The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_019396	Gluconobacter oxydans H24, complete sequence	3602424	653969	684204	3602424	transposase,protease	uncultured_Mediterranean_phage(25.0%)	23	NA	NA
WP_007283214.1|653969_654281_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	47.6	1.8e-14
WP_015072574.1|654406_656716_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.4	1.7e-178
WP_015072575.1|656765_657230_-	DUF3465 domain-containing protein	NA	NA	NA	NA	NA
WP_015072576.1|657303_658323_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_186004348.1|658440_659829_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_015072578.1|659961_661614_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_015072579.1|661646_662573_-	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_015072580.1|662572_663334_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_015072581.1|663350_664208_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_015072582.1|664210_665359_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_015072583.1|665368_666136_-	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_015072584.1|666132_667275_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_015072585.1|667435_668695_-	glycerate kinase	NA	NA	NA	NA	NA
WP_015072586.1|668739_670311_-	acyl CoA:acetate/3-ketoacid CoA transferase	NA	NA	NA	NA	NA
WP_015072587.1|670399_671992_-	GMC family oxidoreductase N-terminal domain-containing protein	NA	A0A1V0SI18	Klosneuvirus	31.1	8.8e-57
WP_029495794.1|671993_673490_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_007283197.1|673959_674613_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144032616.1|674649_675407_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_186004347.1|675669_676881_-	polysaccharide biosynthesis/export family protein	NA	NA	NA	NA	NA
WP_015072590.1|677089_677524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015072591.1|678045_679413_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	49.4	1.0e-114
WP_015072593.1|680687_681893_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_143829254.1|684015_684204_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_019396	Gluconobacter oxydans H24, complete sequence	3602424	1295593	1307469	3602424		uncultured_Mediterranean_phage(50.0%)	10	NA	NA
WP_015073039.1|1295593_1298587_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	61.2	0.0e+00
WP_016737891.1|1298715_1299297_+	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	59.2	1.6e-37
WP_015073041.1|1299359_1299827_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015073042.1|1299823_1300621_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015073043.1|1300676_1301468_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015073044.1|1301541_1304382_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.2	3.4e-96
WP_015073045.1|1304374_1304893_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	38.8	9.2e-24
WP_007281791.1|1304924_1305410_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	56.3	6.2e-38
WP_015073046.1|1305442_1305823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015073047.1|1306158_1307469_+	AAA family ATPase	NA	A0A219YBX8	Aeromonas_phage	30.2	4.0e-31
>prophage 3
NC_019396	Gluconobacter oxydans H24, complete sequence	3602424	2190791	2247412	3602424	transposase,integrase	Catovirus(40.0%)	49	2185632:2185691	2255688:2255860
2185632:2185691	attL	TCTAGCACTACAGTTGCATTTTGTGTCGTGAGTGAGCGCGGATAGCGCTGGCCTGATGTG	NA	NA	NA	NA
WP_015073692.1|2190791_2192168_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_015073693.1|2192398_2192740_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_015073694.1|2192736_2193033_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080600648.1|2194231_2194573_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_015073698.1|2195246_2197346_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_015073700.1|2198227_2201965_-	glycoside hydrolase family 99-like domain-containing protein	NA	A0A1V0SAH6	Catovirus	33.3	3.7e-05
WP_015073701.1|2202096_2203290_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_007284204.1|2203289_2203889_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_015073704.1|2204347_2205655_+	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	32.8	5.0e-50
WP_015073705.1|2205786_2206452_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_015073706.1|2206701_2207994_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.4e-81
WP_041240822.1|2208516_2208723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015073708.1|2208719_2209310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015073709.1|2209377_2210025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015073710.1|2210021_2210669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015073711.1|2210805_2211204_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_015073712.1|2211292_2211589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010504030.1|2211595_2211820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016738402.1|2211985_2212624_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_007284186.1|2212815_2213058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034881975.1|2213148_2213997_+	FkbM family methyltransferase	NA	A0A222Z098	Streptomyces_phage	31.3	6.2e-09
WP_015073716.1|2214365_2214707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015073717.1|2214710_2215979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015073718.1|2215975_2217061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015073719.1|2217057_2218101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015073720.1|2218097_2218934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144032625.1|2219053_2220931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015073723.1|2221738_2221867_-	phenylacetaldoxime dehydratase family protein	NA	NA	NA	NA	NA
