The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_018939	Helicobacter pylori 26695, complete genome	1667892	1018476	1070401	1667892	tRNA,integrase,transposase	Helicobacter_phage(50.0%)	43	1028984:1029003	1080324:1080343
WP_001150920.1|1018476_1019388_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_000401714.1|1019401_1020340_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001862971.1|1020471_1020933_-	acyl carrier protein	NA	M4QDG5	Prochlorococcus_phage	47.1	1.3e-05
WP_001862974.1|1020925_1022269_-	dynamin-like GTPase family protein	NA	NA	NA	NA	NA
WP_010875568.1|1022265_1023357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010875569.1|1023266_1024598_-	dynamin-like GTPase family protein	NA	NA	NA	NA	NA
WP_010875570.1|1024594_1026244_-	GTPase	NA	NA	NA	NA	NA
WP_000271456.1|1026464_1026752_-	endoribonuclease VapD	NA	NA	NA	NA	NA
WP_000978968.1|1027119_1030182_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	25.7	2.8e-83
1028984:1029003	attL	ATGAGCATGCCTATAGCGAT	NA	NA	NA	NA
WP_000816822.1|1030178_1031258_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_010875571.1|1031254_1032496_-	membrane protein	NA	NA	NA	NA	NA
WP_000555186.1|1032545_1034651_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000682021.1|1034762_1035824_+	hypothetical protein	NA	A0A2D1GN01	Pseudoalteromonas_phage	30.1	2.0e-09
WP_000057737.1|1035836_1037312_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001165207.1|1037326_1037608_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_001010809.1|1037727_1039038_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	NA	NA	NA	NA
WP_000574070.1|1039166_1040630_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_000400290.1|1040645_1042124_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_000233600.1|1042254_1043412_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_001863015.1|1044569_1044872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049794234.1|1044882_1045155_+	exonuclease VII large subunit	NA	NA	NA	NA	NA
WP_010875573.1|1045526_1046222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169565.1|1046222_1046513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343415.1|1047071_1047896_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_010875574.1|1048105_1048429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010875575.1|1048731_1049445_-	DUF1887 family protein	NA	NA	NA	NA	NA
WP_000886948.1|1050828_1051062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010875484.1|1051068_1051497_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RG71	Helicobacter_phage	97.9	8.6e-76
WP_000930564.1|1051566_1052850_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1S5REX3	Helicobacter_phage	85.2	1.2e-200
WP_080012132.1|1052898_1053612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010875576.1|1053616_1054246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000006537.1|1054831_1055083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000009099.1|1055054_1055858_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_001120382.1|1056174_1057242_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	26.7	1.7e-08
WP_010875578.1|1058390_1060193_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_000930565.1|1060341_1061625_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1S5REX3	Helicobacter_phage	85.0	2.6e-200
WP_010875484.1|1061694_1062123_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RG71	Helicobacter_phage	97.9	8.6e-76
WP_000587397.1|1062704_1063361_+	ParA family protein	NA	A2I303	Vibrio_virus	23.4	7.1e-05
WP_000394638.1|1063445_1063730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000665511.1|1063773_1064958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000065304.1|1067173_1067488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000254056.1|1068038_1068572_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_001862466.1|1069984_1070401_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	96.4	4.6e-74
1080324:1080343	attR	ATCGCTATAGGCATGCTCAT	NA	NA	NA	NA
