The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_019393	Alteromonas mediterranea DE1, complete sequence	4643844	967494	982295	4643844	integrase,transposase	Escherichia_phage(33.33%)	14	971245:971293	996197:996245
WP_085929700.1|967494_968662_+|transposase	IS3-like element ISAma1 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.6	2.6e-58
WP_012517417.1|969390_969585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015066337.1|970159_970879_-	AAA family ATPase	NA	NA	NA	NA	NA
971245:971293	attL	AAATGGTGGCCCCACCCTGACTTGAACAGGGGACCTGCCGATTATGAGT	NA	NA	NA	NA
WP_015066338.1|971493_972813_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0R6PGY7	Moraxella_phage	30.8	2.4e-44
WP_015066339.1|972972_974382_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_015066340.1|974629_975328_+	DUF3800 domain-containing protein	NA	Q71TB8	Escherichia_phage	68.6	5.7e-93
WP_015066341.1|975327_975801_+	hypothetical protein	NA	Q71TB7	Escherichia_phage	52.0	1.3e-40
WP_015066342.1|976291_976780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015066343.1|976935_977157_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015066344.1|977234_978233_+	replication initiation factor	NA	NA	NA	NA	NA
WP_015066345.1|978229_979405_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A067ZJC5	Vibrio_phage	27.2	8.5e-25
WP_015066346.1|979474_980212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015066347.1|980434_980791_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_020744983.1|980756_982295_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	43.1	9.5e-109
996197:996245	attR	AAATGGTGGCCCCACCCTGACTTGAACAGGGGACCTGCCGATTATGAGT	NA	NA	NA	NA
>prophage 2
NC_019393	Alteromonas mediterranea DE1, complete sequence	4643844	1020903	1029608	4643844		Streptococcus_phage(16.67%)	6	NA	NA
WP_015066371.1|1020903_1022196_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.0	2.5e-134
WP_012517444.1|1022255_1023887_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.2	3.2e-147
WP_015066372.1|1024023_1026615_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.7	6.4e-33
WP_012517446.1|1026775_1027315_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	45.2	1.0e-25
WP_012517447.1|1027435_1028482_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	62.8	2.5e-116
WP_015066373.1|1028786_1029608_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	1.4e-26
>prophage 3
NC_019393	Alteromonas mediterranea DE1, complete sequence	4643844	1918565	1926921	4643844	integrase	Alteromonas_phage(28.57%)	12	1913190:1913204	1929178:1929192
1913190:1913204	attL	AGCTTCAAGCTTTTT	NA	NA	NA	NA
WP_148290651.1|1918565_1919828_+|integrase	tyrosine-type recombinase/integrase	integrase	F1C5A4	Cronobacter_phage	39.8	1.9e-70
WP_015066947.1|1919810_1920080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015066948.1|1920079_1920343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015066949.1|1920335_1920923_-	hypothetical protein	NA	A0A1J0GWD6	Alteromonas_phage	42.4	6.6e-10
WP_015066950.1|1920919_1921420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015066951.1|1921419_1921653_-	hypothetical protein	NA	R4VVP5	Alteromonas_phage	90.5	6.6e-14
WP_015066952.1|1921649_1922426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015066953.1|1922422_1922611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080597428.1|1922649_1923108_-	hypothetical protein	NA	J7I0T4	Pseudomonas_phage	65.5	3.8e-13
WP_015066955.1|1923869_1924259_-	hypothetical protein	NA	G8C7U4	Escherichia_phage	34.1	4.2e-13
WP_015066956.1|1924258_1926004_-	hypothetical protein	NA	A0A2I7RHL2	Vibrio_phage	38.7	1.5e-70
WP_015066957.1|1926006_1926921_-	RecT protein	NA	A0A2I7RQF1	Vibrio_phage	43.3	2.3e-62
1929178:1929192	attR	AGCTTCAAGCTTTTT	NA	NA	NA	NA
>prophage 4
NC_019393	Alteromonas mediterranea DE1, complete sequence	4643844	1942292	1953621	4643844	terminase	Vibrio_phage(37.5%)	17	NA	NA
WP_015066989.1|1942292_1942862_+	recombination protein ninG	NA	A0A2I7RR86	Vibrio_phage	53.0	1.7e-50
WP_015066990.1|1942883_1943402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015066991.1|1943531_1943750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015066992.1|1943895_1944195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015066993.1|1944381_1944810_+	hypothetical protein	NA	A0A2I7QM25	Vibrio_phage	45.3	8.1e-26
WP_015066994.1|1944818_1945052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015066995.1|1945048_1945564_+	hypothetical protein	NA	A0A2I7RSZ4	Vibrio_phage	41.8	1.1e-13
WP_015066996.1|1945635_1945908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015066997.1|1945910_1946207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015066998.1|1946218_1946773_+|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	57.6	1.8e-46
WP_015066999.1|1946842_1948357_+|terminase	phage terminase large subunit	terminase	A0A2H4J2I1	uncultured_Caudovirales_phage	53.7	4.2e-149
WP_148290653.1|1948347_1950336_+	hypothetical protein	NA	A0A218MLF5	uncultured_virus	24.2	7.6e-34
WP_015067001.1|1950332_1950575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015067002.1|1950711_1951689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015067003.1|1951712_1952645_+	hypothetical protein	NA	F8UBM2	Clostridium_phage	31.1	9.4e-27
WP_015067004.1|1952712_1952934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015067005.1|1952949_1953621_+	hypothetical protein	NA	A0A1B1ITG1	uncultured_Mediterranean_phage	40.3	1.4e-35
>prophage 5
NC_019393	Alteromonas mediterranea DE1, complete sequence	4643844	2192314	2249625	4643844	transposase,protease	Acinetobacter_phage(18.18%)	57	NA	NA
WP_015067135.1|2192314_2194261_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0BXI2	Ostreococcus_lucimarinus_virus	44.4	2.3e-120