WP_015073724.1|2221854_2222430_-	phenylacetaldoxime dehydratase family protein	NA	NA	NA	NA	NA
WP_015073725.1|2222559_2223588_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_015073726.1|2223703_2224678_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015073727.1|2224874_2225780_+	transporter	NA	NA	NA	NA	NA
WP_015073694.1|2226079_2226376_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015073728.1|2226372_2226714_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_015073729.1|2227145_2227937_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015073730.1|2228038_2228956_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015073731.1|2229166_2230597_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_015073732.1|2230593_2231772_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_015073733.1|2231821_2233375_-	MFS transporter	NA	NA	NA	NA	NA
WP_144032626.1|2234452_2235216_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	31.6	2.4e-12
WP_015073738.1|2235453_2236659_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_015073739.1|2236811_2237894_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_015073740.1|2237984_2238236_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007284633.1|2238263_2239130_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_029495842.1|2239358_2241614_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_016738389.1|2241669_2242110_+	pseudoazurin	NA	NA	NA	NA	NA
WP_016738388.1|2242192_2242519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016738387.1|2242747_2243896_-	class C beta-lactamase	NA	NA	NA	NA	NA
WP_015073748.1|2246206_2247412_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
2255688:2255860	attR	CACATCAGGCCAGCGCTATCCGCGCTCACTCACGACACAAAATGCAACTGTAGTGCTAGATCCAAGTTTCAGGGGTATGCCAGATATGTAGGCGTAAACGGACCTGCTGCTTACGCCTACATGTCAGACAAATCAAGACTAATAAGCTGCGCTGAAAAGCGGACGTCACGGCT	NA	NA	NA	NA
>prophage 4
NC_019396	Gluconobacter oxydans H24, complete sequence	3602424	2693237	2702024	3602424		Pseudomonas_phage(33.33%)	9	NA	NA
WP_015074090.1|2693237_2695442_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.0	4.5e-160
WP_015074091.1|2695438_2696140_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_015074092.1|2696136_2696526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007281914.1|2696522_2696765_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_015074093.1|2696761_2697526_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	42.6	6.5e-42
WP_015074094.1|2697669_2699001_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	34.4	5.1e-18
WP_016738053.1|2699082_2699694_+	YjbE family putative metal transport protein	NA	A0A0S4KZH7	Pseudomonas_phage	35.2	2.3e-13
WP_016738052.1|2699674_2701552_+	transglycosylase SLT domain-containing protein	NA	I1VXB7	Halocynthia_phage	33.3	1.0e-08
WP_015074097.1|2701538_2702024_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	44.6	7.3e-23
>prophage 5
NC_019396	Gluconobacter oxydans H24, complete sequence	3602424	3170384	3213153	3602424	transposase	Bacillus_virus(50.0%)	30	NA	NA
WP_015074447.1|3170384_3171332_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_015074448.1|3171473_3172106_-	2-hydroxychromene-2-carboxylate isomerase	NA	NA	NA	NA	NA
WP_015074449.1|3172309_3174697_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_015074450.1|3174701_3175688_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015074451.1|3175671_3177159_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015074452.1|3177155_3178160_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_015074453.1|3178141_3179230_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_015074454.1|3179222_3180329_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.6	8.9e-24
WP_015074455.1|3180325_3181177_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015074456.1|3181197_3181971_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015074457.1|3181975_3183466_+	carboxylesterase/lipase family protein	NA	A0A0B5J865	Pandoravirus	39.2	2.3e-14
WP_144032629.1|3184163_3184920_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_015074462.1|3186379_3187459_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016738271.1|3187747_3188410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015074464.1|3188449_3189451_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_015074465.1|3189657_3193257_-	urea carboxylase	NA	NA	NA	NA	NA
WP_015074467.1|3193860_3195381_+	amino acid permease	NA	NA	NA	NA	NA
WP_015074468.1|3195430_3196168_+	urea carboxylase-associated family protein	NA	NA	NA	NA	NA
WP_015074469.1|3196180_3196816_+	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_015074470.1|3196843_3198670_+	allophanate hydrolase	NA	NA	NA	NA	NA
WP_186004352.1|3198630_3199863_+	response regulator	NA	NA	NA	NA	NA
WP_015074472.1|3199869_3201540_+	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_015074473.1|3201619_3202036_+	DUF1636 domain-containing protein	NA	NA	NA	NA	NA
WP_015074474.1|3202048_3203671_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_143829257.1|3203739_3204192_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015074476.1|3204423_3206934_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_015074477.1|3207021_3207951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015074478.1|3208085_3209165_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_015072662.1|3209420_3210257_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_015074481.1|3212205_3213153_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NC_019397	Gluconobacter oxydans H24 plasmid unnamed, complete sequence	213808	4971	53387	213808	transposase,integrase	Paenibacillus_phage(20.0%)	50	9629:9644	41093:41108
WP_144032633.1|4971_5728_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	38.8	3.8e-10
