The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_018641	Lacticaseibacillus paracasei, complete genome	3075780	20325	66660	3075780	holin,bacteriocin,transposase,protease	Planktothrix_phage(25.0%)	46	NA	NA
WP_003568480.1|20325_21183_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003568482.1|21262_21445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012490759.1|21495_21675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003572828.1|22172_23408_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_012490760.1|23611_26185_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003568488.1|26197_26899_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	3.9e-33
WP_012490761.1|27178_27730_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014951487.1|27773_28118_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003584076.1|28584_28905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014566351.1|29130_29811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012490762.1|29743_30247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012490763.1|30266_32417_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_012490764.1|32485_33373_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_014951491.1|33554_34160_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003568507.1|34283_35177_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_012490766.1|35225_35864_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003568512.1|36092_37469_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_012490767.1|37691_38036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562540.1|38111_38471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012490768.1|38711_40154_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003577239.1|40347_40983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003577240.1|41032_41344_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003577242.1|41512_41701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003577243.1|41832_42444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014951495.1|42947_43274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014951496.1|43425_43776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012490769.1|44096_44807_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_003592450.1|44793_45123_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_012490770.1|46003_46219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012490771.1|46565_47441_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012490772.1|47785_48436_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_012490773.1|48604_50020_-|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_003562575.1|50400_51093_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003562576.1|51791_52112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012490774.1|52300_53176_-	Rgg/GadR/MutR family transcriptional regulator	NA	A0A1X9I6E0	Streptococcus_phage	26.6	1.0e-11
WP_012490775.1|53268_54861_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.5	1.1e-11
WP_012490776.1|55198_56572_-	MFS transporter	NA	NA	NA	NA	NA
WP_011673959.1|56749_57073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014951504.1|57144_60564_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_003572929.1|60560_61163_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003572931.1|61412_61673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562592.1|61885_62548_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003562594.1|62547_63477_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003568628.1|63488_64118_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012490780.1|64120_65374_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	43.0	1.5e-14
WP_003577283.1|66006_66660_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NC_018641	Lacticaseibacillus paracasei, complete genome	3075780	555643	600936	3075780	holin,transposase,integrase	Lactobacillus_phage(65.0%)	59	556164:556179	587487:587502
WP_003577893.1|555643_556573_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	63.7	5.9e-106
556164:556179	attL	TCGTTGCTGGCGTCGG	NA	NA	NA	NA
WP_012491046.1|556766_557312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003569067.1|557632_558802_-|integrase	site-specific integrase	integrase	Q6J1W6	Lactobacillus_phage	98.2	6.6e-219
WP_003573997.1|558914_559175_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	40.7	2.5e-09
WP_003589914.1|559263_559884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491047.1|559867_560104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003589919.1|560296_561004_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003572182.1|561162_561585_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IJN5	Lactobacillus_phage	39.1	7.8e-21
WP_003572184.1|561577_561931_-	helix-turn-helix transcriptional regulator	NA	A0A141E1M3	Streptococcus_phage	40.9	7.7e-14
WP_003574003.1|562174_562423_+	hypothetical protein	NA	A0A0P0ID24	Lactobacillus_phage	97.5	2.7e-37
WP_003572187.1|562464_562665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572188.1|562635_563469_-	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	37.8	2.8e-46
WP_010493122.1|563529_564288_+	ORF6C domain-containing protein	NA	A0A1B0YEA7	Lactobacillus_phage	49.4	1.9e-41
WP_003572193.1|564288_564468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572196.1|564460_564712_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_003572199.1|564777_565134_+	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	98.3	2.0e-62
