The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_018867	Dehalobacter sp. CF, complete sequence	3092048	614278	622396	3092048	coat	Staphylococcus_phage(50.0%)	8	NA	NA
WP_015042621.1|614278_615223_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	28.5	8.6e-28
WP_015042622.1|615387_616377_+	J domain-containing protein	NA	A0A1V0SF83	Hokovirus	27.0	4.2e-17
WP_015042623.1|616593_619179_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	38.1	1.1e-128
WP_015042625.1|619358_619568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015042626.1|619587_619785_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015042627.1|619891_620356_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	55.7	8.2e-40
WP_176714393.1|620483_621683_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	51.5	7.4e-109
WP_025205606.1|621742_622396_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.7	2.6e-39
>prophage 2
NC_018867	Dehalobacter sp. CF, complete sequence	3092048	1282541	1314824	3092048	transposase,integrase	Pseudomonas_phage(33.33%)	33	1304353:1304376	1323157:1323180
WP_167967857.1|1282541_1282760_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_015043229.1|1282806_1283067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015043230.1|1283079_1284333_+	DNA polymerase IV	NA	A0A290GHP0	Caldibacillus_phage	26.8	1.4e-17
WP_015043231.1|1284337_1285021_-	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	50.7	3.8e-33
WP_015043232.1|1285176_1285350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015045250.1|1285526_1285943_+	helicase	NA	NA	NA	NA	NA
WP_144020272.1|1286569_1287689_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	61.6	3.9e-96
WP_051014019.1|1287691_1288003_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_015043235.1|1288065_1288737_-	haloacid dehalogenase type II	NA	NA	NA	NA	NA
WP_051014022.1|1288861_1289638_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015043237.1|1289573_1290653_-	uroporphyrinogen III decarboxylase	NA	NA	NA	NA	NA
WP_081582765.1|1290658_1291312_-	corrinoid protein	NA	NA	NA	NA	NA
WP_015045252.1|1291632_1292913_-	PocR ligand-binding domain-containing protein	NA	Q9EYF3	Enterobacteria_phage	29.8	8.1e-21
WP_052168595.1|1293440_1293929_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_081582766.1|1294027_1294201_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_041225779.1|1294725_1295733_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_193352139.1|1295773_1296172_-	NusG domain II-containing protein	NA	NA	NA	NA	NA
WP_015045255.1|1296235_1297582_-	FMN-binding protein	NA	NA	NA	NA	NA
WP_015045256.1|1297775_1298093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015045257.1|1298110_1299481_-	reductive dehalogenase	NA	NA	NA	NA	NA
WP_015043248.1|1299980_1300598_+	DUF1638 domain-containing protein	NA	NA	NA	NA	NA
WP_015043249.1|1300638_1300950_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_015043250.1|1301176_1301863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015043251.1|1301988_1302882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081580509.1|1303286_1304300_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.6	2.4e-36
1304353:1304376	attL	AAGAAAGTAGTTATGCAAAGTAAA	NA	NA	NA	NA
WP_015043253.1|1304481_1305717_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_015043254.1|1305709_1306696_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_015043255.1|1306682_1307696_+|integrase	site-specific integrase	integrase	A0A0K2CP59	Brevibacillus_phage	25.4	7.1e-20
WP_015043256.1|1307797_1308532_-	reverse transcriptase N-terminal domain-containing protein	NA	A0A0U4J920	Pseudomonas_phage	41.2	3.1e-41
WP_015043257.1|1309195_1311007_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.3	1.4e-31
WP_015043259.1|1312139_1313267_-	cobalamin biosynthesis protein CbiD	NA	NA	NA	NA	NA
WP_081580510.1|1313357_1313735_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_144020276.1|1313703_1314824_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	62.0	8.0e-97
1323157:1323180	attR	TTTACTTTGCATAACTACTTTCTT	NA	NA	NA	NA
>prophage 3
NC_018867	Dehalobacter sp. CF, complete sequence	3092048	1420936	1431273	3092048	terminase,integrase,portal	uncultured_Caudovirales_phage(25.0%)	12	1415613:1415629	1428693:1428709
1415613:1415629	attL	TTTTTCTCATTTTGAGG	NA	NA	NA	NA
WP_015045285.1|1420936_1421521_-	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	37.4	7.7e-27
WP_041225783.1|1421648_1422050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041225784.1|1422129_1423401_-|portal	phage portal protein	portal	A0A1V0DZW8	Clostridioides_phage	35.0	8.3e-58
WP_015045289.1|1423464_1424277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041225908.1|1424326_1425877_-|terminase	phage terminase large subunit	terminase	A0A0N7AEF1	Bacillus_phage	33.1	7.7e-74
WP_015045291.1|1426003_1426228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015045292.1|1426442_1426919_-	SocA family protein	NA	A0A0N9SGM1	Paenibacillus_phage	44.4	8.2e-27
WP_015045293.1|1427119_1427968_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7C7	Bacillus_phage	28.1	2.9e-22
WP_015045294.1|1428129_1428681_-	hypothetical protein	NA	A0A2H4JAE2	uncultured_Caudovirales_phage	35.0	2.2e-15
WP_015045295.1|1428734_1428935_-	hypothetical protein	NA	NA	NA	NA	NA
1428693:1428709	attR	CCTCAAAATGAGAAAAA	NA	NA	NA	NA
WP_015045296.1|1429124_1429880_-	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	30.3	6.9e-20
WP_015045297.1|1430025_1431273_-	DNA modification methylase	NA	E4ZFL4	Streptococcus_phage	52.1	1.8e-118
>prophage 4
NC_018867	Dehalobacter sp. CF, complete sequence	3092048	1700832	1748107	3092048	transposase,integrase	Pseudomonas_phage(40.0%)	42	1730238:1730253	1751243:1751258
WP_015042568.1|1700832_1702437_+|transposase	IS1182 family transposase	transposase	A0A146ICT8	Staphylococcus_phage	35.3	2.2e-76