WP_015074838.1|5743_5917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015074839.1|5913_7917_+	FUSC family protein	NA	NA	NA	NA	NA
WP_015074840.1|7918_8218_+	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_015074842.1|8917_9514_-|transposase	transposase	transposase	NA	NA	NA	NA
9629:9644	attL	AGCGCGGCCGGAACGG	NA	NA	NA	NA
WP_016738651.1|12558_13527_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_029495917.1|13625_14549_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016738649.1|14636_15092_-	hypothetical protein	NA	A0A142UM78	Mycobacterium_phage	42.9	1.5e-14
WP_015074850.1|15207_15744_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_015074851.1|15895_16894_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_015074852.1|16897_17683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015074853.1|17675_18434_+	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_016738647.1|18996_19920_+	plasmid replication initiator	NA	NA	NA	NA	NA
WP_015074855.1|20011_20332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015074857.1|20693_21716_-	alpha/beta hydrolase	NA	J3IZC7	Acanthamoeba_polyphaga_lentillevirus	39.6	9.0e-55
WP_015074858.1|21854_22349_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003618986.1|22768_23596_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_003618982.1|23620_24022_-	VOC family protein	NA	NA	NA	NA	NA
WP_016738644.1|24081_25191_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A2L2DIY2	Acanthamoeba_polyphaga_mimivirus	24.7	5.6e-10
WP_015074861.1|25232_25508_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_015074864.1|25893_26781_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016737605.1|26833_27166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015074865.1|27281_28202_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016737604.1|28233_28980_-	SDR family oxidoreductase	NA	A0A2P0VP75	Tetraselmis_virus	27.9	1.1e-06
WP_015074867.1|29129_30044_+	helix-turn-helix transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	27.3	2.5e-08
WP_015074868.1|30063_30546_-	DUF2938 family protein	NA	NA	NA	NA	NA
WP_080578982.1|30649_31102_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_041240858.1|31178_32138_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_015074871.1|32262_33129_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_015074872.1|33244_33607_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015074873.1|33993_34401_-	VOC family protein	NA	NA	NA	NA	NA
WP_015074874.1|34397_35024_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_015074875.1|35139_36048_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_186004321.1|36411_37674_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_015074878.1|38646_39165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100225173.1|39190_39947_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	37.2	5.0e-10
WP_015074881.1|40005_40173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041240859.1|43494_43728_-	hypothetical protein	NA	NA	NA	NA	NA
41093:41108	attR	CCGTTCCGGCCGCGCT	NA	NA	NA	NA
WP_080600659.1|43727_45233_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_015074886.1|45141_45933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015074887.1|46115_46430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029495913.1|46426_47116_-	ParA family protein	NA	A0A0A8IL09	Aurantimonas_phage	53.8	3.4e-58
WP_015074889.1|47278_47608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015074890.1|47718_48048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015074890.1|48158_48488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015074890.1|48598_48928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041240861.1|49327_49705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015074895.1|50777_51464_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_015074896.1|51460_51823_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	51.9	2.0e-25
WP_041240863.1|51875_53387_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	42.6	1.2e-103
>prophage 2
NC_019397	Gluconobacter oxydans H24 plasmid unnamed, complete sequence	213808	138618	158989	213808	transposase,integrase	Shigella_phage(33.33%)	19	129156:129169	144020:144033
129156:129169	attL	TCGTCAGGAAAAGG	NA	NA	NA	NA
WP_080578973.1|138618_139443_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_186004321.1|139550_140813_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_015075000.1|141857_142847_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_015075002.1|143117_144221_+	Fic family protein	NA	NA	NA	NA	NA
144020:144033	attR	TCGTCAGGAAAAGG	NA	NA	NA	NA
WP_015075003.1|144272_145643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016738512.1|145756_147073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015075006.1|147266_147527_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_015075008.1|148049_149129_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_015075009.1|149276_149804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016738508.1|149796_151101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015075013.1|151720_152191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100225176.1|152212_153399_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	32.5	4.4e-29
WP_015075016.1|153512_154391_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_015075017.1|154405_155044_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015075018.1|155174_155450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015075020.1|156064_156835_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.1	5.1e-10
WP_015075021.1|156902_157922_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_029495881.1|157911_158415_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016738505.1|158665_158989_+|transposase	transposase	transposase	B6ETC4	Enterobacteria_phage	52.0	1.0e-20