WP_003572201.1|565218_565422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003586921.1|565404_565950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010493132.1|566130_566445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003589923.1|566437_567184_+	DnaD domain protein	NA	A0A0N7IRA7	Lactobacillus_phage	56.1	5.8e-35
WP_012491048.1|567198_568023_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	74.7	9.6e-116
WP_003574016.1|568022_568541_+	exonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_003564822.1|568587_569010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572217.1|569011_569749_+	hypothetical protein	NA	A0A097BY87	Enterococcus_phage	43.0	1.3e-47
WP_010493149.1|569760_570048_+	hypothetical protein	NA	Q8LTA8	Lactobacillus_phage	76.8	1.6e-38
WP_010493151.1|570117_570450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010493154.1|570964_571408_+	autolysin regulatory protein arpU	NA	A0A0P0IZI6	Lactobacillus_phage	97.3	1.2e-77
WP_003572221.1|571920_572574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003601683.1|572824_573823_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.8	1.8e-55
WP_003573729.1|574018_574237_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010493173.1|575769_576105_+	ribonucleoside-diphosphate reductase	NA	A0A0N7IRA2	Lactobacillus_phage	90.6	6.8e-52
WP_076626284.1|576224_576557_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003582147.1|576586_577315_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	40.1	7.6e-32
WP_014951815.1|577248_578190_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.2	3.1e-17
WP_016364094.1|578235_579099_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	3.1e-24
WP_010493185.1|579828_580107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572355.1|580118_580385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572358.1|580403_580580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572360.1|580581_580809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010493190.1|580851_582093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010493192.1|582070_583621_+	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
WP_012491056.1|583630_584050_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_012491057.1|584058_584637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491058.1|584663_587123_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_012491059.1|587119_589177_+	hypothetical protein	NA	NA	NA	NA	NA
587487:587502	attR	TCGTTGCTGGCGTCGG	NA	NA	NA	NA
WP_003582234.1|589182_589518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014566422.1|589501_590098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491061.1|590078_592007_+	type IV secretory pathway, VirB4 protein	NA	NA	NA	NA	NA
WP_012491062.1|592008_593019_+	C40 family peptidase	NA	A0A1X9SGZ2	Bradyrhizobium_phage	37.9	1.2e-14
WP_012491063.1|593034_593679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491064.1|593675_594083_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_014566423.1|594072_594894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491066.1|595488_595689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491067.1|595685_595943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491068.1|595981_596416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491069.1|596408_597653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016379926.1|597694_597940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014951650.1|597926_600458_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_080600933.1|600789_600936_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
>prophage 3
NC_018641	Lacticaseibacillus paracasei, complete genome	3075780	608346	633703	3075780	transposase	Lactobacillus_phage(50.0%)	24	NA	NA
WP_123018123.1|608346_609134_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003586210.1|609088_609466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491083.1|609501_609774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491084.1|609833_612638_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.6	1.5e-72
WP_002816607.1|613179_613863_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	2.1e-60
WP_005688360.1|614337_615492_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_100216635.1|615500_616288_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014951658.1|616437_617058_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	52.9	1.4e-55
WP_012491089.1|617245_618175_-	class I mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_012491090.1|618188_619019_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_012491091.1|619031_619886_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_012491093.1|620451_620871_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_012491094.1|621047_621770_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_012491095.1|621867_622605_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012491096.1|622909_623230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491097.1|623326_623914_+	recombinase family protein	NA	M4QQC6	Vibrio_phage	42.3	1.0e-18
WP_003591692.1|624081_625410_+	MFS transporter	NA	NA	NA	NA	NA
WP_003567312.1|625610_626168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100216635.1|626689_627477_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_148276982.1|627928_628672_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.8	1.4e-137
WP_003593245.1|629330_630248_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_003593246.1|630394_631003_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	52.8	1.8e-50
WP_010010565.1|631013_632282_+	NADPH-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	47.7	1.8e-49
