The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_019425	Carnobacterium maltaromaticum LMA28, complete genome	3650416	1601529	1706708	3650416	integrase,transposase,tRNA,holin,protease	Staphylococcus_phage(17.86%)	101	1611054:1611071	1686996:1687017
WP_010051222.1|1601529_1602828_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.6	3.8e-58
WP_015076275.1|1602937_1603651_+	DnaD domain-containing protein	NA	A0A0N7AE27	Bacillus_phage	40.4	1.7e-20
WP_015076276.1|1603671_1604316_+	endonuclease III	NA	NA	NA	NA	NA
WP_035065957.1|1604382_1607016_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_010051228.1|1607042_1607663_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.3	6.7e-21
WP_015076278.1|1607733_1608270_+	DUF1273 domain-containing protein	NA	A0A1P8CWY2	Bacillus_phage	26.9	3.3e-08
WP_010051232.1|1608369_1608699_+	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_015076279.1|1609334_1610489_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_015076280.1|1610491_1612000_+	carboxypeptidase M32	NA	NA	NA	NA	NA
1611054:1611071	attL	AAAAAATTAACGAAAATG	NA	NA	NA	NA
WP_015076281.1|1612070_1612424_-	hypothetical protein	NA	NA	NA	NA	NA
1611054:1611071	attL	AAAAAATTAACGAAAATG	NA	NA	NA	NA
WP_010051240.1|1612519_1612948_-	ribonuclease HI family protein	NA	NA	NA	NA	NA
WP_010052955.1|1613201_1613696_+	EbsA family protein	NA	NA	NA	NA	NA
WP_015076282.1|1613845_1614415_+	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_015076283.1|1614506_1614716_-	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	50.8	4.0e-10
WP_015076284.1|1614947_1616621_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_015076285.1|1616795_1617548_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015076286.1|1617544_1618150_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015076287.1|1618142_1619147_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_015076290.1|1619938_1621840_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.5	3.9e-51
WP_015076291.1|1621854_1622802_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.3	4.8e-119
WP_015076292.1|1622828_1623317_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	47.1	2.9e-35
WP_015076293.1|1623405_1624065_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_010052936.1|1624335_1625178_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	42.2	1.6e-20
WP_015076294.1|1625259_1626147_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_015076295.1|1626179_1626821_+	YpmS family protein	NA	NA	NA	NA	NA
WP_010052932.1|1626829_1627351_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_015076296.1|1627350_1627572_+	YozE family protein	NA	NA	NA	NA	NA
WP_015076297.1|1627608_1628319_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_015076298.1|1628334_1629819_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.7	1.6e-20
WP_010052926.1|1630038_1630584_+	signal peptidase I	NA	NA	NA	NA	NA
WP_010052923.1|1630642_1631308_+	signal peptidase I	NA	NA	NA	NA	NA
WP_010052921.1|1631377_1632247_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_015076299.1|1632246_1633032_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	40.4	8.8e-26
WP_016356430.1|1633157_1634027_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	35.5	2.6e-26
WP_010052918.1|1634205_1636284_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	36.3	4.3e-104
WP_015076302.1|1636533_1637853_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_010052916.1|1637918_1638818_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	29.4	2.3e-30
WP_010052913.1|1639110_1639650_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_015076303.1|1639668_1641087_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	27.0	7.1e-42
WP_010052909.1|1641109_1641919_+	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_010052908.1|1642102_1642981_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_010052907.1|1643051_1643666_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_010052906.1|1643995_1646011_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	43.4	4.7e-124
WP_015076305.1|1646000_1648472_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.5	1.6e-97
WP_010052904.1|1648914_1651161_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	9.5e-166
WP_010052902.1|1651227_1651986_+	pyruvate formate lyase-activating protein	NA	NA	NA	NA	NA
WP_015076310.1|1653067_1653994_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_015076311.1|1654150_1655902_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	29.2	2.6e-62
WP_015076312.1|1655903_1656638_+	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	27.1	3.7e-10
WP_015076313.1|1656815_1657259_+|holin	antiholin-like murein hydrolase modulator LrgA	holin	NA	NA	NA	NA
WP_015076314.1|1657260_1657944_+|holin	antiholin-like protein LrgB	holin	NA	NA	NA	NA
WP_035063932.1|1658068_1659061_-	choloylglycine hydrolase family protein	NA	A7IWP6	Paramecium_bursaria_Chlorella_virus	31.9	3.6e-32
WP_080639143.1|1659938_1660103_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	52.0	7.9e-06
WP_080639144.1|1660087_1660258_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000195429.1|1661218_1662391_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_015076317.1|1662489_1663251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076318.1|1663280_1664363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076319.1|1664334_1665348_-	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_015076320.1|1665488_1666190_-	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_015076321.1|1666217_1666856_-	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_035063920.1|1666881_1667532_-	WxL domain-containing protein	NA	NA	NA	NA	NA
1667512:1667529	attR	CATTTTCGTTAATTTTTT	NA	NA	NA	NA
WP_015076323.1|1667449_1667881_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
1667512:1667529	attR	CATTTTCGTTAATTTTTT	NA	NA	NA	NA
WP_016356432.1|1668409_1669900_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041555123.1|1670855_1671749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016356433.1|1672111_1672738_-	V-type ATP synthase subunit D	NA	NA	NA	NA	NA
WP_015076327.1|1672745_1674122_-	V-type ATP synthase subunit B	NA	NA	NA	NA	NA
