The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	0	16945	5875750		Bacillus_virus(100.0%)	13	NA	NA
WP_003131987.1|735_1011_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_003131974.1|1023_1374_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_003131969.1|1445_1880_+	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_043936042.1|4838_5642_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015268378.1|5666_7412_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_015268379.1|7630_9121_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015268380.1|9133_10027_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_015268381.1|10098_11427_-	MFS transporter	NA	NA	NA	NA	NA
WP_015268382.1|11611_12931_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_015268383.1|13025_13748_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015268384.1|14087_14780_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015268385.1|14906_15758_+	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015268386.1|15832_16945_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.9	8.6e-27
>prophage 2
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	23043	24897	5875750		Lactococcus_phage(100.0%)	1	NA	NA
WP_015268392.1|23043_24897_+	DEAD/DEAH box helicase family protein	NA	A0A1W6JHS6	Lactococcus_phage	25.7	2.5e-07
>prophage 3
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	34694	38984	5875750		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_015268399.1|34694_36530_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.3	5.6e-132
WP_015268400.1|36533_37310_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015268401.1|37616_38984_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	35.0	4.9e-32
>prophage 4
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	46369	48043	5875750		Bifidobacterium_phage(50.0%)	2	NA	NA
WP_003260029.1|46369_47242_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	33.5	5.5e-13
WP_012274913.1|47251_48043_-	ParA family protein	NA	Q8JL10	Natrialba_phage	35.3	5.0e-21
>prophage 5
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	54314	61915	5875750		Staphylococcus_phage(33.33%)	8	NA	NA
WP_015268406.1|54314_54560_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	52.2	1.8e-14
WP_003260020.1|54552_54957_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003253163.1|54970_55105_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_137108947.1|55190_55532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015268407.1|55700_57227_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_015268408.1|57267_58371_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	37.0	9.4e-58
WP_003260018.1|58386_59490_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_015268409.1|59494_61915_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.3	8.2e-115
>prophage 6
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	74685	75363	5875750		Bacillus_phage(100.0%)	1	NA	NA
WP_011953086.1|74685_75363_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.2	2.3e-30
>prophage 7
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	87246	89640	5875750		uncultured_virus(100.0%)	1	NA	NA
WP_015268413.1|87246_89640_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.1	1.3e-67
>prophage 8
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	95493	95703	5875750		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_015268418.1|95493_95703_+	hypothetical protein	NA	A0A2H4JG60	uncultured_Caudovirales_phage	66.1	2.7e-14
>prophage 9
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	101368	102043	5875750		Bacillus_phage(100.0%)	1	NA	NA
WP_015268421.1|101368_102043_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.1	2.7e-31
>prophage 10
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	106121	107105	5875750		Shigella_phage(100.0%)	1	NA	NA
WP_010951445.1|106121_107105_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	38.3	2.4e-49
>prophage 11
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	112002	114000	5875750		Streptococcus_phage(100.0%)	1	NA	NA
WP_010951452.1|112002_114000_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	40.7	1.1e-117
>prophage 12
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	122700	123375	5875750		Bacillus_phage(100.0%)	1	NA	NA
WP_003253420.1|122700_123375_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.7	1.4e-27
>prophage 13
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	127421	130748	5875750		Acanthocystis_turfacea_Chlorella_virus(33.33%)	3	NA	NA
WP_043935155.1|127421_129794_+	DEAD/DEAH box helicase	NA	M1HKT1	Acanthocystis_turfacea_Chlorella_virus	30.2	5.0e-32
WP_015268425.1|130067_130439_-	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	70.1	1.8e-42
WP_015268426.1|130445_130748_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	41.8	2.7e-15
>prophage 14
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	137096	138743	5875750		Catovirus(100.0%)	1	NA	NA
WP_015268433.1|137096_138743_+	GMC family oxidoreductase N-terminal domain-containing protein	NA	A0A1V0S9M4	Catovirus	29.4	1.6e-53
>prophage 15
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	150703	152515	5875750		Synechococcus_phage(50.0%)	2	NA	NA
WP_003260000.1|150703_151210_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	8.7e-19
WP_015268439.1|151417_152515_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	36.0	1.5e-23
>prophage 16
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	180089	185525	5875750		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_015268461.1|180089_181622_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	7.7e-26
WP_043935172.1|181753_182395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015268462.1|182764_183892_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_015268463.1|183935_185525_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	35.0	3.4e-08
>prophage 17
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	192983	198850	5875750		Planktothrix_phage(33.33%)	5	NA	NA
WP_015268469.1|192983_193991_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	7.5e-30
WP_015268470.1|194218_196354_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	50.5	2.2e-143
WP_015268471.1|196463_197171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003256958.1|197298_198081_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_015268472.1|198073_198850_-	zinc ABC transporter ATP-binding protein ZnuC	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	2.4e-12
