lysis,integrase,holin,tRNA,head,tail	Enterobacteria_phage(42.31%)	69	3051051:3051065	3101550:3101564
WP_001297484.1|3042760_3043867_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|3043902_3044544_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3044547_3045918_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|3046085_3046757_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|3046756_3048217_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001295435.1|3048292_3049414_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359463.1|3049559_3050789_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3051038_3052175_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
3051051:3051065	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|3052158_3053022_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000885609.1|3053253_3053835_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	3.8e-103
WP_000279201.1|3053834_3056627_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	5.2e-12
WP_001233150.1|3056691_3057291_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	98.0	9.7e-110
WP_000515046.1|3057358_3060832_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	95.9	0.0e+00
WP_123001620.1|3061072_3061705_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.8	1.4e-103
WP_000194711.1|3061650_3062394_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	7.7e-149
WP_001335877.1|3062404_3063103_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_000847306.1|3063102_3063432_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_000081807.1|3063428_3066041_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	90.3	0.0e+00
WP_000533440.1|3066021_3066435_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479049.1|3066461_3066884_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	3.7e-71
WP_000235035.1|3066897_3067650_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	6.0e-133
WP_000683079.1|3067657_3068053_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000975003.1|3068049_3068625_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	3.7e-50
WP_001204567.1|3068640_3068994_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_001390684.1|3068986_3069355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522645.1|3069407_3070436_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	1.1e-113
WP_000256796.1|3070493_3070841_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_001254006.1|3070877_3072383_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.2e-100
WP_000831738.1|3072372_3073965_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	4.2e-184
WP_000259002.1|3073961_3074168_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_014966208.1|3074151_3076080_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	4.6e-262
WP_000235436.1|3076051_3076561_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001329960.1|3076962_3077148_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000347013.1|3077280_3077421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082546.1|3077771_3078239_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	99.4	3.4e-78
WP_001092864.1|3078537_3079071_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	3.3e-101
WP_000731195.1|3079113_3079920_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	95.1	2.5e-145
WP_000284510.1|3079924_3080140_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000874341.1|3080290_3082144_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	91.1	0.0e+00
WP_000935531.1|3082933_3083983_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	96.5	6.1e-200
WP_000917749.1|3084133_3084331_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_000762898.1|3084557_3085379_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.8	1.3e-80
WP_000904113.1|3085375_3085750_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_001265094.1|3085762_3086812_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	5.9e-110
WP_001341382.1|3086813_3087092_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_000813254.1|3087259_3087415_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000753058.1|3088336_3088513_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	4.3e-26
WP_001224662.1|3088505_3088688_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000403778.1|3088781_3089138_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
WP_000207966.1|3089115_3089259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224227.1|3089269_3089533_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_001289900.1|3090454_3091204_-	ead/Ea22-like family protein	NA	Q1MVF9	Enterobacteria_phage	89.1	1.8e-108
WP_000034251.1|3091200_3091887_-	ead/Ea22-like family protein	NA	A5VWB1	Enterobacteria_phage	68.2	1.3e-38
WP_001275731.1|3091873_3092368_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	76.8	1.9e-66
WP_000416574.1|3092364_3092787_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	76.1	1.6e-53
WP_000095671.1|3092827_3093790_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693845.1|3093812_3094238_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048458.1|3094221_3094497_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000824162.1|3094604_3095105_+	helix-turn-helix transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	54.5	1.4e-16
WP_000100896.1|3095122_3095314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014966210.1|3095313_3095604_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379548.1|3095873_3096026_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_000394541.1|3096037_3096376_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
WP_001295058.1|3096364_3096559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|3097125_3097314_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|3097310_3097499_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102130.1|3097591_3100030_+	exonuclease	NA	A0A088CD28	Shigella_phage	45.0	2.9e-112
WP_000003742.1|3100091_3100361_+	excisionase	NA	NA	NA	NA	NA
WP_000074983.1|3100329_3101448_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.2	7.7e-84
3101550:3101564	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 11
NC_018661	Escherichia coli O104:H4 str. 2009EL-2071, complete sequence	5312586	3190346	3195392	5312586	transposase	Stx2-converting_phage(33.33%)	7	NA	NA