WP_015076328.1|1674114_1675899_-	V-type ATP synthase subunit A	NA	NA	NA	NA	NA
WP_015076329.1|1675914_1676226_-	V-type ATP synthase subunit F	NA	NA	NA	NA	NA
WP_015076330.1|1676215_1677220_-	V-type ATPase subunit	NA	NA	NA	NA	NA
WP_015076331.1|1677237_1677822_-	V-type ATP synthase subunit E	NA	NA	NA	NA	NA
WP_015076332.1|1677853_1678330_-	V-type ATP synthase subunit K	NA	NA	NA	NA	NA
WP_016356434.1|1678387_1680358_-	V-type ATP synthase subunit I	NA	NA	NA	NA	NA
WP_016356435.1|1680344_1680671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080639147.1|1680992_1681640_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015075518.1|1682232_1683552_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	83.4	1.5e-211
WP_015076337.1|1683750_1685211_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	45.3	6.5e-107
WP_016356436.1|1685234_1685645_-	universal stress protein	NA	NA	NA	NA	NA
WP_015076339.1|1685868_1686165_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_119906464.1|1686251_1686335_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080639148.1|1686568_1686859_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0C5AEA5	Paenibacillus_phage	45.6	1.9e-10
WP_080639176.1|1686859_1686940_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_015076341.1|1687084_1688761_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015076342.1|1688757_1689831_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_015076343.1|1689909_1690275_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	50.0	1.3e-24
WP_035063906.1|1690864_1691191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010052820.1|1691219_1691735_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015076345.1|1691724_1692204_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015076348.1|1693801_1694182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015076349.1|1694239_1694437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076352.1|1695296_1696190_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015076353.1|1696567_1697932_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_015076354.1|1697974_1698826_-	aminoglycoside 6-adenylyltransferase	NA	NA	NA	NA	NA
WP_010053859.1|1699043_1699625_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_015076356.1|1699735_1700326_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_015076357.1|1700444_1701359_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_010053856.1|1701641_1702034_+	RidA family protein	NA	NA	NA	NA	NA
WP_015076358.1|1702101_1702662_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_016356438.1|1702702_1703386_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_010053850.1|1703586_1704108_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_015076360.1|1704190_1705120_-	LCP family protein	NA	NA	NA	NA	NA
WP_015076361.1|1705388_1706708_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	61.8	1.1e-156
>prophage 2
NC_019425	Carnobacterium maltaromaticum LMA28, complete genome	3650416	1841254	1894719	3650416	tail,plate,integrase,terminase,transposase,tRNA,holin	Listeria_phage(44.44%)	59	1846402:1846418	1878660:1878676
WP_010053889.1|1841254_1841701_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_010053887.1|1841764_1843975_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	32.8	7.2e-09
WP_015076470.1|1844370_1845126_-	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_015076471.1|1845135_1847688_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
1846402:1846418	attL	TGCAATTAATTCTGTAA	NA	NA	NA	NA
WP_016356455.1|1848209_1849346_-	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	42.4	5.4e-16
WP_010053882.1|1849535_1850207_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_010053880.1|1850288_1851053_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_010053875.1|1851053_1852004_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_015076475.1|1852276_1852768_-	DUF3013 family protein	NA	NA	NA	NA	NA
WP_015076476.1|1852784_1853399_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_010053870.1|1853692_1854007_+	DUF898 family protein	NA	S5MNN8	Brevibacillus_phage	71.2	4.7e-15
WP_016356456.1|1854094_1855261_-	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_015076479.1|1855261_1855702_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_010053866.1|1855717_1857796_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_015076480.1|1857874_1859305_-	PTS mannitol transporter subunit IICB	NA	NA	NA	NA	NA
WP_119907037.1|1859850_1860348_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_015076482.1|1860412_1861429_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_015076483.1|1861569_1862031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010053137.1|1862233_1862440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076484.1|1862582_1863704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015076485.1|1863793_1864207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016356458.1|1864529_1865258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015076488.1|1865336_1865558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076489.1|1865554_1865728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076490.1|1865930_1866353_+	helix-turn-helix transcriptional regulator	NA	A0A0B5CYL9	Listeria_phage	51.4	5.0e-28
WP_015076492.1|1866872_1867523_+	DUF308 domain-containing protein	NA	A0A2D1GPN7	Lactobacillus_phage	51.5	1.0e-19
WP_015076493.1|1867668_1868811_+|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	54.5	5.8e-119
WP_015076494.1|1869168_1869510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076495.1|1869844_1870327_-	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_015076496.1|1870520_1871648_-	SH3 domain-containing protein	NA	A0A060AFE7	Listeria_phage	41.8	1.9e-61
WP_015076497.1|1871700_1871961_-|holin	phage holin	holin	J7KDR1	Streptococcus_phage	54.2	1.1e-17
WP_015076498.1|1871979_1872210_-	hemolysin XhlA family protein	NA	A0A1P8BKD4	Lactococcus_phage	48.6	7.2e-13
WP_015076499.1|1872235_1873636_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_051120428.1|1873650_1874289_-	hypothetical protein	NA	A0A1L2JZ80	Aeribacillus_phage	37.9	1.3e-35