WP_015067136.1|2194445_2195270_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_015067137.1|2195279_2196623_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_015067138.1|2196719_2197463_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_015067139.1|2197473_2197920_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_015067140.1|2198280_2200575_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_015067141.1|2200769_2200928_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_015067142.1|2201083_2201539_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_015067143.1|2201749_2203093_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_015067144.1|2203100_2204729_-	hypothetical protein	NA	A0A1V0SBJ0	Catovirus	24.1	1.7e-07
WP_015067145.1|2204880_2205411_+	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
WP_015067146.1|2205431_2206136_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015067147.1|2206248_2207079_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_085929700.1|2207818_2208986_+|transposase	IS3-like element ISAma1 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.6	2.6e-58
WP_020744917.1|2208983_2209124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041702717.1|2209654_2210707_+	DNA topoisomerase IB	NA	A0A0G2Y4T8	Acanthamoeba_polyphaga_mimivirus	29.9	1.8e-29
WP_020743511.1|2211148_2212663_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_015067151.1|2212679_2213789_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	32.3	5.2e-40
WP_015067152.1|2213785_2215033_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.2	1.8e-89
WP_015067153.1|2215163_2216114_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_015067154.1|2216160_2216715_-	HNH endonuclease	NA	A0A1C3NFQ8	Phage_NCTB	39.7	4.6e-05
WP_015067155.1|2217109_2219221_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_012518312.1|2219396_2219690_+	DUF1244 domain-containing protein	NA	NA	NA	NA	NA
WP_015067157.1|2220374_2220587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015067158.1|2220700_2221465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015067159.1|2221576_2222272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015067160.1|2222765_2224019_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_015066045.1|2224047_2224443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015066046.1|2224414_2225980_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	28.9	2.0e-37
WP_015066047.1|2226003_2226339_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	30.8	1.9e-09
WP_015066048.1|2226338_2226623_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_015067161.1|2226808_2227480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015067162.1|2227587_2227818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015067164.1|2228915_2230070_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015067165.1|2230639_2231617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041702719.1|2231732_2232023_+	DUF1244 domain-containing protein	NA	NA	NA	NA	NA
WP_015067167.1|2232560_2232743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015067168.1|2232824_2234333_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_015067169.1|2234761_2235460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015067170.1|2235479_2236238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015067171.1|2236668_2237298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015067172.1|2237429_2238218_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_080597401.1|2238227_2238515_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_085929700.1|2238764_2239932_+|transposase	IS3-like element ISAma1 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.6	2.6e-58
WP_041703271.1|2240142_2240646_+	zf-TFIIB domain-containing protein	NA	NA	NA	NA	NA
WP_015067174.1|2240709_2241159_+	acyltransferase	NA	NA	NA	NA	NA
WP_015067175.1|2241191_2241782_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015067176.1|2241889_2242360_+	hypothetical protein	NA	T1S9H7	Salmonella_phage	71.1	1.3e-11
WP_015067177.1|2242481_2242886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015067179.1|2243191_2243686_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_015067180.1|2243916_2244234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015067181.1|2244267_2244666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015067182.1|2244686_2244911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015067183.1|2244931_2245189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015067184.1|2245266_2246316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015067187.1|2247602_2248235_+	TonB family protein	NA	NA	NA	NA	NA
WP_012518755.1|2248215_2249625_-|transposase	IS66-like element ISAma4 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NC_019393	Alteromonas mediterranea DE1, complete sequence	4643844	4566314	4577357	4643844		Organic_Lake_phycodnavirus(16.67%)	7	NA	NA
WP_012518686.1|4566314_4569572_-	DEAD/DEAH box helicase	NA	F2Y0S4	Organic_Lake_phycodnavirus	22.5	2.8e-09
WP_041702929.1|4569568_4570366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012518684.1|4570384_4572526_-	N-6 DNA methylase	NA	A0A220A2U4	Liberibacter_phage	27.3	5.9e-24
WP_012518683.1|4572546_4574937_-	DEAD/DEAH box helicase	NA	Q5YA94	Bacillus_phage	26.1	1.7e-24
WP_001083515.1|4574938_4575136_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	56.5	1.2e-16
WP_012518682.1|4575385_4577128_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	32.2	9.3e-60
WP_007146785.1|4577114_4577357_-	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	45.3	1.5e-08