WP_000692357.1|3190346_3190568_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186756.1|3190630_3191107_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855050.1|3191122_3191596_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.2	1.9e-12
WP_001241711.1|3191896_3192718_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.1	4.0e-45
WP_000080172.1|3192965_3194579_-|transposase	IS66-like element ISEc43 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
WP_000624688.1|3194610_3194961_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_001309734.1|3194957_3195392_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
>prophage 12
NC_018661	Escherichia coli O104:H4 str. 2009EL-2071, complete sequence	5312586	3275063	3366604	5312586	transposase,portal,terminase,capsid,bacteriocin,integrase,lysis,holin,tail	Escherichia_phage(85.71%)	96	3273602:3273617	3327242:3327257
3273602:3273617	attL	AAAACCTCTGCCTGCG	NA	NA	NA	NA
WP_000279857.1|3275063_3276281_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.7	6.5e-44
WP_000611858.1|3276828_3277815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000627404.1|3277811_3278303_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_085948466.1|3278405_3279567_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000409841.1|3279608_3280967_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.1e-20
WP_000287459.1|3281553_3283977_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_000945561.1|3283985_3286004_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_000610451.1|3285996_3287322_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_001061095.1|3287323_3287737_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_000533522.1|3287786_3288575_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	7.8e-91
WP_001199172.1|3289193_3290465_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000154414.1|3290470_3291598_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000497942.1|3291655_3292486_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_001018486.1|3293027_3294536_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000979516.1|3294694_3294904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299828.1|3294958_3298921_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000191700.1|3298960_3299599_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001297176.1|3299886_3300978_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_001307708.1|3300977_3301670_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001126777.1|3301681_3302068_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001307099.1|3302075_3302876_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001001196.1|3302885_3303476_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028096.1|3303486_3303981_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
WP_001326838.1|3304001_3305330_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	3.7e-234
WP_001273658.1|3305412_3305586_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_000331688.1|3306517_3314899_-	hypothetical protein	NA	A0A0P0ZGX9	Escherichia_phage	100.0	0.0e+00
WP_000012452.1|3314968_3316234_-	hypothetical protein	NA	A0A0P0ZFI5	Escherichia_phage	100.0	2.4e-206
WP_000540391.1|3316244_3316496_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455649.1|3316505_3316952_-	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000509482.1|3316954_3317611_-	hypothetical protein	NA	A0A0P0ZGF6	Escherichia_phage	100.0	5.1e-104
WP_000035557.1|3317705_3318107_-	hypothetical protein	NA	A0A088CC37	Shigella_phage	100.0	1.2e-71
WP_000078907.1|3318163_3318304_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835361.1|3318534_3319269_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZH34	Escherichia_phage	100.0	9.7e-136
WP_001301884.1|3319359_3319977_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455635.1|3319982_3320261_-	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_000197192.1|3320275_3321544_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_024199968.1|3321540_3323166_-	hypothetical protein	NA	A0A0P0ZG99	Escherichia_phage	100.0	0.0e+00
WP_000513231.1|3323399_3323912_-	receptor recognizing protein Gp38	NA	A0A0P0ZFL3	Escherichia_phage	100.0	1.2e-92
WP_000117976.1|3323998_3326590_-|tail	tail fiber protein	tail	A0A0P0ZGL7	Escherichia_phage	100.0	6.1e-209
WP_000207922.1|3326586_3327237_-	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	100.0	4.6e-121
WP_000829202.1|3327236_3327800_-	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	100.0	4.1e-102
3327242:3327257	attR	AAAACCTCTGCCTGCG	NA	NA	NA	NA
WP_001290743.1|3327783_3328245_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140445.1|3328295_3328685_-	hypothetical protein	NA	A0A0P0ZFT7	Escherichia_phage	100.0	3.8e-62
WP_000214467.1|3328739_3329954_-|capsid	N4-gp56 family major capsid protein	capsid	A0A0N7KZY1	Escherichia_phage	100.0	1.7e-233
WP_000345015.1|3329977_3330985_-	hypothetical protein	NA	A0A0P0ZGF7	Escherichia_phage	100.0	2.3e-180
WP_000787518.1|3331142_3333287_-|portal	portal protein	portal	A0A0P0ZGR1	Escherichia_phage	100.0	0.0e+00
WP_000143988.1|3333286_3334993_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086069.1|3334973_3335780_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_001301714.1|3335835_3336039_-	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_000738505.1|3336188_3336482_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001082654.1|3336513_3336978_-|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000455406.1|3336985_3337135_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001056885.1|3337134_3337704_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000087461.1|3337978_3338512_-	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_001072899.1|3338516_3338732_-|holin	class II holin family protein	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_001290230.1|3338809_3339055_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|3339095_3339275_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874432.1|3339411_3341349_-	SASA family carbohydrate esterase	NA	A0A0P0ZGE0	Escherichia_phage	100.0	0.0e+00