WP_015076501.1|1874278_1875457_-|plate	baseplate J/gp47 family protein	plate	A0A2H4J8D2	uncultured_Caudovirales_phage	40.8	1.9e-77
WP_015076502.1|1875449_1875818_-	hypothetical protein	NA	A0A2H4J4S8	uncultured_Caudovirales_phage	40.2	1.4e-13
WP_051120429.1|1875817_1876156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076504.1|1876152_1876956_-	hypothetical protein	NA	E5DV61	Deep-sea_thermophilic_phage	46.4	7.5e-57
WP_041555016.1|1876948_1877284_-	hypothetical protein	NA	A0A2H4J6L1	uncultured_Caudovirales_phage	49.1	1.0e-23
WP_015076506.1|1877307_1877862_-	hypothetical protein	NA	A0A1L2JY61	Aeribacillus_phage	39.5	7.1e-30
WP_016356460.1|1877864_1882541_-	transglycosylase SLT domain protein	NA	A8ATH6	Listeria_phage	37.2	3.2e-147
1878660:1878676	attR	TGCAATTAATTCTGTAA	NA	NA	NA	NA
WP_015076509.1|1882542_1882734_-	hypothetical protein	NA	A8ATH5	Listeria_phage	59.7	6.0e-13
WP_015076510.1|1882714_1883050_-	hypothetical protein	NA	D6PSY5	Lactobacillus_phage	47.3	3.6e-21
WP_015076511.1|1883104_1883503_-	hypothetical protein	NA	A8ATH3	Listeria_phage	69.8	1.7e-46
WP_015076512.1|1883522_1884551_-	DUF3383 family protein	NA	A8ATH2	Listeria_phage	61.4	4.3e-113
WP_015076513.1|1884565_1885018_-	hypothetical protein	NA	A8ATH1	Listeria_phage	54.1	7.8e-35
WP_015076514.1|1885001_1885364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076515.1|1885367_1885958_-	hypothetical protein	NA	A8ATG9	Listeria_phage	61.9	3.5e-59
WP_016356461.1|1885957_1886302_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_015076518.1|1886314_1886689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076519.1|1886708_1887590_-	DUF2184 domain-containing protein	NA	A8ATG6	Listeria_phage	51.7	3.1e-80
WP_015076520.1|1887607_1888066_-	hypothetical protein	NA	A8ATG5	Listeria_phage	54.2	1.5e-33
WP_016356462.1|1888068_1889175_-	DUF2213 domain-containing protein	NA	A8ATG4	Listeria_phage	53.4	8.1e-86
WP_015076524.1|1889188_1889446_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015076525.1|1889504_1889684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015075518.1|1890880_1892200_-|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	83.4	1.5e-211
WP_041555017.1|1892350_1892617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076528.1|1892609_1893842_-	DUF1073 domain-containing protein	NA	A8ATG0	Listeria_phage	62.5	5.5e-91
WP_015076529.1|1893984_1894719_-|terminase	terminase small subunit	terminase	NA	NA	NA	NA
>prophage 3
NC_019425	Carnobacterium maltaromaticum LMA28, complete genome	3650416	1900260	1920208	3650416	integrase,transposase	Listeria_phage(25.0%)	29	1898033:1898053	1920611:1920631
1898033:1898053	attL	TCCTTCTAATTCAGCTAATGT	NA	NA	NA	NA
WP_015076538.1|1900260_1900497_-	hypothetical protein	NA	L0L8J8	Bacillus_phage	47.5	1.2e-07
WP_015076539.1|1900499_1901057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076540.1|1901059_1901575_-	hypothetical protein	NA	C9E2P0	Enterococcus_phage	47.0	4.0e-35
WP_144060851.1|1901576_1901789_-	hypothetical protein	NA	Q8W5W9	Listeria_phage	73.5	1.2e-22
WP_015076542.1|1901857_1902112_-	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	65.3	2.6e-19
WP_015076543.1|1902108_1902324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076544.1|1902316_1902544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076545.1|1902531_1902765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076546.1|1902761_1903568_-	DNA adenine methylase	NA	Q8W5X3	Listeria_phage	48.5	1.9e-68
WP_015076547.1|1903564_1903942_-	hypothetical protein	NA	A0A1Q1PW02	Staphylococcus_phage	36.4	6.7e-08
WP_015076548.1|1903946_1904198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076549.1|1904197_1905004_-	DnaD domain protein	NA	A0A1B0Y2R2	Lactobacillus_phage	38.9	1.9e-20
WP_016356465.1|1905022_1905718_-	MBL fold metallo-hydrolase	NA	A0A1L2JY21	Aeribacillus_phage	51.5	1.9e-64
WP_015076552.1|1906837_1907104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076553.1|1907103_1909131_-	AAA family ATPase	NA	A0A0A0RNI0	Bacillus_phage	30.4	7.2e-72
WP_015076554.1|1909130_1909340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076555.1|1909547_1909694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076557.1|1909823_1910066_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_015076558.1|1910083_1910605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076559.1|1910601_1910838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041555018.1|1910903_1911101_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015076560.1|1911262_1911652_+	helix-turn-helix domain-containing protein	NA	A6XML9	Bacillus_virus	37.3	2.0e-10
WP_015075518.1|1911888_1913208_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	83.4	1.5e-211
WP_051120430.1|1913397_1913811_+	hypothetical protein	NA	A0A059T7S0	Listeria_phage	38.3	3.0e-17
WP_015076562.1|1913928_1915005_+	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	56.5	1.6e-107
WP_015076563.1|1915062_1915608_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_015076564.1|1915760_1916909_+|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	47.8	1.2e-100
WP_010053131.1|1916998_1918834_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	23.7	1.1e-18
WP_016356467.1|1919029_1920208_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.3	1.7e-25
1920611:1920631	attR	TCCTTCTAATTCAGCTAATGT	NA	NA	NA	NA
>prophage 4
NC_019425	Carnobacterium maltaromaticum LMA28, complete genome	3650416	2017860	2069007	3650416	tRNA,tail,transposase,protease	Bacillus_phage(16.67%)	53	NA	NA
WP_016356482.1|2017860_2019249_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_010052977.1|2019382_2019970_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_015076627.1|2020136_2021207_-	phage structural domain-containing protein	NA	NA	NA	NA	NA
WP_015076628.1|2021214_2022318_-	siphovirus ReqiPepy6 Gp37-like family protein	NA	H7BUP3	unidentified_phage	27.1	2.0e-28
WP_016356483.1|2022320_2023265_-|tail	phage tail family protein	tail	A0A1P8BL47	Lactococcus_phage	26.4	4.0e-17
WP_015076631.1|2023264_2024857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010052968.1|2024878_2025112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010052967.1|2025195_2025630_-|tail	tail assembly chaperone	tail	NA	NA	NA	NA