WP_015045324.1|1702555_1703500_-	AmmeMemoRadiSam system radical SAM enzyme	NA	NA	NA	NA	NA
WP_015045325.1|1703521_1704784_-	AmmeMemoRadiSam system protein A	NA	NA	NA	NA	NA
WP_015043719.1|1705429_1705642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015043720.1|1705749_1706067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015043721.1|1706133_1707789_-	reductive dehalogenase	NA	NA	NA	NA	NA
WP_144020279.1|1708426_1708651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015043727.1|1710006_1710957_-	trigger factor	NA	NA	NA	NA	NA
WP_015043728.1|1711084_1712371_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_015043729.1|1712478_1712796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015043730.1|1712858_1714514_-	reductive dehalogenase	NA	NA	NA	NA	NA
WP_025206075.1|1714989_1715298_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_015043732.1|1716112_1716739_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_015043754.1|1716795_1718298_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_015043735.1|1719367_1721464_+	glutamine synthetase III	NA	NA	NA	NA	NA
WP_015043736.1|1721589_1722108_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_015043737.1|1722374_1723514_+	hydrogenase small subunit	NA	NA	NA	NA	NA
WP_015043738.1|1723536_1725243_+	nickel-dependent hydrogenase large subunit	NA	NA	NA	NA	NA
WP_167539431.1|1725294_1726056_+	Ni/Fe-hydrogenase, b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_176714377.1|1726030_1727095_+	spore photoproduct lyase	NA	NA	NA	NA	NA
WP_015043741.1|1727124_1728267_-	hypothetical protein	NA	G3MB53	Bacillus_virus	42.7	1.9e-61
WP_015043742.1|1728352_1729105_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_015043743.1|1729162_1729681_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_015043744.1|1729682_1730552_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
1730238:1730253	attL	TTGCTCCTGGAATTCC	NA	NA	NA	NA
WP_015043745.1|1730616_1731195_-	DUF3795 domain-containing protein	NA	NA	NA	NA	NA
WP_015043746.1|1731251_1731641_-	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_015045330.1|1731928_1732990_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_015043749.1|1733050_1733353_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_015043753.1|1735160_1736048_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015043754.1|1736228_1737731_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_015043755.1|1738009_1738576_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015043756.1|1738811_1739570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015043757.1|1739773_1741135_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.6	1.1e-31
WP_015045332.1|1741162_1741390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015043758.1|1741659_1742844_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_015043759.1|1743049_1743367_-	DUF4362 domain-containing protein	NA	NA	NA	NA	NA
WP_015043760.1|1743652_1744180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015042955.1|1744283_1745630_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.4	8.2e-32
WP_081580523.1|1745687_1745882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015043762.1|1746293_1746506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015043763.1|1747086_1747782_-	SprT-like domain-containing protein	NA	NA	NA	NA	NA
WP_144020288.1|1747924_1748107_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	53.7	4.2e-08
1751243:1751258	attR	TTGCTCCTGGAATTCC	NA	NA	NA	NA
>prophage 5
NC_018867	Dehalobacter sp. CF, complete sequence	3092048	1828082	1859816	3092048	transposase,terminase,holin	Clostridium_phage(40.0%)	31	NA	NA
WP_015043842.1|1828082_1828454_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_015043843.1|1828490_1829159_-	M23 family metallopeptidase	NA	A0A1B0XUH3	Freshwater_phage	40.6	4.8e-17
WP_015043844.1|1829162_1829564_-|holin	phage holin family protein	holin	A0A0A7RTU1	Clostridium_phage	45.0	2.2e-25
WP_015043845.1|1829579_1830305_-	Rha family transcriptional regulator	NA	A0A2I7RH70	Vibrio_phage	33.9	7.8e-29
WP_041225787.1|1830608_1830863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015043846.1|1830889_1834381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015043847.1|1834391_1835810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015044949.1|1836547_1837789_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	38.5	2.3e-57
WP_015043848.1|1837940_1839938_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_015043849.1|1839942_1841679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015043850.1|1841668_1842247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015043851.1|1842262_1843900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041225788.1|1843912_1844203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015043853.1|1844262_1844445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015043854.1|1844496_1845396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015043855.1|1845463_1846174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015043856.1|1846188_1846896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015043857.1|1847029_1848994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015043858.1|1849029_1850490_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0A7RTE7	Clostridium_phage	26.1	7.1e-21
WP_015043859.1|1850559_1851036_-|transposase	transposase	transposase	A0A0A7RTH0	Clostridium_phage	56.1	4.5e-41
WP_015045337.1|1851048_1851342_-	hypothetical protein	NA	I1TK27	Clostridium_phage	37.4	7.3e-10