WP_000738068.1|3341834_3342104_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3342115_3343075_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001356551.1|3343457_3343610_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204859.1|3343858_3344293_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000144767.1|3344285_3344480_-	phage NinH family protein	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_000813671.1|3344476_3345040_-	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000402092.1|3345047_3345497_-	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_001260358.1|3345496_3346468_-	toprim domain-containing protein	NA	A0A0P0ZFY3	Escherichia_phage	100.0	6.5e-196
WP_000913116.1|3346457_3347978_-	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	100.0	1.4e-306
WP_001271433.1|3347971_3348349_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_001369601.1|3348515_3348710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240876.1|3348880_3349084_-	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001056250.1|3349179_3349893_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_000939558.1|3349987_3351457_+	Eco57I restriction-modification methylase domain-containing protein	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001064714.1|3351453_3352407_+	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_113690331.1|3353024_3353810_+	Rha family phage regulatory protein	NA	A0A0P0ZGC2	Escherichia_phage	96.2	2.6e-139
WP_000917252.1|3353880_3354093_+	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_000934197.1|3354104_3354386_+	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_000995345.1|3354406_3354688_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_000459721.1|3354704_3355655_+	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	100.0	1.1e-179
WP_000187063.1|3355651_3356341_+	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000344637.1|3356340_3356928_+	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	100.0	1.2e-107
WP_001071603.1|3357002_3357350_+	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_000080417.1|3357413_3358235_+	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_001159715.1|3358311_3358707_+	hypothetical protein	NA	A0A0P0ZG44	Escherichia_phage	100.0	1.1e-69
WP_000206047.1|3358857_3359583_+	ead/Ea22-like family protein	NA	A0A0P0ZFU9	Escherichia_phage	100.0	3.3e-128
WP_000034212.1|3359579_3359987_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_001014298.1|3359988_3360180_+	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_000206786.1|3360182_3361079_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	100.0	5.4e-173
WP_000203837.1|3361434_3361719_+	phage antirepressor Ant	NA	G9L6G2	Escherichia_phage	100.0	4.1e-50
WP_000211520.1|3361968_3362598_+	phage antirepressor Ant	NA	G9L6G1	Escherichia_phage	100.0	2.3e-117
WP_000809302.1|3362653_3363085_+	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000163448.1|3363081_3363708_+	adenine methylase	NA	G9L6F9	Escherichia_phage	100.0	1.8e-122
WP_001291843.1|3363667_3363880_+	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000994793.1|3363915_3364296_+	DUF1627 domain-containing protein	NA	A0A0P0ZFT6	Escherichia_phage	100.0	1.2e-52
WP_000497812.1|3364659_3364911_+	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_001208772.1|3364956_3365241_+	excisionase family protein	NA	A0A0P0ZGY2	Escherichia_phage	100.0	7.0e-50
WP_001401545.1|3365293_3366604_+	DUF3596 domain-containing protein	NA	A0A0P0ZGT7	Escherichia_phage	100.0	2.4e-254
>prophage 13
NC_018661	Escherichia coli O104:H4 str. 2009EL-2071, complete sequence	5312586	3577419	3673962	5312586	transposase,portal,capsid,lysis,integrase,head,tail	Enterobacteria_phage(46.15%)	107	3603703:3603737	3675396:3675430
WP_000399648.1|3577419_3578400_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000961458.1|3578678_3580271_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_001056384.1|3580489_3581410_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000056442.1|3581468_3582587_-	anion transporter	NA	NA	NA	NA	NA
WP_000091016.1|3582583_3583051_-	manganese-binding transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_001001761.1|3583236_3583365_+	manganase accumulation protein MntS	NA	NA	NA	NA	NA
WP_001054697.1|3583636_3585220_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001295296.1|3585268_3585784_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|3585836_3585902_-	protein YliM	NA	NA	NA	NA	NA
WP_001119538.1|3586136_3587024_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|3587322_3587826_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|3588229_3588976_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|3589114_3589774_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|3589770_3590493_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001267242.1|3590609_3592835_+	mechanosensitive channel protein	NA	NA	NA	NA	NA
WP_001387659.1|3592831_3593758_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_001387658.1|3594033_3594294_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430039.1|3594558_3596841_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990161.1|3596882_3597560_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	3.1e-19
WP_000146343.1|3597633_3597900_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|3598164_3598425_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443512.1|3598653_3599739_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386540.1|3599879_3600842_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001340191.1|3600869_3603020_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_001145128.1|3603139_3603622_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
3603703:3603737	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000007101.1|3603853_3605218_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|3605446_3606118_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001296990.1|3606120_3607116_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996091.1|3607108_3608845_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
WP_000070131.1|3608837_3609971_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|3609981_3611088_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|3611049_3611460_-	YbhQ family protein	NA	NA	NA	NA	NA