WP_015076633.1|2025709_2026234_-|tail	phage major tail protein, TP901-1 family	tail	G8FV40	Pediococcus_virus	41.3	9.0e-27
WP_015076634.1|2026568_2026913_-	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_010053615.1|2027144_2028389_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	60.8	5.5e-139
WP_010053614.1|2028644_2029757_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.0	3.2e-37
WP_010053613.1|2030091_2031372_-	trigger factor	NA	NA	NA	NA	NA
WP_119907038.1|2031569_2032319_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015076638.1|2032745_2032979_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_015076639.1|2032975_2034979_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_010053605.1|2035091_2035277_+	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_010053604.1|2035417_2035711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080569772.1|2035805_2036597_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_010053364.1|2036616_2037468_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_010053362.1|2037501_2038866_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_010053359.1|2038870_2039302_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_010053358.1|2039327_2039798_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_010053357.1|2039797_2041042_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_010053356.1|2041059_2041797_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.5	3.6e-21
WP_010053355.1|2041836_2042772_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_015076640.1|2042938_2043892_-	enoyl-[acyl-carrier-protein] reductase FabK	NA	NA	NA	NA	NA
WP_010053351.1|2043916_2044147_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_015076641.1|2044213_2045191_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_010053347.1|2045196_2045658_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010053346.1|2045958_2046306_-	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_016356485.1|2046666_2047338_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	49.3	1.4e-53
WP_016356486.1|2047334_2048723_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	37.8	2.5e-44
WP_015076646.1|2048793_2049882_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010053342.1|2049881_2050556_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.7	1.7e-38
WP_015076647.1|2050653_2052558_-	mutS domain V family protein	NA	F2Y0V3	Organic_Lake_phycodnavirus	26.2	2.4e-16
WP_010053339.1|2053893_2054106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010053338.1|2054157_2054634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076648.1|2054845_2055739_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010053336.1|2056047_2057382_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_010053334.1|2057464_2057857_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016356487.1|2058127_2059378_-	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_015076650.1|2059374_2060622_-	GTPase HflX	NA	NA	NA	NA	NA
WP_015076651.1|2060638_2061589_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_015076652.1|2061590_2062331_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	39.5	5.0e-15
WP_015076653.1|2062519_2062750_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_010053324.1|2062830_2063226_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_015076654.1|2063320_2064439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076657.1|2065576_2065780_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_010053315.1|2065798_2066509_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_010053314.1|2066586_2067120_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_010053313.1|2067227_2067377_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_015075518.1|2067687_2069007_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	83.4	1.5e-211
>prophage 5
NC_019425	Carnobacterium maltaromaticum LMA28, complete genome	3650416	2098717	2179424	3650416	portal,tail,terminase,capsid,tRNA,holin	Lactococcus_phage(25.71%)	89	NA	NA
WP_010054263.1|2098717_2099863_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	41.9	4.6e-84
WP_119907039.1|2099894_2100497_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015076674.1|2101170_2102202_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016356490.1|2102218_2103229_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	31.1	1.6e-08
WP_010054255.1|2103270_2103891_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_051120432.1|2103998_2105159_-	MFS transporter	NA	NA	NA	NA	NA
WP_015076680.1|2105898_2108175_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_015076681.1|2108432_2108876_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010054251.1|2108947_2109475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076682.1|2109514_2109850_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015076683.1|2110026_2110605_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_015076684.1|2110628_2112752_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	43.6	6.9e-57
WP_015076685.1|2112818_2115440_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	24.7	2.6e-37
WP_010054244.1|2115460_2115850_-	YlbF family regulator	NA	NA	NA	NA	NA
WP_010054242.1|2115846_2116656_-	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_010054241.1|2116839_2118405_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_015076688.1|2118794_2119949_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.7	1.6e-124
WP_015076691.1|2120254_2121514_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_015076692.1|2121567_2122962_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_010054237.1|2123073_2123652_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_015076693.1|2123789_2125865_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_010054235.1|2125944_2126829_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015076695.1|2126926_2127652_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_015076696.1|2127648_2128950_-	insulinase family protein	NA	M1NN74	Moumouvirus	21.0	3.0e-15
WP_015076697.1|2128951_2130208_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	33.5	2.1e-61