WP_123031263.1|632959_633703_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.4	1.5e-136
>prophage 4
NC_018641	Lacticaseibacillus paracasei, complete genome	3075780	919992	953877	3075780	terminase,head,capsid,integrase,portal,tail,protease,tRNA	Lactobacillus_phage(97.56%)	46	925416:925431	951119:951134
WP_003578174.1|919992_922404_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.4	0.0e+00
WP_003564130.1|922669_924313_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_012491225.1|924317_925028_+	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
WP_003569458.1|925170_925386_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
925416:925431	attL	TCAAAAAAGCAGGTGA	NA	NA	NA	NA
WP_003569460.1|925502_926324_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_012491226.1|926320_926824_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_012491227.1|927146_928286_-|integrase	site-specific integrase	integrase	A0A0P0IXL3	Lactobacillus_phage	100.0	2.4e-218
WP_003598052.1|928403_929471_-	Abi family protein	NA	A0A0N7IRA5	Lactobacillus_phage	100.0	1.1e-207
WP_003598055.1|929615_930047_-	hypothetical protein	NA	A0A0P0IJV8	Lactobacillus_phage	100.0	6.8e-73
WP_012491228.1|930116_930599_-	hypothetical protein	NA	A0A0P0IZP3	Lactobacillus_phage	100.0	2.1e-83
WP_003598059.1|930602_930896_-	hypothetical protein	NA	A0A0P0HRW5	Lactobacillus_phage	100.0	5.7e-47
WP_012491229.1|931079_931940_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IV64	Lactobacillus_phage	100.0	2.8e-158
WP_012491230.1|931926_932295_-	helix-turn-helix domain-containing protein	NA	A0A0P0I3L3	Lactobacillus_phage	100.0	2.8e-59
WP_003578190.1|932550_932748_+	hypothetical protein	NA	A0A0P0IK60	Lactobacillus_phage	100.0	5.2e-28
WP_012491231.1|932744_933467_+	Rha family transcriptional regulator	NA	A0A0P0IDD0	Lactobacillus_phage	100.0	1.4e-126
WP_014951753.1|933474_933687_+	hypothetical protein	NA	A0A0N7IRA6	Lactobacillus_phage	100.0	7.8e-30
WP_003657835.1|933795_934020_+	DUF771 domain-containing protein	NA	A0A0P0IQT9	Lactobacillus_phage	100.0	2.6e-39
WP_012491233.1|934108_934321_+	hypothetical protein	NA	A0A0P0IXL9	Lactobacillus_phage	100.0	2.5e-36
WP_012491234.1|934330_935206_+	YqaJ viral recombinase family protein	NA	A0A0P0IJW5	Lactobacillus_phage	100.0	1.1e-170
WP_012491235.1|935208_935403_+	hypothetical protein	NA	A0A0P0IZQ2	Lactobacillus_phage	100.0	2.5e-30
WP_012491236.1|935402_936290_+	recombinase RecT	NA	A0A0P0HRX2	Lactobacillus_phage	100.0	8.6e-163
WP_012491237.1|936298_936544_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IV68	Lactobacillus_phage	100.0	2.6e-37
WP_012491239.1|937430_938252_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	100.0	6.1e-155
WP_012491240.1|938248_938548_+	hypothetical protein	NA	A0A0P0IK66	Lactobacillus_phage	100.0	2.1e-49
WP_014566466.1|938510_938795_+	hypothetical protein	NA	A0A0P0IDD7	Lactobacillus_phage	100.0	8.8e-45
WP_014566751.1|938763_939111_+	hypothetical protein	NA	A0A0P0IQU7	Lactobacillus_phage	100.0	1.5e-62
WP_012491244.1|939694_940117_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0IXM5	Lactobacillus_phage	100.0	5.5e-75
WP_012491245.1|940121_940385_+	hypothetical protein	NA	A0A0P0IJX1	Lactobacillus_phage	100.0	6.1e-40
WP_012491246.1|940408_940732_+	hypothetical protein	NA	A0A0N7IRA8	Lactobacillus_phage	100.0	9.7e-56
WP_012491247.1|940810_941260_+	hypothetical protein	NA	A0A0P0IZR0	Lactobacillus_phage	100.0	1.2e-80
WP_012491248.1|941484_941865_+	HNH endonuclease	NA	A0A0P0HRY0	Lactobacillus_phage	100.0	2.5e-71
WP_003582259.1|941934_942309_+	hypothetical protein	NA	A0A1B0YE76	Lactobacillus_phage	100.0	3.6e-62
WP_014951757.1|942311_944042_+|terminase	terminase large subunit	terminase	A0A0P0IJU3	Lactobacillus_phage	99.7	0.0e+00
WP_014951758.1|944060_945296_+|portal	phage portal protein	portal	A0A0P0IZM3	Lactobacillus_phage	99.8	4.5e-234
WP_014951759.1|945273_945981_+|protease	Clp protease ClpP	protease	A0A0P0HRU7	Lactobacillus_phage	99.6	1.2e-127
WP_014566753.1|945985_947215_+|capsid	phage major capsid protein	capsid	A0A0P0IV50	Lactobacillus_phage	99.8	1.6e-228
WP_012491330.1|947288_947537_+	hypothetical protein	NA	A0A1B0Y2R9	Lactobacillus_phage	100.0	7.0e-38
WP_003582271.1|947550_947877_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B0Y2R7	Lactobacillus_phage	100.0	7.0e-54
WP_012491255.1|947815_948154_+|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	100.0	2.2e-58
WP_012491331.1|948137_948467_+	hypothetical protein	NA	A0A1B0Y3M9	Lactobacillus_phage	100.0	3.1e-57
WP_012491332.1|948456_948840_+	hypothetical protein	NA	A0A1B0YC24	Lactobacillus_phage	100.0	2.6e-68
WP_014951760.1|948851_949499_+	hypothetical protein	NA	A0A0P0I7R6	Lactobacillus_phage	99.5	2.1e-118
WP_012491259.1|949575_949941_+	hypothetical protein	NA	A0A0P0IXK4	Lactobacillus_phage	100.0	4.6e-62
WP_003582283.1|950021_950183_+	hypothetical protein	NA	A0A0P0IJV2	Lactobacillus_phage	100.0	7.5e-25
WP_012491260.1|950202_953175_+	tape measure protein	NA	A0A0P0IZN3	Lactobacillus_phage	100.0	1.3e-292
951119:951134	attR	TCAAAAAAGCAGGTGA	NA	NA	NA	NA
WP_014951761.1|953181_953877_+|tail	tail protein	tail	A0A0P0HRV6	Lactobacillus_phage	99.6	5.4e-128
>prophage 5
NC_018641	Lacticaseibacillus paracasei, complete genome	3075780	958307	960917	3075780	holin	Lactobacillus_phage(100.0%)	6	NA	NA
WP_012491263.1|958307_958733_+	DUF1617 family protein	NA	A0A1B0Y2S1	Lactobacillus_phage	100.0	8.8e-73
WP_012491264.1|958735_959005_+	hypothetical protein	NA	A0A0P0I3K6	Lactobacillus_phage	100.0	2.4e-39
WP_012491265.1|959050_959344_+	hypothetical protein	NA	A0A0P0IK41	Lactobacillus_phage	100.0	4.0e-48
WP_012491266.1|959333_959768_+|holin	phage holin	holin	A0A0P0IDC6	Lactobacillus_phage	100.0	7.4e-51