WP_001113348.1|3611592_3612354_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650337.1|3612350_3613592_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045450.1|3613591_3614548_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_001088647.1|3614583_3615297_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_001331162.1|3615366_3616014_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000373624.1|3616215_3616920_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852287.1|3617056_3617509_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598616.1|3617510_3617756_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|3617748_3618234_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084632.1|3618236_3618749_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001295301.1|3618770_3619760_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001295302.1|3620156_3621065_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042533.1|3621256_3623278_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044868.1|3623863_3624541_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246805.1|3624533_3625289_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118840.1|3625275_3626430_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951213.1|3626426_3627467_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_001307065.1|3627553_3628843_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
WP_000767389.1|3628901_3629378_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_000586343.1|3630123_3631455_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	2.5e-20
WP_000885598.1|3631528_3632113_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	1.9e-105
WP_001387657.1|3632112_3635187_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_001233090.1|3635251_3635851_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_000515639.1|3635921_3639419_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.6	0.0e+00
WP_000090917.1|3639479_3640112_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000140717.1|3640048_3640792_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.1e-146
WP_001152492.1|3640797_3641496_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	1.8e-131
WP_000847379.1|3641495_3641825_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840291.1|3641821_3644383_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	97.9	0.0e+00
WP_000459457.1|3644375_3644810_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479200.1|3644791_3645214_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.0	1.4e-59
WP_001390429.1|3645229_3645970_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	6.8e-129
WP_000683129.1|3645977_3646373_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_000975081.1|3646369_3646948_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000785282.1|3646959_3647313_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000158875.1|3647324_3647720_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000063238.1|3647761_3648787_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	4.7e-189
WP_001299443.1|3648842_3649175_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123216.1|3649184_3650504_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.4e-230
WP_001316944.1|3650484_3652086_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	1.2e-311
WP_000198149.1|3652082_3652289_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_000453580.1|3654184_3654730_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_000105084.1|3655118_3655352_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|3655408_3655819_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001028465.1|3656168_3656690_-	KilA-N domain-containing protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_000092234.1|3656894_3657332_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	94.5	3.0e-68
WP_001135297.1|3657328_3657826_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	3.2e-90
WP_000839596.1|3657825_3658041_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737263.1|3658629_3659712_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
WP_001204791.1|3659900_3660284_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971074.1|3660369_3660510_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_000774504.1|3660864_3661155_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224912.1|3661147_3661318_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	1.4e-13
WP_001053034.1|3661317_3661773_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	4.9e-61
WP_072147432.1|3661769_3661871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001391403.1|3661967_3662219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338663.1|3662795_3663035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145901.1|3664186_3664489_-	protein ren	NA	M1FPD5	Enterobacteria_phage	97.8	6.1e-44
WP_000788812.1|3664485_3665187_-	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_000147903.1|3665183_3666203_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	9.7e-110
WP_001182903.1|3666199_3666739_-	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_001067458.1|3666808_3667039_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|3667144_3667834_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000233576.1|3668431_3668638_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995433.1|3668713_3669010_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000100847.1|3669015_3669801_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186833.1|3669797_3670478_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000682318.1|3670474_3670657_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000548541.1|3670629_3670821_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	4.7e-26
WP_000188870.1|3670897_3671113_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763367.1|3671211_3671433_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_000120064.1|3671643_3672246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|3672488_3672656_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|3672695_3672914_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533642.1|3672891_3673962_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
3675396:3675430	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 14
NC_018661	Escherichia coli O104:H4 str. 2009EL-2071, complete sequence	5312586	4179601	4235563	5312586	transposase,plate,integrase	Escherichia_phage(18.18%)	54	4179290:4179303	4195292:4195305
4179290:4179303	attL	AAGAATGGCGGCAG	NA	NA	NA	NA
WP_001269640.1|4179601_4180879_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000378354.1|4180959_4181244_-	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	57.7	5.1e-16