WP_010054229.1|2130386_2131349_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015076698.1|2131350_2132448_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010054227.1|2132437_2134006_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	2.0e-21
WP_015076699.1|2134281_2134662_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_010054225.1|2134708_2135761_-	BMP family protein	NA	A0A0A7DN02	Lactobacillus_phage	40.6	3.9e-61
WP_016356491.1|2136022_2138362_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	52.8	2.4e-87
WP_015076702.1|2138519_2139344_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_010054216.1|2141596_2141911_-	DUF1033 family protein	NA	NA	NA	NA	NA
WP_010054214.1|2142049_2142325_+	acylphosphatase	NA	NA	NA	NA	NA
WP_035063736.1|2142390_2143305_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_119906478.1|2143370_2144885_-	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	30.5	3.2e-16
WP_010054209.1|2144881_2145568_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	6.7e-30
WP_015076709.1|2146280_2146577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015076713.1|2147959_2148220_-|holin	phage holin	holin	J7KDR1	Streptococcus_phage	54.2	6.5e-18
WP_015076714.1|2148238_2148469_-	hemolysin XhlA family protein	NA	A0A1P8BKD4	Lactococcus_phage	47.9	2.1e-12
WP_015076715.1|2148504_2148657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076716.1|2148649_2148991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076717.1|2149014_2149440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076718.1|2149479_2150172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076719.1|2150176_2152105_-|tail	phage tail protein	tail	A0A1B2APX2	Phage_Wrath	47.7	2.0e-92
WP_015076720.1|2152104_2152830_-|tail	phage tail family protein	tail	A0A1B2APY0	Phage_Wrath	42.8	3.9e-52
WP_015076721.1|2152826_2156012_-	hypothetical protein	NA	A0A141E0M7	Streptococcus_phage	35.2	2.6e-36
WP_016356495.1|2156012_2156663_-	bacteriophage Gp15 family protein	NA	A0A1B1IMN4	Lactococcus_phage	33.2	3.8e-27
WP_015076723.1|2156669_2157128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076724.1|2157192_2157477_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_015076725.1|2157442_2157892_-	hypothetical protein	NA	A5GYM5	Lactococcus_phage	55.3	3.3e-38
WP_015076726.1|2157909_2158332_-|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_015076727.1|2158343_2158694_-	hypothetical protein	NA	A5GYM3	Lactococcus_phage	50.4	9.0e-23
WP_015076728.1|2158690_2159032_-|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_015076729.1|2159021_2159426_-	hypothetical protein	NA	A0A2I7QIP5	Bacillus_phage	41.3	2.1e-15
WP_016356496.1|2160655_2161726_-	hypothetical protein	NA	A5GYL8	Lactococcus_phage	54.6	3.5e-94
WP_015076733.1|2161718_2161913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016356497.1|2161915_2162764_-	phage Mu F like family protein	NA	A5GYL7	Lactococcus_phage	38.1	2.3e-48
WP_016356498.1|2162768_2164280_-|portal	phage portal protein	portal	A0A1B1IM25	Lactococcus_phage	55.3	1.6e-153
WP_041555157.1|2164290_2165724_-|terminase	phage terminase large subunit	terminase	A5GYP8	Lactococcus_phage	62.0	1.4e-175
WP_015076738.1|2165707_2166442_-|terminase	terminase small subunit	terminase	NA	NA	NA	NA
WP_015076739.1|2166501_2166750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041555019.1|2166851_2167187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076740.1|2167426_2168023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076741.1|2168074_2168686_-	sigma-70, region 4 family protein	NA	R9TMH4	Paenibacillus_phage	31.8	6.2e-11
WP_015076742.1|2168776_2168956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076743.1|2169018_2169201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076744.1|2169212_2169377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076745.1|2169378_2169627_-	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	61.3	6.8e-17
WP_015076746.1|2169623_2169839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076747.1|2169896_2170067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076748.1|2170054_2170288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076749.1|2170284_2170707_-	yopX family protein	NA	D2IZL0	Enterococcus_phage	62.3	5.6e-19
WP_015076750.1|2170693_2170900_-	hypothetical protein	NA	Q9AZ73	Lactococcus_phage	56.2	2.1e-08
WP_080639152.1|2170906_2171185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076752.1|2171268_2171730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076753.1|2171719_2172592_-	DnaD domain protein	NA	B4XYS6	Lactobacillus_phage	32.1	7.5e-10
WP_015076754.1|2172605_2173298_-	hypothetical protein	NA	A8ATK9	Listeria_phage	55.4	4.8e-68
WP_015076755.1|2173300_2174035_-	phage recombination protein Bet	NA	A8ATK8	Listeria_phage	66.2	5.4e-70
WP_015076756.1|2174034_2176053_-	AAA family ATPase	NA	D7RWF8	Brochothrix_phage	30.9	1.9e-80
WP_015076757.1|2176258_2176405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076759.1|2176531_2176831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076760.1|2176836_2177364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076761.1|2177360_2177597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041555021.1|2177673_2177901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015076762.1|2177892_2178117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076763.1|2178178_2178409_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015076764.1|2178570_2178993_+	helix-turn-helix transcriptional regulator	NA	A0A0B5CYL9	Listeria_phage	47.8	8.0e-26
WP_015076765.1|2179001_2179424_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	54.1	2.8e-34
>prophage 6
NC_019425	Carnobacterium maltaromaticum LMA28, complete genome	3650416	2569073	2629242	3650416	portal,tail,terminase,transposase,capsid	Bacillus_phage(23.53%)	72	NA	NA
WP_015077068.1|2569073_2570393_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	83.1	1.3e-210
WP_016356561.1|2570580_2571804_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	39.6	3.1e-78
WP_016356562.1|2571817_2573245_-	polysaccharide biosynthesis C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_016356563.1|2573246_2574404_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_144060853.1|2574396_2575572_-	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