>prophage 18
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	202003	204751	5875750		uncultured_virus(100.0%)	1	NA	NA
WP_015268477.1|202003_204751_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.2	5.9e-69
>prophage 19
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	208660	215022	5875750		Bacillus_phage(33.33%)	4	NA	NA
WP_015268482.1|208660_210604_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.4	1.3e-17
WP_013970322.1|210684_211473_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	32.2	1.0e-13
WP_015268483.1|211595_213200_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_015268484.1|213240_215022_-	PAS domain-containing protein	NA	A0A1V0SGX0	Hokovirus	27.3	6.2e-19
>prophage 20
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	223817	224609	5875750		Pithovirus(100.0%)	1	NA	NA
WP_015268492.1|223817_224609_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.9	2.0e-09
>prophage 21
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	230291	231062	5875750		Moraxella_phage(100.0%)	1	NA	NA
WP_015268497.1|230291_231062_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.9	2.3e-39
>prophage 22
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	266538	299363	5875750		Bacillus_phage(33.33%)	6	NA	NA
WP_015268516.1|266538_268695_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	28.3	1.8e-36
WP_015268517.1|269681_295709_+	type I secretion C-terminal target domain-containing protein	NA	A0A1I9L2D8	Xanthomonas_phage	33.6	3.0e-05
WP_015268518.1|296014_296356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015268519.1|296555_297455_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_015268520.1|297473_298493_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015268521.1|298499_299363_+	ABC transporter ATP-binding protein	NA	M1HRF1	Paramecium_bursaria_Chlorella_virus	29.8	1.0e-06
>prophage 23
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	326834	337893	5875750		Escherichia_phage(40.0%)	13	NA	NA
WP_015268549.1|326834_328745_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.4	1.8e-64
WP_015268550.1|328744_329332_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_015268551.1|329535_330168_+	LysE family transporter	NA	NA	NA	NA	NA
WP_015268552.1|330216_330969_-	slipin family protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	30.7	5.4e-25
WP_015268553.1|330971_332318_-	nodulation protein NfeD	NA	NA	NA	NA	NA
WP_015268554.1|332416_332875_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_015268555.1|332936_333179_+	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_015268556.1|333248_333887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015268557.1|333893_334331_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	31.9	3.3e-06
WP_015268558.1|334561_336292_-	dipeptidase	NA	NA	NA	NA	NA
WP_015268559.1|336466_336790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015268560.1|336847_337378_-	DUF5384 family protein	NA	A0A077SL46	Escherichia_phage	55.1	4.1e-11
WP_015268561.1|337389_337893_-	hypothetical protein	NA	A0A077SK39	Escherichia_phage	44.5	1.9e-18
>prophage 24
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	343496	346644	5875750		Bacillus_virus(100.0%)	4	NA	NA
WP_015268566.1|343496_344348_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	5.9e-36
WP_015268567.1|344344_345310_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_015268568.1|345309_345591_+	DUF971 domain-containing protein	NA	NA	NA	NA	NA
WP_015268569.1|345780_346644_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.6	7.4e-34
>prophage 25
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	357739	366723	5875750		Bacillus_phage(50.0%)	7	NA	NA
WP_015268577.1|357739_359017_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.3	3.9e-31
WP_015268578.1|359152_360415_+	response regulator	NA	NA	NA	NA	NA
WP_015268579.1|360530_361559_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.9	1.3e-16
WP_015268580.1|361659_362844_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_043935215.1|362990_364886_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.9	3.9e-11
WP_008096606.1|364979_365624_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015268582.1|365613_366723_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.4	4.9e-30
>prophage 26
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	371792	372551	5875750		Bacillus_phage(100.0%)	1	NA	NA
WP_013970435.1|371792_372551_-	L-cystine ABC transporter ATP-binding protein YecC	NA	W8CYL7	Bacillus_phage	33.7	3.9e-15
>prophage 27
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	375671	380254	5875750	holin	Vibrio_phage(50.0%)	3	NA	NA
WP_167506610.1|375671_377633_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.0	2.1e-20
WP_015268590.1|377747_378581_-	taurine dioxygenase	NA	NA	NA	NA	NA
WP_023660883.1|379465_380254_-	taurine ABC transporter ATP-binding subunit	NA	G3M9Y6	Bacillus_virus	35.9	5.9e-30
>prophage 28
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	387783	388596	5875750		Planktothrix_phage(100.0%)	1	NA	NA
WP_013970450.1|387783_388596_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.6	6.3e-27
>prophage 29
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	394265	458604	5875750	bacteriocin,protease,holin	Bacillus_phage(36.36%)	60	NA	NA
WP_012270052.1|394265_395006_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	36.3	4.5e-32
WP_013970454.1|395019_396333_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.0	2.8e-08
WP_015268602.1|396447_397353_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.0	3.6e-39
WP_169774668.1|397349_397799_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_013970457.1|397941_398343_+	RNA-binding protein S4	NA	NA	NA	NA	NA
WP_015268603.1|398537_399332_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_015268604.1|399454_400354_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_015268605.1|400533_402075_+	phosphoenolpyruvate carboxykinase	NA	A0A2H4PQN1	Staphylococcus_phage	46.9	1.5e-125
WP_015268606.1|402251_402692_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_015268607.1|402747_403230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015268608.1|403547_405893_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_015268609.1|405898_406729_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_015268610.1|406914_407355_+	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