WP_000019427.1|4181324_4182305_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	3.4e-184
WP_000891726.1|4182883_4184725_-	hypothetical protein	NA	A0A140G5Z0	Enterobacteria_phage	27.5	1.9e-18
WP_001387927.1|4184759_4184957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999102.1|4185108_4186140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013184.1|4186154_4186538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807036.1|4186542_4186740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390662.1|4187730_4188030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000580786.1|4188029_4188233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000532776.1|4188290_4188674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221926.1|4188771_4189041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000594462.1|4189050_4189719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296967.1|4189866_4190049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001273869.1|4191723_4192275_+	recombinase family protein	NA	Q2A092	Sodalis_phage	43.9	3.2e-30
WP_000550450.1|4192615_4192774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000788776.1|4192840_4192993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000893256.1|4193789_4195043_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.3e-95
WP_001285288.1|4195054_4196158_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
4195292:4195305	attR	AAGAATGGCGGCAG	NA	NA	NA	NA
WP_000749877.1|4196445_4197501_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	2.2e-117
WP_000174677.1|4197539_4197941_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|4197998_4199243_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4199334_4199793_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293014.1|4200053_4201511_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000602103.1|4201567_4202182_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_000528869.1|4202178_4203318_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	2.0e-31
WP_001059855.1|4203563_4204016_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001226164.1|4204012_4205068_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207574.1|4205138_4205924_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001386594.1|4205868_4207608_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000598758.1|4207712_4207991_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_001030484.1|4207983_4208340_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_000543895.1|4208396_4209170_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729704.1|4209355_4209616_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615974.1|4209618_4209897_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4210052_4210793_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|4210763_4211531_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4211736_4212315_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973081.1|4212554_4214999_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4215041_4215515_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118029.1|4215668_4216439_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_122985282.1|4218926_4219112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939262.1|4219026_4219509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000103304.1|4223231_4225373_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.8	3.7e-26
WP_001142958.1|4225582_4226101_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037389.1|4226797_4227298_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4227332_4227557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056978.1|4227607_4229083_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611748.1|4229089_4229503_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393853.1|4229506_4231357_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|4231320_4232403_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|4232427_4233708_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|4233704_4234229_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246421.1|4234231_4235563_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 15
NC_018661	Escherichia coli O104:H4 str. 2009EL-2071, complete sequence	5312586	4552228	4616225	5312586	transposase,holin	Stx2-converting_phage(33.33%)	59	NA	NA
WP_000181142.1|4552228_4553185_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.5	2.7e-61
WP_001137018.1|4553651_4554884_+	multidrug efflux MFS transporter MdtM	NA	NA	NA	NA	NA
WP_001037377.1|4554924_4556205_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_001298930.1|4556320_4557472_+	2-hydroxyacyl-CoA dehydratase subunit D	NA	NA	NA	NA	NA
WP_000222495.1|4557481_4558249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000657676.1|4558245_4558503_+	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
WP_001298932.1|4558567_4559428_+	YjiK family protein	NA	NA	NA	NA	NA
WP_001141192.1|4559495_4560674_+	MFS transporter	NA	NA	NA	NA	NA
WP_001151854.1|4560686_4561241_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
WP_001295597.1|4561490_4562174_+	nucleoside recognition pore and gate family inner membrane transporter	NA	NA	NA	NA	NA
WP_000211971.1|4562170_4562632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000568407.1|4562644_4563817_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_000340758.1|4563881_4564793_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_000986215.1|4564785_4565178_-	anti-adapter protein IraD	NA	NA	NA	NA	NA
WP_120795393.1|4565174_4565258_-	iraD leader peptide IdlP	NA	NA	NA	NA	NA
WP_000062571.1|4565849_4566680_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000833686.1|4566820_4567594_-	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_000208220.1|4567808_4569269_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	3.6e-49
WP_000438591.1|4569349_4570534_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_000558251.1|4570873_4572217_+	gluconate permease GntP	NA	NA	NA	NA	NA