WP_015043860.1|1851623_1851839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041225790.1|1851843_1852242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015043861.1|1852375_1853737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015045338.1|1853861_1854425_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_015043863.1|1854453_1854849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015043864.1|1855074_1855350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015043865.1|1855346_1857170_-	AAA family ATPase	NA	S0A1J9	Cellulophaga_phage	23.9	2.2e-19
WP_015043866.1|1857169_1858093_-	replication protein	NA	A0A290FZL4	Caldibacillus_phage	50.0	1.7e-20
WP_015043867.1|1858131_1858365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144020267.1|1858696_1859816_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	62.0	8.0e-97
>prophage 6
NC_018867	Dehalobacter sp. CF, complete sequence	3092048	1954038	2017274	3092048	transposase,tRNA,protease,coat	Moumouvirus(16.67%)	47	NA	NA
WP_015043969.1|1954038_1955502_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	27.7	3.3e-42
WP_015043970.1|1955521_1956979_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015043971.1|1957086_1958274_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_015043972.1|1958251_1959418_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_015043974.1|1959688_1960081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015043975.1|1960234_1961575_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_015043976.1|1961588_1964072_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	35.7	1.9e-130
WP_015043977.1|1964103_1965171_-	protein arginine kinase	NA	NA	NA	NA	NA
WP_015043978.1|1965167_1965692_-	protein-arginine kinase activator protein McsA	NA	NA	NA	NA	NA
WP_015043979.1|1965706_1966180_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015043980.1|1966365_1967148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015043981.1|1967322_1967925_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_034378231.1|1968016_1968439_+	membrane protein	NA	NA	NA	NA	NA
WP_015045343.1|1968497_1970723_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_015043984.1|1970866_1971496_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015043985.1|1971484_1972546_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_015043986.1|1972588_1973377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015043987.1|1973449_1974583_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_015043988.1|1974751_1978723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015043989.1|1978991_1979465_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015043990.1|1979588_1980005_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015043991.1|1980169_1980850_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_015043992.1|1980933_1981371_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_015043993.1|1981395_1982034_-	DedA family protein	NA	NA	NA	NA	NA
WP_015043994.1|1982233_1982983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015042137.1|1983340_1985110_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_015043995.1|1985171_1985354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015043996.1|1991848_1993120_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015043997.1|1993377_1996029_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_015043998.1|1996153_1998544_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	43.2	2.1e-09
WP_015043999.1|1998545_2001131_-	U32 family peptidase	NA	Q6DW11	Phage_TP	29.5	1.3e-33
WP_015044000.1|2001363_2001666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015044001.1|2002351_2002618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051014054.1|2002793_2003183_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015044002.1|2003291_2004215_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_034377939.1|2004588_2005005_-	DUF3795 domain-containing protein	NA	NA	NA	NA	NA
WP_034377937.1|2005202_2005715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081580526.1|2005929_2006259_-	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_015044003.1|2006461_2007181_-	DUF169 domain-containing protein	NA	NA	NA	NA	NA
WP_015042633.1|2007607_2009050_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015044004.1|2009422_2010082_-	YIP1 family protein	NA	NA	NA	NA	NA
WP_015045345.1|2010757_2011144_-	response regulator	NA	NA	NA	NA	NA
WP_015044008.1|2011273_2011486_+	helix-turn-helix transcriptional regulator	NA	S5MNZ4	Brevibacillus_phage	35.4	6.7e-05
WP_015044009.1|2012125_2012635_+	YcxB family protein	NA	NA	NA	NA	NA
WP_015044010.1|2012826_2014779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015044011.1|2015149_2015911_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_144020267.1|2016153_2017274_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	62.0	8.0e-97
>prophage 7
NC_018867	Dehalobacter sp. CF, complete sequence	3092048	2252333	2263059	3092048		Synechococcus_phage(25.0%)	10	NA	NA
WP_034378672.1|2252333_2253875_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.7	4.3e-77
WP_015044235.1|2254114_2254723_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.1	1.3e-21
WP_015044236.1|2254719_2255736_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F0L1	Synechococcus_phage	46.7	1.7e-69
WP_015044237.1|2255759_2257160_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	36.1	2.0e-60
WP_015044238.1|2257246_2257966_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	36.8	2.2e-39
WP_015044239.1|2258104_2259403_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	28.8	2.7e-19
WP_015044240.1|2259430_2259925_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	4.7e-25
WP_015044241.1|2260218_2261286_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_015044243.1|2261582_2262368_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_015044244.1|2262360_2263059_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.0	2.1e-18