WP_012491267.1|959767_959956_+	hypothetical protein	NA	A0A0P0IQT6	Lactobacillus_phage	100.0	6.7e-25
WP_012491268.1|959942_960917_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0P0I7S1	Lactobacillus_phage	100.0	9.1e-198
>prophage 6
NC_018641	Lacticaseibacillus paracasei, complete genome	3075780	1018035	1116972	3075780	terminase,tRNA,capsid,integrase,portal,tail,protease,holin,head	Lactobacillus_phage(77.05%)	99	1041685:1041703	1076589:1076607
WP_003564220.1|1018035_1018371_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_003564222.1|1018562_1019522_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_003578277.1|1019523_1020351_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_003583985.1|1020361_1021417_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_041168779.1|1021460_1022435_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	47.9	9.1e-81
WP_012491290.1|1023018_1024746_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.9	3.3e-182
WP_003569557.1|1024980_1025628_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014566477.1|1025620_1026631_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_014566756.1|1027401_1029768_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003564240.1|1029925_1030573_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003578292.1|1030778_1032794_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_012491295.1|1033061_1035953_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	1.9e-307
WP_003564246.1|1036304_1036844_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_003564248.1|1037006_1037894_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.4	1.1e-08
WP_003564250.1|1037890_1038919_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	51.2	2.3e-90
WP_012491296.1|1038923_1039871_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.7	9.2e-54
WP_003564253.1|1040256_1040712_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003564255.1|1040828_1041419_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	52.3	1.1e-52
1041685:1041703	attL	TGTGCAATTTGTGTGCAAT	NA	NA	NA	NA
WP_012491297.1|1041823_1042975_-|integrase	site-specific integrase	integrase	Q8W767	Lactobacillus_phage	100.0	2.2e-219
WP_041168764.1|1043085_1043850_-	hypothetical protein	NA	A0A1B0YA83	Lactobacillus_phage	99.2	2.9e-143
WP_012491299.1|1043864_1044095_+	hypothetical protein	NA	U5U783	Lactobacillus_phage	100.0	7.2e-37
WP_012491300.1|1044349_1045129_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	100.0	9.1e-116
WP_012491301.1|1045200_1045605_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1B0Y2S4	Lactobacillus_phage	100.0	2.1e-76
WP_012491302.1|1045601_1045928_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	100.0	3.4e-56
WP_012491303.1|1046184_1046397_+	helix-turn-helix transcriptional regulator	NA	A0A1B0YC38	Lactobacillus_phage	100.0	3.7e-32
WP_012491304.1|1046399_1047173_+	ORF6N domain-containing protein	NA	A0A1B0YEA7	Lactobacillus_phage	100.0	1.3e-143
WP_012491305.1|1047204_1047528_+	DUF771 domain-containing protein	NA	A0A1B0Y6D5	Lactobacillus_phage	100.0	1.2e-58
WP_012491308.1|1047795_1048107_-	hypothetical protein	NA	A0A1B0YA89	Lactobacillus_phage	100.0	8.2e-52
WP_012491309.1|1048167_1048359_+	hypothetical protein	NA	A0A1B0Y2S8	Lactobacillus_phage	100.0	6.4e-31
WP_012491310.1|1048372_1048612_+	hypothetical protein	NA	A0A1B0Y2S6	Lactobacillus_phage	100.0	7.7e-34
WP_012491311.1|1048616_1049111_+	siphovirus Gp157 family protein	NA	A0A1B0Y2S7	Lactobacillus_phage	100.0	9.9e-84
WP_012491312.1|1049122_1049353_+	hypothetical protein	NA	A0A1B0Y3N2	Lactobacillus_phage	100.0	3.0e-35
WP_012491313.1|1049352_1050720_+	DEAD/DEAH box helicase	NA	A0A1B0YC45	Lactobacillus_phage	100.0	1.6e-264
WP_012491314.1|1050721_1051462_+	AAA family ATPase	NA	A0A1B0YEB5	Lactobacillus_phage	100.0	4.1e-134
WP_012491315.1|1051464_1051974_+	hypothetical protein	NA	A0A1B0Y6E2	Lactobacillus_phage	100.0	4.1e-93
WP_012491317.1|1052841_1054077_+	helicase	NA	A0A1B0Y896	Lactobacillus_phage	100.0	1.1e-237
WP_012491318.1|1054351_1054666_+	VRR-NUC domain-containing protein	NA	A0A1B0YA93	Lactobacillus_phage	100.0	1.4e-54
WP_012491319.1|1054672_1054957_+	hypothetical protein	NA	A0A1B0Y2T1	Lactobacillus_phage	100.0	6.8e-45
WP_014951787.1|1054925_1055273_+	hypothetical protein	NA	A0A1B0Y2S9	Lactobacillus_phage	99.1	2.2e-58
WP_012491321.1|1055265_1055853_+	HNH endonuclease	NA	A0A1B0Y2T0	Lactobacillus_phage	100.0	9.9e-107
WP_012491322.1|1055839_1056094_+	hypothetical protein	NA	A0A1B0Y3N3	Lactobacillus_phage	100.0	2.3e-44
WP_012491323.1|1056090_1056495_+	transcriptional regulator	NA	A0A1B0YC57	Lactobacillus_phage	100.0	9.3e-72
WP_012491324.1|1056659_1057040_+	HNH endonuclease	NA	A0A1B0YEC6	Lactobacillus_phage	100.0	1.5e-71
WP_003582259.1|1057108_1057483_+	hypothetical protein	NA	A0A1B0YE76	Lactobacillus_phage	100.0	3.6e-62
WP_012491326.1|1057485_1059216_+|terminase	terminase large subunit	terminase	A0A1B0Y6B8	Lactobacillus_phage	100.0	0.0e+00
WP_012491327.1|1059234_1060470_+|portal	phage portal protein	portal	A0A1B0Y4Q9	Lactobacillus_phage	100.0	1.2e-234
WP_012491328.1|1060447_1061155_+|protease	Clp protease ClpP	protease	A0A1B0Y857	Lactobacillus_phage	100.0	1.4e-128
WP_014566753.1|1061159_1062389_+|capsid	phage major capsid protein	capsid	A0A0P0IV50	Lactobacillus_phage	99.8	1.6e-228
WP_012491254.1|1062462_1062711_+	hypothetical protein	NA	A0A0P0I3K0	Lactobacillus_phage	100.0	9.1e-38
WP_003582271.1|1062724_1063051_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B0Y2R7	Lactobacillus_phage	100.0	7.0e-54
WP_012491255.1|1062989_1063328_+|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	100.0	2.2e-58