WP_003257447.1|407467_408130_-	GMP/IMP nucleotidase	NA	NA	NA	NA	NA
WP_015268611.1|408194_408761_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_015268612.1|408757_409576_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_015268613.1|409789_410245_-	YiiD C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_015268614.1|410244_411651_-	sigma-54-dependent Fis family transcriptional regulator	NA	W8CYM9	Bacillus_phage	28.7	3.9e-08
WP_015268615.1|411647_413462_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_015268616.1|413504_414050_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.5	9.3e-51
WP_015268617.1|414329_415436_+	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	50.6	1.5e-103
WP_015268618.1|415951_418030_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_015268619.1|418532_419852_+	OprD family porin	NA	NA	NA	NA	NA
WP_015268620.1|419969_421637_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_043936049.1|421877_423245_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_015268622.1|423246_423966_-	response regulator	NA	W8CYM9	Bacillus_phage	34.1	4.1e-30
WP_015268623.1|424106_426404_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_015268624.1|426685_426892_-	DUF3079 domain-containing protein	NA	NA	NA	NA	NA
WP_015268625.1|427218_427467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015268626.1|428031_428307_+	DUF3077 domain-containing protein	NA	NA	NA	NA	NA
WP_015268627.1|428658_429864_-	methyltransferase	NA	NA	NA	NA	NA
WP_015268628.1|429992_430682_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015268629.1|430681_431374_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015268630.1|431428_432184_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003257472.1|432195_432969_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.0	8.4e-21
WP_013970487.1|433633_435019_+	GABA permease	NA	NA	NA	NA	NA
WP_013970488.1|435198_435642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161551498.1|435699_436572_-	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_015268632.1|436923_437226_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	50.0	7.8e-15
WP_003257478.1|437530_437803_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_015268633.1|437799_438867_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_015268634.1|438863_441110_-	AsmA family protein	NA	NA	NA	NA	NA
WP_015268635.1|441415_443077_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_003255736.1|443360_443954_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_013970493.1|443954_444593_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_003257483.1|444593_444854_+	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_015268636.1|444881_445619_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_013970495.1|445629_446400_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_003257485.1|446520_447699_-|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	36.2	1.9e-24
WP_169774667.1|447695_448544_-|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_015268637.1|448625_449573_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_015268638.1|450026_451403_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_015268639.1|451860_452967_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003257487.1|453087_453345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015268640.1|453712_454189_-	thioesterase family protein	NA	NA	NA	NA	NA
WP_015268641.1|454199_455165_-	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
WP_015268642.1|455183_456068_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_015268643.1|456194_457139_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_015268644.1|457286_458231_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_015268645.1|458352_458604_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 30
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	471898	472657	5875750		Bacteriophage(100.0%)	1	NA	NA
WP_015268652.1|471898_472657_+	RHS repeat-associated core domain-containing protein	NA	B6SD27	Bacteriophage	32.3	3.4e-19
>prophage 31
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	480806	482060	5875750		Aeromonas_phage(100.0%)	1	NA	NA
WP_013970518.1|480806_482060_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	3.9e-100
>prophage 32
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	488982	491698	5875750		Tupanvirus(50.0%)	2	NA	NA
WP_015268662.1|488982_490182_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	28.5	3.8e-12
WP_080604833.1|491107_491698_-	RHS repeat-associated core domain-containing protein	NA	A0A1W5K0N1	Bacteriophage	41.9	4.7e-24
>prophage 33
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	499114	499795	5875750		Bacillus_phage(100.0%)	1	NA	NA
WP_015268671.1|499114_499795_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	37.0	1.6e-31
>prophage 34
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	542505	543678	5875750		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_015268697.1|542505_543678_+	8-amino-7-oxononanoate synthase	NA	D2TEZ5	Emiliania_huxleyi_virus	26.7	3.7e-28
>prophage 35
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	552332	554745	5875750		Lactobacillus_phage(50.0%)	2	NA	NA
WP_004375209.1|552332_553256_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.7	6.7e-09
WP_015268704.1|553464_554745_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	A0A1V0SKB7	Klosneuvirus	27.8	6.0e-16
>prophage 36
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	560514	562815	5875750		Klosneuvirus(100.0%)	1	NA	NA
WP_015268708.1|560514_562815_-	pyrroloquinoline quinone biosynthesis protein PqqF	NA	A0A1V0SJA4	Klosneuvirus	25.9	6.4e-16
>prophage 37
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	568407	587212	5875750	tRNA	Bacillus_phage(28.57%)	14	NA	NA
WP_015268714.1|568407_572151_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	37.4	1.8e-15
WP_013970578.1|572464_574315_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.2	2.4e-37
WP_013970579.1|574382_576365_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.2e-73
WP_003255575.1|576668_576884_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_015268715.1|577088_578114_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	56.1	8.6e-106