WP_000250224.1|4573323_4574001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001329788.1|4574832_4575030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813456.1|4575201_4575804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235221.1|4575898_4576105_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000840367.1|4576245_4576512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000221544.1|4577729_4578299_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270971.1|4578558_4578960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221614.1|4578947_4579382_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_001390365.1|4579736_4580117_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	3.9e-64
WP_000612591.1|4580113_4580461_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998014.1|4580510_4581896_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	1.4e-257
WP_000823241.1|4582134_4583493_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000555341.1|4584243_4584501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|4585418_4585940_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|4585936_4586890_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188245.1|4586976_4589301_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879153.1|4589345_4590248_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125175.1|4590244_4591243_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|4591239_4592196_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|4592196_4592964_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|4593521_4593779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189126.1|4594429_4595938_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_160371899.1|4597513_4598356_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001388979.1|4598358_4599447_+	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_001387303.1|4599451_4600402_+	virulence factor VirK	NA	NA	NA	NA	NA
WP_001390363.1|4600466_4601411_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000088357.1|4601591_4602731_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
WP_001293435.1|4602884_4604882_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000625669.1|4604944_4606222_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000145474.1|4606467_4607124_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001422798.1|4607304_4607433_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000422741.1|4607571_4607997_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|4607993_4608344_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080200.1|4608374_4609988_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
WP_001295538.1|4611171_4611954_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350265.1|4612259_4613180_+	ribokinase	NA	NA	NA	NA	NA
WP_000998350.1|4613207_4614524_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000107474.1|4614535_4615549_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_001327567.1|4615970_4616225_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	8.0e-21
>prophage 16
NC_018661	Escherichia coli O104:H4 str. 2009EL-2071, complete sequence	5312586	4675573	4816550	5312586	transposase,tRNA,protease	Escherichia_phage(12.0%)	117	NA	NA
WP_001162171.1|4675573_4676926_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4677019_4677571_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219816.1|4677721_4679095_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853753.1|4679270_4680269_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000595979.1|4680301_4681297_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001387274.1|4681283_4682306_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205794.1|4682319_4683822_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_000265933.1|4684131_4685088_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|4685397_4685928_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000239579.1|4686007_4686358_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223208.1|4686351_4686603_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4686814_4687156_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060946.1|4687158_4690938_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4690934_4692668_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001295196.1|4692873_4693512_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935042.1|4693834_4695178_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4695239_4695446_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175289.1|4695770_4696328_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000886909.1|4696317_4697058_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589423.1|4697247_4699191_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|4699319_4699700_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560563.1|4699788_4700649_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001296686.1|4700756_4701722_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331456.1|4701829_4702492_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4702536_4703949_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4704257_4704878_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119478.1|4705096_4705735_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826425.1|4705869_4707078_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	9.2e-208
WP_000604912.1|4707085_4707517_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
WP_001351393.1|4708139_4708934_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4709004_4709454_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4709495_4709723_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4709727_4710042_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4710048_4710444_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4710770_4711046_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000996728.1|4711120_4711672_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4711768_4712455_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949539.1|4712454_4713309_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4713318_4713969_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776505.1|4713982_4714447_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4714456_4714762_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001300695.1|4714777_4716175_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|4716529_4717594_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|4717701_4718457_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569708.1|4718453_4719203_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4719384_4719714_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4719862_4720138_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001339483.1|4720254_4721880_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943976.1|4721963_4723127_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.3e-81