WP_012491256.1|1063311_1063641_+	hypothetical protein	NA	A0A0P0IDB8	Lactobacillus_phage	100.0	3.1e-57
WP_012491332.1|1063630_1064014_+	hypothetical protein	NA	A0A1B0YC24	Lactobacillus_phage	100.0	2.6e-68
WP_012491333.1|1064025_1064673_+	hypothetical protein	NA	A0A1B0Y6C3	Lactobacillus_phage	100.0	1.2e-118
WP_003595114.1|1064749_1065115_+	hypothetical protein	NA	A0A1B0Y865	Lactobacillus_phage	100.0	4.6e-62
WP_012491334.1|1065195_1065357_+	hypothetical protein	NA	A0A1B0Y4R4	Lactobacillus_phage	100.0	5.7e-25
WP_014566481.1|1065376_1068547_+|tail	phage tail tape measure protein	tail	A0A1B0YA78	Lactobacillus_phage	99.9	0.0e+00
WP_014951789.1|1068553_1069249_+|tail	tail protein	tail	A0A0P0HRV6	Lactobacillus_phage	99.6	1.9e-128
WP_014951790.1|1069245_1073649_+|tail	phage tail protein	tail	A0A1B0Y2S0	Lactobacillus_phage	99.9	0.0e+00
WP_012491263.1|1073677_1074103_+	DUF1617 family protein	NA	A0A1B0Y2S1	Lactobacillus_phage	100.0	8.8e-73
WP_012491338.1|1074105_1074375_+	hypothetical protein	NA	A0A1B0Y3N0	Lactobacillus_phage	100.0	1.3e-40
WP_012491339.1|1074422_1074809_+	hypothetical protein	NA	A0A1B0YC31	Lactobacillus_phage	100.0	5.6e-66
WP_004562059.1|1074789_1074996_+	hypothetical protein	NA	A0A1B0YE97	Lactobacillus_phage	100.0	1.4e-12
WP_012491341.1|1074992_1075454_+|holin	phage holin	holin	A0A1B0Y6C9	Lactobacillus_phage	100.0	1.2e-70
WP_012491342.1|1075455_1076508_+	peptidoglycan recognition protein	NA	A0A1B0Y4R9	Lactobacillus_phage	100.0	2.3e-207
WP_003564263.1|1077283_1078321_+	central glycolytic genes regulator	NA	NA	NA	NA	NA
1076589:1076607	attR	TGTGCAATTTGTGTGCAAT	NA	NA	NA	NA
WP_003564265.1|1078357_1079380_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003564267.1|1079570_1080761_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_003564269.1|1080835_1081591_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_012491343.1|1081639_1082944_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	67.1	5.7e-163
WP_014566482.1|1083255_1084536_+	MFS transporter	NA	A0A1B0RXG2	Streptococcus_phage	34.9	3.6e-61
WP_012491345.1|1084541_1084898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014951793.1|1084986_1086558_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_003564279.1|1086743_1086980_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_012491347.1|1087222_1087957_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014566483.1|1087958_1090328_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.4	6.6e-93
WP_003564285.1|1090359_1090833_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	60.5	1.2e-46
WP_012491349.1|1091229_1092183_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012491351.1|1094059_1095805_+	alpha-glycosidase	NA	NA	NA	NA	NA
WP_012491352.1|1095934_1098196_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_014566485.1|1098188_1098881_+	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_014566762.1|1098885_1100016_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.4	1.4e-21
WP_012491355.1|1100043_1101669_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_012491356.1|1101708_1102941_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_012491357.1|1103010_1104369_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003604744.1|1104374_1105232_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_012491358.1|1105368_1105671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491359.1|1105660_1105849_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012491360.1|1106254_1107502_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012491361.1|1107630_1108944_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012491362.1|1108953_1109775_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_014566486.1|1109790_1110684_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003593952.1|1110673_1111735_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	48.9	3.1e-18
WP_003569672.1|1112104_1112686_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003569673.1|1112996_1113503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003569675.1|1113715_1114609_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003564334.1|1114728_1115415_+	uracil-DNA glycosylase	NA	A0A0S1TKU8	Elephant_endotheliotropic_herpesvirus	41.7	2.1e-39
WP_012491363.1|1115536_1116514_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_012491364.1|1116510_1116972_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
>prophage 7
NC_018641	Lacticaseibacillus paracasei, complete genome	3075780	1215350	1292863	3075780	terminase,transposase,capsid,integrase,portal,tail,holin,head	Lactobacillus_phage(87.1%)	86	1215342:1215401	1292813:1293929
1215342:1215401	attL	GACGAATTGTCAACTCAAGTGCAACTTTTTACCCATGAAGACTTCTGATGGCGTCTTCCA	NA	NA	NA	NA
WP_003601683.1|1215350_1216349_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.8	1.8e-55
WP_012491408.1|1216407_1217289_+	DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_012491409.1|1217263_1217584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014566766.1|1217597_1219211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491411.1|1219408_1220857_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_016387680.1|1220987_1222790_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_012491413.1|1222876_1223707_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_012491414.1|1224372_1227036_-	YfhO family protein	NA	NA	NA	NA	NA
WP_012491415.1|1227346_1229086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491416.1|1229437_1230367_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	47.7	3.9e-73
WP_014951820.1|1230453_1231092_-	YkyA family protein	NA	NA	NA	NA	NA