WP_004375186.1|578117_578687_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_004375185.1|578761_579118_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_015268716.1|579108_579618_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_015268717.1|579666_580773_-	multifunctional CCA addition/repair protein	NA	A0A292GDU1	Xanthomonas_phage	41.2	1.5e-60
WP_013970585.1|580828_582397_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_013970586.1|582393_583665_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	38.1	8.4e-10
WP_015268718.1|583795_585718_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_015268719.1|586001_586331_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_015268720.1|586345_587212_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	32.0	1.8e-08
>prophage 38
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	600906	602031	5875750		Bacillus_virus(100.0%)	1	NA	NA
WP_012270208.1|600906_602031_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	1.6e-28
>prophage 39
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	610887	613370	5875750		Acinetobacter_phage(100.0%)	3	NA	NA
WP_015268734.1|610887_611481_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.8	5.3e-76
WP_013970609.1|611490_612540_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	58.4	1.4e-111
WP_015268735.1|612536_613370_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.5	4.0e-69
>prophage 40
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	621304	624232	5875750		Lake_Baikal_phage(50.0%)	3	NA	NA
WP_015268740.1|621304_621655_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	3.0e-26
WP_015268741.1|621714_622806_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_015268742.1|622810_624232_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2P1JY73	Gordonia_phage	43.4	2.5e-18
>prophage 41
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	638933	650609	5875750		Phaeocystis_globosa_virus(33.33%)	5	NA	NA
WP_013970631.1|638933_643007_+	DNA-directed RNA polymerase subunit beta	NA	R4TQG3	Phaeocystis_globosa_virus	27.5	5.2e-21
WP_013970632.1|643071_647271_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.9	1.4e-66
WP_003257088.1|647482_647854_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_003246741.1|647960_648431_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_015268748.1|648461_650609_+	elongation factor G	NA	A0A1S5SF82	Streptococcus_phage	25.0	8.2e-50
>prophage 42
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	665833	672949	5875750		Tupanvirus(33.33%)	5	NA	NA
WP_015268751.1|665833_667273_+	catalase	NA	A0A2K9L0T1	Tupanvirus	39.3	6.2e-102
WP_003257116.1|667437_667902_+	bacterioferritin	NA	NA	NA	NA	NA
WP_013970642.1|668038_670873_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.4	1.8e-310
WP_015268752.1|671002_672397_+	MFS transporter	NA	NA	NA	NA	NA
WP_013970644.1|672406_672949_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	68.0	1.2e-45
>prophage 43
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	679582	680533	5875750		Escherichia_phage(100.0%)	1	NA	NA
WP_015268757.1|679582_680533_+	formate dehydrogenase subunit beta	NA	A0A077SL61	Escherichia_phage	31.1	7.4e-19
>prophage 44
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	683693	685616	5875750		Tupanvirus(100.0%)	1	NA	NA
WP_015268760.1|683693_685616_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.8	1.4e-11
>prophage 45
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	692338	693271	5875750		Catovirus(100.0%)	1	NA	NA
WP_015268765.1|692338_693271_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	35.1	6.5e-44
>prophage 46
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	697764	709307	5875750		Staphylococcus_phage(57.14%)	16	NA	NA
WP_015268771.1|697764_698475_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.2	1.8e-22
WP_015268772.1|698475_699054_-	DUF2796 domain-containing protein	NA	NA	NA	NA	NA
WP_043935270.1|699185_699530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013970670.1|699661_700534_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	37.4	3.3e-13
WP_003259339.1|700565_701237_-	methyltransferase	NA	NA	NA	NA	NA
WP_015268774.1|701237_701690_-	YbaY family lipoprotein	NA	NA	NA	NA	NA
WP_003255402.1|701796_702261_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_015268775.1|702263_703394_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	30.7	4.8e-41
WP_003255399.1|703436_704102_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	36.9	6.9e-32
WP_003259341.1|704120_705212_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	35.0	2.4e-50
WP_003255395.1|705304_705781_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.7	7.2e-31
WP_013970674.1|705777_706278_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_015268776.1|706296_707265_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_015268777.1|707261_707765_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_015268778.1|707781_708525_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015268779.1|708689_709307_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.4	2.0e-41
>prophage 47
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	714047	716217	5875750		Staphylococcus_phage(50.0%)	2	NA	NA
WP_015268784.1|714047_714698_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	39.1	6.3e-38
WP_015268785.1|715011_716217_+	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.7	3.6e-135
>prophage 48
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	724103	727974	5875750		Planktothrix_phage(33.33%)	4	NA	NA
WP_015268794.1|724103_724790_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	5.1e-30
WP_015268795.1|724786_725938_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_015268796.1|726369_727071_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	30.8	7.3e-16
WP_003255365.1|727446_727974_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	71.1	2.1e-68
>prophage 49
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	744515	745622	5875750		Mycobacterium_phage(100.0%)	1	NA	NA
WP_015268809.1|744515_745622_-	acetoin dehydrogenase dihydrolipoyllysine-residue acetyltransferase subunit	NA	A0A1I9SC21	Mycobacterium_phage	32.1	4.3e-10
>prophage 50
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	755584	759133	5875750		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_015268815.1|755584_757546_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.4	7.8e-23
WP_015268816.1|757774_759133_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.3	2.1e-19
>prophage 51