WP_144060839.1|2575680_2576172_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	40.3	2.7e-09
WP_015075648.1|2576341_2577514_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.5e-122
WP_015077079.1|2579260_2580199_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_015077080.1|2580462_2581218_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_015077081.1|2581503_2581944_+	flavodoxin	NA	NA	NA	NA	NA
WP_016356565.1|2582020_2582683_-	DUF1361 domain-containing protein	NA	NA	NA	NA	NA
WP_015077083.1|2582884_2583448_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015077084.1|2583513_2584074_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015077085.1|2584369_2585608_+	aminopeptidase	NA	NA	NA	NA	NA
WP_015077086.1|2585806_2586742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015077087.1|2587120_2587531_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_144060840.1|2587531_2587693_-	DUF3188 domain-containing protein	NA	NA	NA	NA	NA
WP_010051683.1|2587723_2587951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077089.1|2588113_2588443_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_010051681.1|2588475_2588793_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_010051679.1|2589060_2589387_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_010051677.1|2589459_2589777_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_010051676.1|2589973_2591224_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_016356566.1|2594263_2595553_-	DEAD/DEAH box helicase	NA	E3T5E1	Cafeteria_roenbergensis_virus	32.9	8.4e-42
WP_015077093.1|2596059_2597064_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_015077094.1|2597090_2597795_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_015077095.1|2597902_2598259_-	YxeA family protein	NA	NA	NA	NA	NA
WP_035065656.1|2598355_2599198_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_015077098.1|2599456_2600245_-	glycosyl hydrolase 25 family protein	NA	NA	NA	NA	NA
WP_015077099.1|2600765_2601926_-	SH3 domain-containing protein	NA	A0A060AFE7	Listeria_phage	41.3	3.6e-60
WP_015077101.1|2602258_2602489_-	hemolysin XhlA family protein	NA	A0A1P8BKD4	Lactococcus_phage	46.5	6.1e-12
WP_015076715.1|2602524_2602677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076716.1|2602669_2603011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076717.1|2603034_2603460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015076718.1|2603499_2604192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077102.1|2604196_2606125_-|tail	phage tail protein	tail	A0A1B2APX2	Phage_Wrath	48.0	6.0e-92
WP_041555028.1|2606124_2606847_-	hypothetical protein	NA	A0A1B2APY0	Phage_Wrath	41.5	1.5e-51
WP_015077104.1|2606843_2609471_-	hypothetical protein	NA	E8ZDK0	Streptococcus_phage	32.7	1.3e-09
WP_015077105.1|2609473_2610055_-	bacteriophage Gp15 family protein	NA	A0A059T7W8	Listeria_phage	34.7	3.4e-27
WP_015077106.1|2610064_2610496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077107.1|2610552_2611032_-	hypothetical protein	NA	A0A1S5SEC5	Streptococcus_phage	63.7	5.0e-48
WP_015077108.1|2611032_2611428_-|capsid	minor capsid protein	capsid	Q5YA65	Bacillus_phage	55.9	4.4e-34
WP_015077109.1|2611427_2611751_-|capsid	minor capsid protein	capsid	Q5YA66	Bacillus_phage	46.6	8.3e-23
WP_144060854.1|2611750_2612086_-|capsid	minor capsid protein	capsid	Q5YA67	Bacillus_phage	64.9	5.9e-40
WP_015077111.1|2612085_2612490_-	hypothetical protein	NA	Q5YA68	Bacillus_phage	60.9	1.0e-33
WP_167594259.1|2612522_2612666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077113.1|2612665_2613547_-	hypothetical protein	NA	A0A1L2JXH5	Streptococcus_phage	66.8	2.8e-105
WP_015077114.1|2613567_2614128_-	phage scaffolding protein	NA	L0P7B0	Lactobacillus_phage	30.5	2.2e-15
WP_015077115.1|2614250_2615408_-|capsid	phage minor capsid protein	capsid	Q5YA73	Bacillus_phage	57.3	8.7e-123
WP_015077116.1|2615412_2615598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144060856.1|2615597_2617088_-|portal	phage portal protein	portal	Q5YA75	Bacillus_phage	55.4	1.8e-152
WP_144060855.1|2617150_2618494_-|terminase	PBSX family phage terminase large subunit	terminase	Q5YA76	Bacillus_phage	68.7	5.1e-183
WP_016356569.1|2618486_2619020_-	hypothetical protein	NA	A0A0E3U2Q7	Fusobacterium_phage	50.8	1.2e-26
WP_016356570.1|2619375_2619663_+	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	62.4	8.1e-30
WP_015077122.1|2619652_2619919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077123.1|2620761_2621193_-	phage transcriptional regulator, ArpU family protein	NA	D2IZ85	Enterococcus_phage	42.1	8.2e-18
WP_041555030.1|2621204_2621414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077124.1|2621503_2621668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077125.1|2621669_2622266_-	DUF1642 domain-containing protein	NA	D2IYV1	Enterococcus_phage	39.2	3.4e-14
WP_015077126.1|2622283_2622760_-	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	56.3	2.1e-43
WP_015077127.1|2622763_2623075_-	hypothetical protein	NA	A8ASM5	Listeria_phage	36.7	6.1e-07
WP_015077129.1|2623438_2623840_-	yopX family protein	NA	D2IZL0	Enterococcus_phage	61.8	6.9e-19
WP_041555031.1|2623844_2624087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077130.1|2624098_2624860_-	site-specific DNA-methyltransferase	NA	A0A097QQ03	Enterococcus_phage	82.0	1.5e-118
WP_015077131.1|2624860_2625226_-	RusA family crossover junction endodeoxyribonuclease	NA	A8AU00	Listeria_phage	57.0	1.1e-31
WP_015077132.1|2625215_2625407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077133.1|2625407_2625899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077134.1|2625888_2626062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041555032.1|2626231_2627071_-	ATP-binding protein	NA	O03914	Lactobacillus_phage	38.8	3.5e-41
WP_015077136.1|2627048_2627843_-	phage replisome organizer N-terminal domain-containing protein	NA	C9E2N2	Enterococcus_phage	68.1	8.0e-51
WP_015077137.1|2627845_2628508_-	hypothetical protein	NA	A0A1D6Z258	Staphylococcus_phage	44.4	7.6e-31
WP_015077138.1|2628504_2629242_-	DUF1071 domain-containing protein	NA	A0A2I7QXI0	Vibrio_phage	52.8	3.7e-42
>prophage 7