WP_012491418.1|1231219_1232185_+	membrane protein	NA	NA	NA	NA	NA
WP_080513729.1|1232332_1232461_+	transcription elongation factor GreAB	NA	NA	NA	NA	NA
WP_003566521.1|1233144_1233345_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	1.2e-19
WP_012491419.1|1233586_1234069_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003661214.1|1234068_1234710_+	glycoside hydrolase family 73 protein	NA	A0A0A7RUS8	Clostridium_phage	47.7	8.5e-27
WP_003566514.1|1234900_1235479_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003566511.1|1235485_1236814_+	purine permease	NA	Q9KX94	Enterobacteria_phage	31.7	1.6e-35
WP_003598329.1|1236834_1237944_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_012491420.1|1238013_1239309_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	28.5	4.4e-14
WP_012491421.1|1239430_1240000_-	branched-chain amino acid ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003566502.1|1240009_1240756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491422.1|1240841_1243097_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	44.6	4.7e-157
WP_003566498.1|1243562_1244168_+	VanZ family protein	NA	NA	NA	NA	NA
WP_003566496.1|1244339_1245197_+	GRP family sugar transporter	NA	NA	NA	NA	NA
WP_014566769.1|1245410_1246751_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_012491423.1|1246877_1248062_-|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	100.0	6.6e-227
WP_012491424.1|1248190_1248520_-	hypothetical protein	NA	A0A0P0IJW6	Lactobacillus_phage	100.0	1.7e-39
WP_012491425.1|1248512_1248971_-	hypothetical protein	NA	A0A0P0ID57	Lactobacillus_phage	100.0	1.2e-86
WP_012491426.1|1249044_1249248_-	hypothetical protein	NA	A0A0P0IQK8	Lactobacillus_phage	100.0	8.5e-34
WP_012491427.1|1249271_1249697_-	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	100.0	9.8e-64
WP_012491428.1|1249795_1250689_-	hypothetical protein	NA	A0A1B0YE50	Lactobacillus_phage	100.0	4.3e-162
WP_012491430.1|1252170_1252521_-	hypothetical protein	NA	A0A1B0Y4P2	Lactobacillus_phage	100.0	3.3e-57
WP_012491431.1|1252577_1253156_-	hypothetical protein	NA	A0A1B0Y834	Lactobacillus_phage	100.0	8.8e-108
WP_012491432.1|1253214_1253634_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1B0YA58	Lactobacillus_phage	100.0	1.2e-77
WP_012491433.1|1253623_1253962_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2R0	Lactobacillus_phage	100.0	7.0e-57
WP_003585053.1|1254101_1254302_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2Q9	Lactobacillus_phage	100.0	6.2e-29
WP_003574526.1|1254338_1254650_+	hypothetical protein	NA	A0A1B0Y2Q8	Lactobacillus_phage	100.0	2.2e-52
WP_012491434.1|1254943_1255090_+	hypothetical protein	NA	A0A1B0YC03	Lactobacillus_phage	100.0	1.0e-20
WP_012491435.1|1255155_1255704_+	hypothetical protein	NA	A0A1B0YE60	Lactobacillus_phage	100.0	1.1e-99
WP_003594176.1|1255682_1255904_+	helix-turn-helix domain-containing protein	NA	A0A1B0Y6A3	Lactobacillus_phage	100.0	1.8e-37
WP_014951828.1|1256144_1256552_+	hypothetical protein	NA	A0A1B0Y842	Lactobacillus_phage	100.0	1.1e-75
WP_014951829.1|1256590_1257427_+	recombinase RecT	NA	A0A1B0YA63	Lactobacillus_phage	100.0	1.1e-154
WP_014566774.1|1257407_1258208_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	92.5	3.1e-143
WP_012491440.1|1258223_1259189_+	DnaD domain protein	NA	A0A1B0Y2R2	Lactobacillus_phage	100.0	1.3e-140
WP_012491441.1|1259315_1259696_-	DUF2513 domain-containing protein	NA	A0A0P0IV09	Lactobacillus_phage	100.0	1.4e-66
WP_012491442.1|1260030_1260243_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IJY1	Lactobacillus_phage	100.0	1.3e-32
WP_012491443.1|1260239_1260689_+	hypothetical protein	NA	A0A0P0ID70	Lactobacillus_phage	100.0	1.2e-72
WP_012491444.1|1260735_1260990_+	hypothetical protein	NA	A0A0P0IQP0	Lactobacillus_phage	100.0	2.6e-40
WP_003661419.1|1260986_1261352_+	endodeoxyribonuclease	NA	A0A0P0I7M2	Lactobacillus_phage	100.0	1.8e-66
WP_012491445.1|1261364_1261658_+	hypothetical protein	NA	A0A0P0IXF6	Lactobacillus_phage	100.0	2.6e-47
WP_012491447.1|1261663_1261861_+	hypothetical protein	NA	A0A1B0Y850	Lactobacillus_phage	100.0	2.8e-29
WP_012491448.1|1262231_1262675_+	autolysin regulatory protein arpU	NA	A0A0P0IZI6	Lactobacillus_phage	100.0	1.3e-79
WP_012491450.1|1264159_1265308_+	hypothetical protein	NA	A0A0P0I3G0	Lactobacillus_phage	100.0	4.6e-225
WP_016379922.1|1265300_1265624_+	phage-related protein, ribonucleoside-diphosphate reductase	NA	A0A0P0IJY9	Lactobacillus_phage	100.0	1.0e-57
WP_012491452.1|1265660_1266233_+|terminase	terminase small subunit	terminase	A0A0P0IUY4	Lactobacillus_phage	100.0	1.0e-84
WP_012491453.1|1266216_1267470_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0P0I3B0	Lactobacillus_phage	100.0	3.5e-250
WP_012491454.1|1267474_1268902_+|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	99.8	2.8e-264
WP_012491455.1|1268867_1269860_+|capsid	minor capsid protein	capsid	A0A0P0ID43	Lactobacillus_phage	100.0	1.6e-186
WP_012491456.1|1269984_1270623_+	DUF4355 domain-containing protein	NA	A0A0P0IQJ5	Lactobacillus_phage	100.0	7.2e-87
WP_003605853.1|1270635_1270950_+	hypothetical protein	NA	A0A0N7IR89	Lactobacillus_phage	100.0	2.7e-50
WP_012491457.1|1270963_1272004_+|capsid	major capsid protein	capsid	A0A0P0I7J2	Lactobacillus_phage	100.0	6.7e-191
WP_003605849.1|1272133_1272511_+	hypothetical protein	NA	A0A0P0IXC0	Lactobacillus_phage	100.0	7.4e-31
WP_012491458.1|1272514_1273393_+	hypothetical protein	NA	A0A0P0IJL6	Lactobacillus_phage	100.0	5.9e-180
WP_012491459.1|1273392_1273767_+|head,tail	phage head-tail connector protein	head,tail	A0A0P0IZF6	Lactobacillus_phage	100.0	1.0e-64