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	784581	789498	5875750		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_015268831.1|784581_786525_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.6	1.3e-22
WP_015268832.1|786691_787102_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_015268833.1|787098_789498_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	39.8	3.6e-123
>prophage 52
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	795166	795751	5875750		Streptococcus_phage(100.0%)	1	NA	NA
WP_015268839.1|795166_795751_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	36.2	4.1e-20
>prophage 53
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	813620	816452	5875750	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_015268847.1|813620_816452_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	24.9	5.3e-81
>prophage 54
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	823518	828023	5875750		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_015268856.1|823518_824481_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	A0A2H4UV25	Bodo_saltans_virus	29.2	1.2e-05
WP_015268857.1|824477_825218_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_015268858.1|825458_828023_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.8	7.8e-124
>prophage 55
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	837339	842438	5875750		Enterobacteria_phage(50.0%)	4	NA	NA
WP_158242119.1|837339_838626_+	AAA family ATPase	NA	Q2P9X8	Enterobacteria_phage	27.2	8.5e-10
WP_015268866.1|838627_839608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080604838.1|839604_841188_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_015268868.1|841214_842438_+	DNA cytosine methyltransferase	NA	I6NLI4	Burkholderia_phage	45.2	4.8e-87
>prophage 56
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	855827	859613	5875750		Pandoravirus(50.0%)	3	NA	NA
WP_015268882.1|855827_857099_+	cystathionine gamma-synthase family protein	NA	S4VRH6	Pandoravirus	27.0	1.6e-13
WP_043935306.1|857242_858691_+	amino acid permease	NA	NA	NA	NA	NA
WP_015268884.1|858728_859613_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	29.2	3.3e-21
>prophage 57
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	865681	873716	5875750		Aeromonas_phage(33.33%)	4	NA	NA
WP_003256308.1|865681_866935_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	54.6	2.4e-102
WP_043935307.1|867276_871107_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	29.4	1.5e-14
WP_015268892.1|871355_871757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015268893.1|872048_873716_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	28.2	3.7e-42
>prophage 58
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	888266	889385	5875750		Streptococcus_phage(100.0%)	1	NA	NA
WP_015268899.1|888266_889385_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	38.0	5.0e-59
>prophage 59
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	915714	916482	5875750		Planktothrix_phage(100.0%)	1	NA	NA
WP_170929289.1|915714_916482_-	ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA	NA	G9BWD6	Planktothrix_phage	40.2	2.0e-30
>prophage 60
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	926406	927792	5875750		Klosneuvirus(100.0%)	1	NA	NA
WP_015268929.1|926406_927792_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.1	8.8e-13
>prophage 61
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	940151	941093	5875750		Tupanvirus(100.0%)	1	NA	NA
WP_003247410.1|940151_941093_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.0	1.7e-44
>prophage 62
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	949537	956889	5875750		Pseudomonas_phage(25.0%)	8	NA	NA
WP_013970909.1|949537_950620_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	44.8	7.4e-07
WP_015268943.1|950619_951450_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_013970911.1|951443_952199_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_015268944.1|952191_952989_+	glutamate racemase	NA	NA	NA	NA	NA
WP_015268945.1|953090_953609_+	acyloxyacyl hydrolase	NA	A0A2H4J0I5	uncultured_Caudovirales_phage	55.6	1.3e-46
WP_043935321.1|953849_954560_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015268947.1|954556_955999_-	deoxyribodipyrimidine photo-lyase	NA	A0A2H4UV63	Bodo_saltans_virus	31.7	1.0e-48
WP_015268948.1|955989_956889_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	31.2	3.8e-17
>prophage 63
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	961186	962461	5875750		Enterobacteria_phage(100.0%)	1	NA	NA
WP_013970921.1|961186_962461_-	uracil-xanthine permease	NA	Q9KX94	Enterobacteria_phage	38.6	3.2e-62
>prophage 64
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	970890	971511	5875750		Bacillus_phage(100.0%)	1	NA	NA
WP_003260669.1|970890_971511_+	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	27.1	4.0e-05
>prophage 65
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	974561	977460	5875750		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_015268956.1|974561_975527_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	28.4	2.6e-19
WP_015268957.1|975777_977460_+	fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	26.1	6.0e-32
>prophage 66
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	998657	999620	5875750		Bacillus_virus(100.0%)	1	NA	NA
WP_015268972.1|998657_999620_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	41.5	3.7e-58
>prophage 67
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1003055	1003628	5875750		Sphingobium_phage(100.0%)	1	NA	NA
WP_015268974.1|1003055_1003628_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	37.0	2.9e-10
>prophage 68
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1006711	1009564	5875750		Hokovirus(100.0%)	1	NA	NA
WP_015268977.1|1006711_1009564_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.7	3.2e-09
>prophage 69
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1018390	1022167	5875750		Bacillus_phage(50.0%)	2	NA	NA
WP_015268985.1|1018390_1019065_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.3	2.7e-31
WP_015268986.1|1019074_1022167_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.7	2.5e-60
>prophage 70
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1044515	1048442	5875750		Organic_Lake_phycodnavirus(50.0%)	5	NA	NA
WP_015269001.1|1044515_1045310_+	phosphonate ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	26.1	7.1e-07