NC_019425	Carnobacterium maltaromaticum LMA28, complete genome	3650416	2633020	2641236	3650416		Staphylococcus_phage(28.57%)	11	NA	NA
WP_015077150.1|2633020_2633416_+	hypothetical protein	NA	A0A1B1IMP6	Lactococcus_phage	30.8	4.4e-10
WP_016356573.1|2633546_2634329_-	phage antirepressor KilAC domain-containing protein	NA	M1RZB2	Staphylococcus_phage	53.0	1.4e-71
WP_035065584.1|2634540_2634747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077154.1|2634842_2635004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077155.1|2635007_2635187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077156.1|2635199_2635442_-	helix-turn-helix transcriptional regulator	NA	A0A1J0MFJ4	Staphylococcus_phage	72.4	4.3e-24
WP_015077157.1|2635616_2636345_+	helix-turn-helix domain-containing protein	NA	E9LUS8	Lactobacillus_phage	38.9	2.9e-31
WP_015077158.1|2636438_2636990_+	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
WP_015077159.1|2637102_2638530_+	recombinase family protein	NA	D7RWL2	Brochothrix_phage	55.6	1.2e-126
WP_016356574.1|2638559_2639942_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	51.9	1.5e-134
WP_015077161.1|2640204_2641236_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	29.3	1.4e-18
>prophage 8
NC_019425	Carnobacterium maltaromaticum LMA28, complete genome	3650416	2655241	2664084	3650416		Synechococcus_phage(33.33%)	9	NA	NA
WP_015077170.1|2655241_2655823_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	3.8e-26
WP_015077171.1|2655825_2656869_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	42.2	2.1e-59
WP_010051642.1|2656895_2658341_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.2	3.3e-55
WP_015077172.1|2658316_2660548_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.4	3.4e-147
WP_010051639.1|2660544_2661225_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_010051638.1|2661225_2661474_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_010051637.1|2661489_2662203_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	42.8	6.9e-46
WP_015077173.1|2662462_2662843_+	VOC family protein	NA	NA	NA	NA	NA
WP_010051635.1|2662896_2664084_-	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	27.5	8.0e-31
>prophage 9
NC_019425	Carnobacterium maltaromaticum LMA28, complete genome	3650416	2676530	2687790	3650416	transposase	Streptococcus_phage(33.33%)	11	NA	NA
WP_080732560.1|2676530_2676806_-|transposase	transposase	transposase	Q9MBP7	Staphylococcus_prophage	49.4	3.5e-14
WP_015077180.1|2677045_2677975_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A097BY70	Enterococcus_phage	58.7	1.9e-43
WP_015077181.1|2678520_2679051_-	DsbA family protein	NA	NA	NA	NA	NA
WP_015077182.1|2679165_2679762_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.7	3.1e-55
WP_010051612.1|2680227_2681175_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.8	6.0e-53
WP_015077183.1|2681219_2682215_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	54.9	3.1e-100
WP_010051608.1|2682211_2683099_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	35.6	3.7e-12
WP_015077184.1|2683326_2685054_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	57.8	7.0e-193
WP_010051606.1|2685239_2686187_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.4	1.7e-87
WP_010051605.1|2686282_2686714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077186.1|2686866_2687790_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.2	2.1e-79
>prophage 10
NC_019425	Carnobacterium maltaromaticum LMA28, complete genome	3650416	3280361	3348834	3650416	portal,tail,head,terminase,integrase,capsid,tRNA,holin,protease	Streptococcus_phage(17.5%)	95	3341367:3341382	3344845:3344860
WP_015077649.1|3280361_3280796_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_015077650.1|3280972_3282907_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_016356658.1|3282973_3284407_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_035065252.1|3284426_3284762_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_015077652.1|3284761_3286018_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_010053491.1|3286273_3286579_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_015077653.1|3287160_3287358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010053489.1|3287536_3287881_-	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_010053486.1|3287941_3288754_-	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_010053485.1|3288784_3289780_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	35.5	3.3e-38
WP_010053484.1|3289797_3290127_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_015077654.1|3290128_3290776_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	53.6	4.3e-55
WP_015077655.1|3291059_3292295_-	tetracycline resistance MFS efflux pump	NA	A0A2H4UVM2	Bodo_saltans_virus	21.8	2.7e-05
WP_015077656.1|3292489_3292963_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010053475.1|3293092_3293551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010053472.1|3293642_3293987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016356660.1|3293983_3295318_-	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
WP_015077659.1|3295327_3296773_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_010053463.1|3296874_3297105_-	YaaL family protein	NA	NA	NA	NA	NA
WP_010053460.1|3297121_3297718_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_010053459.1|3297822_3298134_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_015077660.1|3298231_3300118_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	39.8	5.2e-56
WP_041555040.1|3300351_3301119_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_015077662.1|3301417_3301783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015077663.1|3301779_3302052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015077664.1|3302218_3302533_+	ssDNA-binding protein	NA	NA	NA	NA	NA
WP_015077665.1|3302698_3303229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077666.1|3303242_3303710_-	SocA family protein	NA	I6R0L8	Salmonella_phage	39.1	1.7e-21
WP_144060859.1|3304097_3305132_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9MCC8	Lactobacillus_phage	62.2	2.2e-56
WP_015077668.1|3305217_3305460_-|holin	phage holin	holin	A0A059T684	Listeria_phage	56.2	2.6e-21