WP_012491460.1|1273771_1274074_+	hypothetical protein	NA	A0A0P0HRN0	Lactobacillus_phage	100.0	4.7e-52
WP_012491461.1|1274070_1274436_+|head,tail	phage head-tail joining protein	head,tail	A0A0P0IUZ3	Lactobacillus_phage	100.0	1.6e-59
WP_003566400.1|1274436_1274841_+	DUF3168 domain-containing protein	NA	A0A0P0I3C8	Lactobacillus_phage	100.0	4.6e-71
WP_012491462.1|1274852_1275452_+|tail	phage tail protein	tail	A0A0N7IR90	Lactobacillus_phage	100.0	6.1e-104
WP_003566397.1|1275590_1275926_+|tail	tail assembly chaperone	tail	A0A0P0IJV9	Lactobacillus_phage	100.0	9.4e-54
WP_003595195.1|1276024_1276378_+	hypothetical protein	NA	A0A0P0ID51	Lactobacillus_phage	100.0	8.7e-58
WP_012491464.1|1276370_1279706_+|tail	phage tail tape measure protein	tail	A0A0P0IQK3	Lactobacillus_phage	100.0	0.0e+00
WP_012491465.1|1279708_1281673_+|tail	phage tail family protein	tail	A0A0P0I7K0	Lactobacillus_phage	100.0	0.0e+00
WP_012491466.1|1281669_1284789_+|tail	phage tail protein	tail	A0A0P0IXD5	Lactobacillus_phage	100.0	0.0e+00
WP_012491467.1|1284798_1285122_+	hypothetical protein	NA	A0A0P0IJM9	Lactobacillus_phage	100.0	3.5e-53
WP_003573798.1|1285114_1285246_+	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	100.0	6.5e-19
WP_003581984.1|1285301_1285577_+	hypothetical protein	NA	A0A0P0IZF9	Lactobacillus_phage	100.0	7.5e-49
WP_003594199.1|1285591_1286005_+|holin	phage holin	holin	A0A0N7IR91	Lactobacillus_phage	100.0	3.1e-46
WP_012491470.1|1286015_1287200_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0P0HRN9	Lactobacillus_phage	100.0	5.1e-227
WP_012491471.1|1287244_1287469_+	hypothetical protein	NA	A0A0P0IUZ5	Lactobacillus_phage	100.0	7.2e-34
WP_012491472.1|1288110_1288890_-	DUF1829 domain-containing protein	NA	NA	NA	NA	NA
WP_003564892.1|1288991_1289279_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_012491473.1|1289460_1289991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491474.1|1290071_1290923_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_003564898.1|1290919_1291669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003601683.1|1291864_1292863_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.8	1.8e-55
1292813:1293929	attR	TGGAAGACGCCATCAGAAGTCTTCATGGGTAAAAAGTTGCACTTGAGTTGACAATTCGTCCCAGAAAAAAAGCCCGGCGACAAGCACCGAGCTAGCTTCACAGTCAGTTTTTTAGGATTTGACCACATCGACATTAGCATACAAGTTTGCAATGATTGCCAGCATGTCTTTTTCAGTCCGGTCCCAGCCGATCGTTTTAAGAAAGGCTTGACCATTTTGGACTTGGTTGCTGATCGCGTCAGGGTTGGCACAAGCATTTGCAAGCGTTTTGGCCAGATCTCGTTCATCAAGGTGACTGGCAAAATAGGTCCCGTCTTTCAAGAAGTAGCTTCCTGTGCCTTCCTTAAAATCAATGAGTGGCAGGCCAGTGCTCATCATTTCATAAGGGACAAGCGAAAAATTGGTCATAGATGGCGCGATCCCGAAATCAGCACTTTGGTAAAGTCGATTTAATTCCGGGGGAGTCAGCTTACCAAGGTTTTCACCATTGATGAATCGTTTGCTGCGGCCGGTACCGAAGTATTGAATTTTGAGATCGATTCCTTTGGCGCGCAGTAACTGGCGGCAATTTTCGAGGACAATCTGAATGTTGATGGGTGCGCGCCGCGGGCTGCTCCACTTGGTATAGACAGCAAGCTTGATTTGCTTCTTTTGTTGATAAGGTCCCATGTCGCGTTCCTTGAATGGATACCGTGCGACATCGACAGGAAAGTTAATCACATCAATAGGACTGTGAACCTTGCAATGCATGGTGATCATGTGGGCACACCATGGACCAAGCGATACCATGTGCAGACCTAGACTGTAAGTTCGTCGCGCCATCTGATAGCGATCGCCATATGGATAGAAATACGGTTCGTAATCTTGAACAAAATACATTTTGTACCCCGGTTTGTTCTTGATCACATAAACGGATTCCCATAACGTGGCGACCCAAATATCGGAACGATGGGACTCAAGTTCGCCCATTGGCAGACAGGTTCCTTTGTAACCGGGATAATTAAATTCAGCATTCTGAATCATTTCGTCTTGGCTTTGTGGGACATAGCTTAAATAGTAGACATCGTAACCGGCGTTGGCCAGCAGCGTACCTAGATGCAGCATCGTTGTTTGACCG	NA	NA	NA	NA
>prophage 8
NC_018641	Lacticaseibacillus paracasei, complete genome	3075780	1383813	1439503	3075780	lysis,transposase,tRNA	Leptospira_phage(28.57%)	53	NA	NA
WP_003599410.1|1383813_1384743_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_012491515.1|1385181_1385892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491519.1|1387783_1388365_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_012491520.1|1388460_1389540_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_012491521.1|1389544_1390477_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_012491522.1|1390545_1390866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491523.1|1391047_1392802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491524.1|1393407_1393596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491525.1|1393597_1393777_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012491526.1|1393891_1394500_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157847124.1|1394424_1394814_+|transposase	transposase	transposase	S5VLC8	Leptospira_phage	37.1	5.1e-11
WP_016364311.1|1394704_1395169_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014951865.1|1395165_1395372_+|transposase	transposase domain-containing protein	transposase	S5VTD3	Leptospira_phage	40.7	2.9e-05
WP_003565106.1|1395677_1396289_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_012491531.1|1396464_1396947_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_003565110.1|1397123_1398827_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_003574834.1|1399135_1400293_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_012491532.1|1400309_1401527_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_003570094.1|1401832_1402486_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_014566514.1|1402857_1405500_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	41.4	2.7e-151
WP_012491533.1|1405791_1407069_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003565122.1|1407260_1407905_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003565124.1|1407966_1408635_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_003565127.1|1408774_1409776_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_012491534.1|1409864_1410725_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003574845.1|1410726_1411257_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_012491535.1|1411270_1411927_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_003565134.1|1411927_1412725_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_003565136.1|1413390_1414047_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003565139.1|1414059_1414698_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.5	2.6e-28
