The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_019904	Echinicola vietnamensis DSM 17526, complete sequence	5608040	2970184	3028209	5608040	integrase,transposase,protease	Acinetobacter_phage(30.0%)	52	3022063:3022091	3025526:3025554
WP_157501754.1|2970184_2972056_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015266300.1|2972216_2973110_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_015266301.1|2973359_2974058_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.1	4.6e-26
WP_015266302.1|2974066_2974270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015266303.1|2974423_2975083_-	fructose-6-phosphate aldolase	NA	M1PR54	Cyanophage	44.5	4.2e-45
WP_015266304.1|2975574_2975883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015266305.1|2975900_2976128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015266306.1|2976556_2977966_+	anthranilate synthase component I family protein	NA	A0A0B5J984	Pandoravirus	34.0	1.6e-22
WP_015266307.1|2978003_2978384_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_015266308.1|2978458_2979028_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	43.0	3.6e-37
WP_015266309.1|2979211_2980228_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	31.8	7.3e-41
WP_015266310.1|2980231_2981050_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	42.5	8.2e-43
WP_015266311.1|2981053_2981674_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_015266312.1|2981707_2982886_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_015266313.1|2982998_2983775_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_015266314.1|2983914_2984934_+	bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase	NA	NA	NA	NA	NA
WP_015266315.1|2985233_2986028_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_015266316.1|2986244_2986829_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_015266317.1|2986831_2987551_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_015266318.1|2987686_2988442_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_015266319.1|2988465_2989071_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_015266320.1|2989149_2990478_-|protease	periplasmic protease	protease	NA	NA	NA	NA
WP_015266321.1|2990634_2991300_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015266322.1|2991312_2992635_+	AarF/ABC1/UbiB kinase family protein	NA	NA	NA	NA	NA
WP_015266323.1|2993037_2994231_-	sorbosone dehydrogenase family protein	NA	NA	NA	NA	NA
WP_041739767.1|2994331_2996254_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	1.4e-56
WP_015266325.1|2996358_2997627_+	DUF5103 domain-containing protein	NA	NA	NA	NA	NA
WP_015266326.1|2998334_2999201_-	CRISPR-associated endoribonuclease Cas6	NA	NA	NA	NA	NA
WP_015266327.1|2999314_3000412_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_015266328.1|3000423_3001509_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_015266329.1|3001642_3001981_-	DUF3276 family protein	NA	NA	NA	NA	NA
WP_015266330.1|3002177_3002525_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_015266331.1|3002899_3003916_+	acyl-CoA reductase	NA	NA	NA	NA	NA
WP_015266332.1|3004012_3005320_+	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_015266333.1|3005644_3007918_+	aconitate hydratase	NA	NA	NA	NA	NA
WP_083891973.1|3008015_3008630_+	PepSY-like domain-containing protein	NA	NA	NA	NA	NA
WP_015266335.1|3008638_3009358_+	DUF2490 domain-containing protein	NA	NA	NA	NA	NA
WP_015266336.1|3009453_3011346_+	response regulator	NA	A0A1V0SGX0	Hokovirus	30.8	2.0e-47
WP_015266337.1|3011333_3012281_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015266338.1|3012794_3013148_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_015266339.1|3013175_3014189_+	cation transporter	NA	NA	NA	NA	NA
WP_015266340.1|3014219_3014633_-	VOC family protein	NA	NA	NA	NA	NA
WP_015266341.1|3014755_3015736_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041739769.1|3016012_3018370_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_157501378.1|3018372_3019185_+	DUF4249 family protein	NA	NA	NA	NA	NA
WP_015266344.1|3019450_3019648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015266346.1|3019991_3021170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169316437.1|3021537_3021951_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
3022063:3022091	attL	CATTATGTGAAGTATATGATTATGTAAAG	NA	NA	NA	NA
WP_015263897.1|3022220_3023489_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_157501578.1|3023457_3024465_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3Y5J2	Fusobacterium_phage	31.4	3.4e-06
WP_015263899.1|3024451_3025465_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A059T688	Listeria_phage	22.2	1.1e-07
WP_015266349.1|3025944_3028209_+|protease	periplasmic protease	protease	NA	NA	NA	NA
3025526:3025554	attR	CTTTACATAATCATATACTTCACATAATG	NA	NA	NA	NA