WP_041555202.1|3305463_3305700_-	hemolysin XhlA family protein	NA	A5GYL2	Lactococcus_phage	46.5	1.3e-12
WP_015077670.1|3305830_3308026_-	glycerophosphoryl diester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	29.5	1.9e-54
WP_015077671.1|3308038_3309694_-|tail	phage tail protein	tail	A0A1B2APX2	Phage_Wrath	46.0	1.0e-92
WP_015077672.1|3309693_3310404_-	hypothetical protein	NA	A0A1S5SAI1	Streptococcus_phage	38.7	3.6e-34
WP_015077673.1|3310400_3312818_-	hypothetical protein	NA	M1PKM6	Streptococcus_phage	37.3	6.5e-19
WP_015077674.1|3312942_3315285_-|tail	phage tail tape measure protein	tail	M1PKM6	Streptococcus_phage	49.3	3.7e-80
WP_015077675.1|3315314_3315482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077676.1|3315511_3315829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077677.1|3315930_3316524_-|tail	phage major tail, phi13 family protein	tail	NA	NA	NA	NA
WP_015077678.1|3316550_3316940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077679.1|3316936_3317065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077680.1|3317061_3317334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077681.1|3317311_3317677_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_015077682.1|3317660_3317957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077683.1|3317973_3318255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077684.1|3318323_3319520_-|capsid	phage major capsid protein	capsid	A0A288WGE9	Bacillus_phage	46.6	1.1e-88
WP_041555044.1|3319568_3320174_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	55.1	8.5e-53
WP_015077686.1|3320121_3321450_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	43.8	1.9e-89
WP_015077687.1|3321605_3321926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077688.1|3321938_3323660_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	54.3	4.2e-174
WP_016356663.1|3323656_3324133_-|terminase	phage terminase small subunit P27 family	terminase	A0A0A7S0C4	Clostridium_phage	59.2	1.5e-36
WP_041555047.1|3324710_3325055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010051769.1|3325061_3325325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077692.1|3325382_3325562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041555048.1|3325623_3325833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077693.1|3325829_3326054_-	hypothetical protein	NA	F8WQ61	Bacillus_phage	48.8	4.9e-06
WP_015077694.1|3326239_3326527_+	hypothetical protein	NA	A0A1W6JPU7	Staphylococcus_phage	62.4	4.8e-30
WP_015077695.1|3326516_3326783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010050190.1|3327588_3328014_-	autolysin regulatory protein ArpU	NA	D2IZ85	Enterococcus_phage	38.6	1.3e-12
WP_041555049.1|3328026_3328233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077696.1|3328322_3328487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077697.1|3328488_3329088_-	DUF1642 domain-containing protein	NA	A0A097BY76	Enterococcus_phage	27.6	1.8e-15
WP_015077698.1|3329087_3329240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077699.1|3329255_3329720_-	single-stranded DNA-binding protein	NA	G4KNN8	Staphylococcus_phage	44.3	2.4e-23
WP_015077700.1|3329716_3329992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077701.1|3329988_3330411_-	yopX family protein	NA	D2IZL0	Enterococcus_phage	60.3	2.1e-18
WP_041555210.1|3330665_3331070_-	DUF1064 domain-containing protein	NA	A0A1P8BMB7	Lactococcus_phage	53.4	7.7e-26
WP_015077703.1|3331065_3331257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077704.1|3331253_3331493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077705.1|3331489_3331774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077706.1|3331760_3332621_-	helix-turn-helix domain-containing protein	NA	A0A1B1P7T6	Bacillus_phage	60.6	1.3e-27
WP_080639167.1|3332624_3333374_-	hypothetical protein	NA	D7RWH3	Brochothrix_phage	33.9	6.0e-24
WP_015077708.1|3333380_3334400_-	DUF1351 domain-containing protein	NA	C9E2N0	Enterococcus_phage	32.4	3.4e-22
WP_015077709.1|3334396_3335149_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	36.7	2.7e-32
WP_015077710.1|3335145_3335349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077711.1|3335350_3335776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077142.1|3335847_3336207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077143.1|3336207_3336348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077712.1|3336352_3336547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041555052.1|3336862_3337210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016356665.1|3337206_3337401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015077715.1|3337754_3338018_-	hypothetical protein	NA	A0A0S2MYC6	Enterococcus_phage	58.3	1.8e-20
WP_015077716.1|3338430_3338637_-	hypothetical protein	NA	A0A1J0MFT6	Staphylococcus_phage	39.7	2.6e-06
WP_015077717.1|3338650_3338827_-	hypothetical protein	NA	D7RWL9	Brochothrix_phage	58.2	5.7e-10
WP_015077718.1|3338840_3339596_-	phage antirepressor KilAC domain-containing protein	NA	R4IFK0	Staphylococcus_phage	46.9	1.6e-61
WP_015077719.1|3339606_3339831_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JHJ6	uncultured_Caudovirales_phage	52.9	1.2e-09
WP_016356666.1|3339970_3340309_+	helix-turn-helix domain-containing protein	NA	A0A141E0Q5	Streptococcus_phage	64.6	6.2e-21
WP_015077721.1|3340321_3340786_+	hypothetical protein	NA	A0A059T7S0	Listeria_phage	44.7	1.4e-18
WP_080639181.1|3341037_3341778_+	Ltp family lipoprotein	NA	A0A097BY93	Leuconostoc_phage	69.2	3.1e-12
3341367:3341382	attL	AAAAAAAGAAGCTGAA	NA	NA	NA	NA
WP_015077723.1|3341897_3343040_+|integrase	site-specific integrase	integrase	A0A0S2MYI6	Enterococcus_phage	54.9	3.1e-112
WP_015077724.1|3343397_3344210_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	33.6	1.6e-30
WP_015077725.1|3344284_3344806_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_010049713.1|3344947_3345814_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
3344845:3344860	attR	TTCAGCTTCTTTTTTT	NA	NA	NA	NA
WP_010049709.1|3345888_3346239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016356668.1|3346341_3348834_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	39.9	4.3e-127