WP_015269002.1|1045303_1046131_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015269003.1|1046127_1046895_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_015269004.1|1047034_1047928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080604915.1|1048148_1048442_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	49.0	2.5e-18
>prophage 71
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1053409	1057749	5875750	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_013971009.1|1053409_1054525_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.8	6.3e-94
WP_003259111.1|1054567_1054903_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	43.5	2.2e-10
WP_015269010.1|1054967_1056830_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_013971011.1|1056840_1057749_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	42.0	1.5e-48
>prophage 72
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1061860	1067372	5875750		Faustovirus(20.0%)	8	NA	NA
WP_013971017.1|1061860_1063075_+	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	29.9	2.0e-32
WP_003248539.1|1063121_1063508_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.2	2.7e-52
WP_003257854.1|1063536_1063860_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	50.5	1.5e-24
WP_015269012.1|1063868_1064390_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_015269013.1|1064432_1066295_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.6	2.4e-106
WP_013971020.1|1066298_1066640_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_003257859.1|1066650_1066851_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_013971021.1|1066940_1067372_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	40.9	1.3e-18
>prophage 73
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1071495	1072785	5875750	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_015269018.1|1071495_1072785_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.7	1.2e-24
>prophage 74
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1084998	1085679	5875750		Synechococcus_phage(100.0%)	1	NA	NA
WP_015269025.1|1084998_1085679_+	Fe2+-dependent dioxygenase	NA	V5UR52	Synechococcus_phage	29.8	3.1e-19
>prophage 75
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1096479	1098063	5875750		Tupanvirus(100.0%)	1	NA	NA
WP_003257876.1|1096479_1098063_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	30.9	6.1e-10
>prophage 76
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1102341	1104278	5875750		Bacillus_virus(50.0%)	2	NA	NA
WP_015269038.1|1102341_1103310_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.9	1.3e-18
WP_015269039.1|1103309_1104278_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	3.9e-15
>prophage 77
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1120298	1120673	5875750		Synechococcus_phage(100.0%)	1	NA	NA
WP_015269048.1|1120298_1120673_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	62.9	3.3e-23
>prophage 78
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1139541	1148639	5875750		Bacillus_thuringiensis_phage(14.29%)	12	NA	NA
WP_015269059.1|1139541_1140153_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	72.9	6.3e-80
WP_013971075.1|1140568_1140841_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_013971076.1|1140860_1141715_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	32.8	6.2e-09
WP_015269060.1|1141717_1142182_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_003255135.1|1142194_1142503_-	ribosome-associated translation inhibitor RaiA	NA	A0A0K1LP60	Escherichia_phage	34.1	4.4e-05
WP_015269061.1|1142582_1144076_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_015269062.1|1144251_1144977_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	2.9e-23
WP_015269063.1|1144977_1145502_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_003257918.1|1145488_1146061_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_015269064.1|1146069_1146594_-	HAD family hydrolase	NA	A0A140XBD6	Dickeya_phage	47.8	2.4e-27
WP_003257920.1|1146606_1147581_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	33.1	3.6e-37
WP_012270662.1|1147829_1148639_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.5	4.5e-25
>prophage 79
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1158625	1167226	5875750	tRNA	Vibrio_phage(20.0%)	8	NA	NA
WP_013971092.1|1158625_1158922_+	GIY-YIG nuclease family protein	NA	A0A2I7QNM5	Vibrio_phage	37.7	8.4e-06
WP_013971093.1|1159044_1160052_-	nucleoid-associated protein YejK	NA	L7TI92	Pseudomonas_virus	78.9	3.9e-151
WP_003257928.1|1160422_1160704_+	HU family DNA-binding protein	NA	F8TVE1	EBPR_siphovirus	40.4	1.4e-10
WP_015269069.1|1160754_1161708_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_015269070.1|1161886_1164733_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.4	1.6e-141
WP_015269071.1|1164880_1165246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015269072.1|1165251_1165683_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_015269073.1|1165732_1167226_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.8	6.1e-52
>prophage 80
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1170479	1170692	5875750		Lactococcus_phage(100.0%)	1	NA	NA
WP_003257941.1|1170479_1170692_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	62.5	9.9e-17
>prophage 81
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1173776	1178429	5875750		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_015269080.1|1173776_1176632_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.3	7.8e-266
WP_015269081.1|1176643_1177027_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_015269082.1|1177367_1178429_-	SDR family oxidoreductase	NA	A0A2C9DTC1	Eastern_grey_kangaroopox_virus	27.9	5.9e-09
>prophage 82
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1200514	1201240	5875750		Bacillus_phage(100.0%)	1	NA	NA
WP_003257963.1|1200514_1201240_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.8	1.3e-28
>prophage 83
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1207290	1208445	5875750		Planktothrix_phage(100.0%)	1	NA	NA
WP_015269098.1|1207290_1208445_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	8.7e-22
>prophage 84
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1211877	1213347	5875750		Cyanophage(100.0%)	1	NA	NA
WP_015269100.1|1211877_1213347_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	34.8	7.3e-74
>prophage 85
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1217091	1230032	5875750		Microcystis_virus(16.67%)	10	NA	NA