WP_000101644.1|4723129_4723768_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000012553.1|4724193_4724853_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|4724903_4725602_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|4725620_4726022_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4726148_4726880_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076316.1|4727059_4729501_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|4729539_4729965_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4730169_4731468_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4731571_4731769_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4731850_4732855_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312490.1|4732857_4734117_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|4734202_4735483_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|4735559_4735868_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|4735953_4736904_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122523.1|4736896_4738744_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.6	2.6e-60
WP_000990321.1|4738753_4740091_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|4740109_4740571_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001307537.1|4740542_4742090_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294219.1|4742088_4743228_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|4743210_4743264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|4744006_4744552_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|4744646_4745699_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934933.1|4745795_4746764_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236813.1|4746785_4750109_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001276180.1|4750137_4750452_-	YjeO family protein	NA	NA	NA	NA	NA
WP_000342867.1|4750448_4750763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001346081.1|4750814_4752317_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|4752535_4753513_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192973.1|4753837_4755646_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|4755638_4756373_+	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_000208757.1|4756383_4756779_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_001299198.1|4756789_4757149_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001367937.1|4757211_4758345_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238378.1|4758433_4758967_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|4758963_4759281_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|4759455_4759602_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|4759712_4759838_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|4759889_4760456_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940530.1|4760497_4761526_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001008073.1|4761915_4762785_+	YjeJ family protein	NA	NA	NA	NA	NA
WP_000558209.1|4762987_4763341_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|4763478_4765125_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|4765168_4765462_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015837.1|4765737_4766994_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|4767009_4767486_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|4767822_4769259_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961957.1|4769376_4770678_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000883400.1|4770793_4771132_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068978.1|4771107_4772805_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001387262.1|4772841_4773417_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001034110.1|4781497_4785355_+|protease	serine protease autotransporter toxin SigA	protease	Q9LA58	Enterobacterial_phage	38.3	2.4e-225
WP_000291751.1|4785401_4785983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000624688.1|4787816_4788167_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_001309734.1|4788163_4788598_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_000422740.1|4791137_4791563_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001189118.1|4793248_4794757_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_001387241.1|4795721_4797917_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750143.1|4797922_4799260_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015710.1|4799256_4800999_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001287497.1|4800998_4801946_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001387605.1|4801946_4803671_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000074478.1|4803806_4805000_+	MFS transporter	NA	NA	NA	NA	NA
WP_001387604.1|4804949_4805876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000555384.1|4806615_4807749_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_077577697.1|4807788_4808151_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	62.5	6.4e-40
WP_000019416.1|4808518_4809499_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	3.4e-184
WP_001390760.1|4810145_4811270_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.3e-199
WP_001045650.1|4812431_4816550_-|protease	serine protease autotransporter toxin Pic	protease	Q9LA54	Enterobacteria_phage	45.8	0.0e+00
>prophage 1
NC_018662	Escherichia coli O104:H4 str. 2009EL-2071 plasmid pAA-09EL71, complete sequence	75573	10848	17802	75573	transposase	Stx2-converting_phage(57.14%)	8	NA	NA
WP_000019440.1|10848_11829_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_001339397.1|12556_13234_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|13233_13581_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381397.1|13600_15172_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	2.2e-169
WP_000624689.1|15484_15781_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	64.4	3.4e-31
WP_001387845.1|15777_16212_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	3.4e-19
WP_000139330.1|16440_17001_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000205736.1|17055_17802_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