WP_003565141.1|1414694_1415507_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014951866.1|1415739_1416582_+	PLDc N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_014951867.1|1416632_1417172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014951868.1|1417256_1417376_-	DUF4044 domain-containing protein	NA	NA	NA	NA	NA
WP_003565147.1|1417726_1418059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003565152.1|1418667_1419609_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_003565154.1|1419621_1419987_+	cell division protein FtsL	NA	NA	NA	NA	NA
WP_014566515.1|1419983_1422131_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_003565157.1|1422145_1423111_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_012491540.1|1423141_1424521_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_003570121.1|1424520_1425612_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_003565163.1|1425617_1426472_+	cell division protein FtsQ/DivIB	NA	NA	NA	NA	NA
WP_003565166.1|1426581_1427928_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_003565171.1|1429228_1429684_+	cell division protein SepF	NA	NA	NA	NA	NA
WP_003565173.1|1429695_1429989_+	YggT family protein	NA	NA	NA	NA	NA
WP_012491541.1|1429995_1430775_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_012491542.1|1430832_1431615_+	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_012491543.1|1431861_1434648_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	27.0	5.4e-86
WP_003570139.1|1434660_1434882_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_003565182.1|1435018_1435924_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_003658327.1|1436099_1437536_+	MFS transporter	NA	NA	NA	NA	NA
WP_003565187.1|1437632_1438844_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	26.3	1.5e-32
WP_003578969.1|1438840_1439503_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis family protein	lysis	NA	NA	NA	NA
>prophage 9
NC_018641	Lacticaseibacillus paracasei, complete genome	3075780	2051077	2072916	3075780	transposase,protease	unidentified_phage(40.0%)	17	NA	NA
WP_012491745.1|2051077_2051839_+|protease	matrixin family metalloprotease	protease	G9I094	Helicoverpa_zea_nudivirus	53.1	1.7e-05
WP_003599410.1|2052006_2052936_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_012491746.1|2053060_2053828_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_012491747.1|2054140_2055736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003566275.1|2056436_2056766_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012491748.1|2057142_2057787_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_012491750.1|2059336_2059981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491751.1|2059961_2060252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123018123.1|2060681_2061468_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012491754.1|2062166_2062688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148276978.1|2062860_2063977_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.9	4.6e-28
WP_003595460.1|2065236_2066145_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003599410.1|2066428_2067358_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_012491757.1|2067471_2068368_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_014566584.1|2068371_2069229_-	M55 family metallopeptidase	NA	NA	NA	NA	NA
WP_012491759.1|2069228_2070314_-	M42 family peptidase	NA	NA	NA	NA	NA
WP_002816607.1|2072232_2072916_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	2.1e-60
>prophage 11
NC_018641	Lacticaseibacillus paracasei, complete genome	3075780	3029473	3040842	3075780	terminase,capsid,portal,tail,head	uncultured_Caudovirales_phage(37.5%)	17	NA	NA
WP_012492208.1|3029473_3030112_-	helix-turn-helix domain-containing protein	NA	L0P7E1	Lactobacillus_phage	27.6	2.4e-05
WP_003594046.1|3030279_3030555_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012492209.1|3030622_3030844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012492211.1|3030954_3031146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012492212.1|3031192_3031483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014566704.1|3031479_3031668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014566705.1|3031651_3032464_+	bifunctional DNA primase/polymerase	NA	Q854C1	Mycobacterium_phage	34.2	6.7e-13
WP_012492215.1|3032476_3034063_+	primase	NA	A0A1B1P7L5	Bacillus_phage	27.9	4.0e-25
WP_012492216.1|3034388_3034724_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_012492217.1|3034728_3034914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014952495.1|3034910_3035333_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	45.4	1.2e-21
WP_010489224.1|3035449_3035920_+|terminase	phage terminase small subunit P27 family	terminase	M1PKP2	Streptococcus_phage	26.5	4.6e-06
WP_012492218.1|3035916_3037620_+|terminase	terminase	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	42.1	2.3e-116
WP_014952496.1|3037585_3037765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010489222.1|3037769_3038951_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	35.5	2.8e-60
WP_012492220.1|3038937_3040494_+|capsid	phage major capsid protein	capsid	A0A2H4J9X8	uncultured_Caudovirales_phage	32.0	4.6e-34
WP_003574397.1|3040548_3040842_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