WP_015269103.1|1217091_1217919_-	M23 family metallopeptidase	NA	A0A7K9	Microcystis_virus	29.7	8.7e-16
WP_015269104.1|1217922_1219302_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.4	1.8e-37
WP_015269105.1|1219438_1220317_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013971137.1|1220414_1221170_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003257977.1|1221221_1221779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013971138.1|1221865_1223335_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.5e-90
WP_015269106.1|1223413_1224991_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.8	3.2e-19
WP_015269107.1|1225086_1226967_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_015269108.1|1227492_1228560_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	46.6	2.5e-63
WP_015269109.1|1228556_1230032_-	hypothetical protein	NA	A0A2D2W211	Stenotrophomonas_phage	32.4	7.4e-10
>prophage 86
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1234292	1239372	5875750		Burkholderia_phage(50.0%)	3	NA	NA
WP_015269113.1|1234292_1238192_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.0	1.7e-114
WP_015269114.1|1238195_1238507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015269115.1|1238610_1239372_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	29.6	1.8e-23
>prophage 87
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1246868	1248632	5875750		Enterobacteria_phage(100.0%)	1	NA	NA
WP_173585793.1|1246868_1248632_+	type II secretion system secretin GspD	NA	A7BJX1	Enterobacteria_phage	35.0	1.3e-29
>prophage 88
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1262620	1265302	5875750		Burkholderia_virus(50.0%)	5	NA	NA
WP_015269133.1|1262620_1263172_-	NUDIX hydrolase	NA	Q6UJ14	Burkholderia_virus	35.3	9.2e-06
WP_003252125.1|1263296_1263896_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_015269134.1|1263940_1264465_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_043935378.1|1264454_1264652_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_015269136.1|1264834_1265302_+	hypothetical protein	NA	A0A088F6S0	Vibrio_phage	42.7	1.0e-21
>prophage 89
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1274272	1275809	5875750		Xanthomonas_phage(50.0%)	2	NA	NA
WP_015269140.1|1274272_1274680_+	acyl-CoA thioesterase	NA	A0A292GK23	Xanthomonas_phage	37.9	2.5e-08
WP_015269141.1|1274912_1275809_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.1	5.1e-30
>prophage 90
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1283625	1285335	5875750		Lactococcus_phage(100.0%)	1	NA	NA
WP_015269147.1|1283625_1285335_+	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1W6JL19	Lactococcus_phage	23.5	9.8e-30
>prophage 91
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1290735	1309279	5875750	tRNA	Bacillus_virus(16.67%)	16	NA	NA
WP_015269152.1|1290735_1291773_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.2	2.3e-26
WP_015269153.1|1291921_1293073_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015269154.1|1293291_1293984_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_015269155.1|1294240_1295863_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.1	3.9e-12
WP_015269156.1|1295868_1296375_+	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_015269157.1|1296371_1297646_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_043935385.1|1297642_1298305_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_015269159.1|1298301_1300605_+	hybrid sensor histidine kinase/response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	9.8e-09
WP_013971215.1|1300601_1301615_+	Wsp signal transduction system protein-glutamate methylesterase WspF	NA	NA	NA	NA	NA
WP_015269160.1|1301666_1302671_+	Wsp signal transduction system regulator diguanylate cyclase WspR	NA	NA	NA	NA	NA
WP_096009945.1|1302782_1303877_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	44.8	3.3e-07
WP_013971217.1|1303970_1305473_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.7	1.8e-83
WP_015269162.1|1305684_1306389_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003258915.1|1306418_1306967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013971219.1|1307106_1308384_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_043935390.1|1308355_1309279_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	27.0	2.3e-09
>prophage 92
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1314705	1315356	5875750		Tupanvirus(100.0%)	1	NA	NA
WP_003259830.1|1314705_1315356_+	adenylate kinase	NA	A0A2K9L833	Tupanvirus	30.6	5.6e-10
>prophage 93
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1333815	1341947	5875750	tRNA	Lake_Baikal_phage(25.0%)	8	NA	NA
WP_003252255.1|1333815_1334025_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	54.0	1.8e-10
WP_003257701.1|1334147_1334522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015269184.1|1334539_1335352_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013971240.1|1335351_1336503_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_015269185.1|1336702_1339294_-	glycosyltransferase	NA	M1I277	Paramecium_bursaria_Chlorella_virus	26.3	1.7e-17
WP_015269186.1|1339413_1340223_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	A0A291ATS8	Pandoravirus	32.9	2.5e-15
WP_015269187.1|1340334_1340745_-	SufE family protein	NA	NA	NA	NA	NA
WP_015269188.1|1340741_1341947_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	36.1	2.3e-70
>prophage 94
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1354483	1355239	5875750		Flavobacterium_phage(100.0%)	1	NA	NA
WP_015269194.1|1354483_1355239_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	38.8	4.5e-19
>prophage 95
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1365163	1392224	5875750	tRNA	Synechococcus_phage(15.38%)	23	NA	NA
WP_013971261.1|1365163_1365787_+	ribonuclease HII	NA	R4THQ2	Phaeocystis_globosa_virus	32.9	5.0e-16
WP_013971262.1|1365974_1369499_+	DNA polymerase III subunit alpha	NA	A0A1C9LWZ5	Streptomyces_phage	35.9	2.6e-194
WP_015269200.1|1369605_1370553_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_015269201.1|1370691_1371975_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_004375437.1|1372244_1373873_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.9	1.2e-157
WP_015269202.1|1373876_1374722_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.0	6.5e-51
WP_015269203.1|1374875_1376165_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.4	9.7e-139
WP_004375443.1|1376333_1376615_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_015269204.1|1376611_1377319_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_015269205.1|1377450_1378347_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013971270.1|1378454_1379567_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.5	8.0e-33
WP_015269206.1|1379575_1380430_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_015269207.1|1380631_1381105_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_015269208.1|1381101_1382160_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_013971274.1|1382147_1382897_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.2	4.4e-67
WP_015269209.1|1382932_1383571_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	1.7e-40
WP_015269210.1|1383791_1384649_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	36.2	1.9e-13
WP_013971277.1|1384757_1385765_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	35.8	5.0e-34
WP_004375459.1|1386382_1386706_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_043936065.1|1386846_1389420_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.6	9.9e-26
WP_015269212.1|1389721_1390375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015269213.1|1390570_1391053_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	78.0	7.4e-60
WP_015269214.1|1391156_1392224_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	62.0	6.4e-112
>prophage 96
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1400290	1401115	5875750	tRNA	Escherichia_phage(100.0%)	1	NA	NA
WP_015269219.1|1400290_1401115_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	71.2	4.5e-105
>prophage 97
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1404822	1413532	5875750		Streptococcus_phage(40.0%)	6	NA	NA
WP_015269225.1|1404822_1405812_-	2-hydroxyacid dehydrogenase	NA	M1H214	Paramecium_bursaria_Chlorella_virus	40.4	5.1e-63
WP_015269226.1|1405980_1408737_-	response regulator	NA	A0A1V0SGX0	Hokovirus	30.1	1.7e-52
WP_015269227.1|1408930_1409650_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.3	9.8e-24
WP_015269228.1|1409653_1411036_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_043936067.1|1411273_1412173_+	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	41.1	1.1e-56
WP_015269230.1|1412173_1413532_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	28.1	2.2e-32
>prophage 98
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1418598	1420310	5875750		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_015269235.1|1418598_1419252_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	40.8	3.7e-30
WP_013971366.1|1419251_1420310_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.4	2.0e-73
>prophage 99
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1424017	1425344	5875750		Bacillus_phage(50.0%)	2	NA	NA
WP_015269239.1|1424017_1424671_+	C40 family peptidase	NA	B6V2P9	Bacillus_phage	37.1	8.6e-19
WP_013971371.1|1424810_1425344_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	41.1	1.4e-19
>prophage 100
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1456783	1457704	5875750		Pseudomonas_virus(100.0%)	1	NA	NA
WP_013971401.1|1456783_1457704_-	recombination-associated protein RdgC	NA	L7TP07	Pseudomonas_virus	67.0	1.2e-111
>prophage 101
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1473174	1478138	5875750		Moraxella_phage(50.0%)	4	NA	NA
WP_013971410.1|1473174_1475256_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	35.0	2.2e-108
WP_015269273.1|1475400_1476363_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_015269274.1|1476480_1477134_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_015269275.1|1477148_1478138_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	4.6e-32
>prophage 102
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1489788	1490724	5875750		Morganella_phage(100.0%)	1	NA	NA
WP_015269282.1|1489788_1490724_+	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	34.6	1.0e-44
>prophage 103
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1501188	1501657	5875750		Vibrio_phage(50.0%)	2	NA	NA
WP_003259056.1|1501188_1501377_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	40.0	7.0e-06
WP_015269288.1|1501420_1501657_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	78.7	9.0e-27
>prophage 104
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1504768	1506556	5875750		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_015269291.1|1504768_1506556_-	N-acetylglutaminylglutamine amidotransferase	NA	R4TIC1	Phaeocystis_globosa_virus	27.7	2.6e-33
>prophage 105
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1515916	1520432	5875750		Bacillus_phage(100.0%)	2	NA	NA
WP_015269297.1|1515916_1517749_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.8	5.9e-41
WP_015269298.1|1517987_1520432_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.6	1.1e-18
>prophage 106
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1525321	1529440	5875750		Bacillus_virus(50.0%)	2	NA	NA
WP_015269303.1|1525321_1528087_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	43.1	1.6e-98
WP_015269304.1|1528354_1529440_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	48.8	4.1e-90
>prophage 107
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1535519	1538721	5875750		Burkholderia_phage(50.0%)	3	NA	NA
WP_015269307.1|1535519_1536584_+	acyltransferase	NA	A9YX16	Burkholderia_phage	31.1	3.8e-24
WP_015269308.1|1537471_1538065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013971456.1|1538421_1538721_+	integration host factor subunit beta	NA	A3E2K9	Sodalis_phage	41.1	2.0e-10
>prophage 108
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1543623	1552951	5875750		Paramecium_bursaria_Chlorella_virus(25.0%)	8	NA	NA
WP_015269313.1|1543623_1544934_+	UDP-N-acetyl-D-glucosamine 6-dehydrogenase	NA	A7IWZ0	Paramecium_bursaria_Chlorella_virus	29.1	1.8e-36
WP_015269314.1|1545008_1545959_+	UDP-N-acetyl-2-amino-2-deoxy-D-glucuronate oxidase	NA	NA	NA	NA	NA
WP_015269315.1|1546090_1547923_+	acyltransferase family protein	NA	B5WZU0	Pseudomonas_phage	33.3	8.0e-46
WP_015269316.1|1547919_1548495_+	UDP-2-acetamido-3-amino-2, 3-dideoxy-D-glucuronate N-acetyltransferase	NA	NA	NA	NA	NA
WP_015269317.1|1548497_1549595_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	29.3	2.0e-28
WP_015269318.1|1549591_1550875_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_043935425.1|1550963_1552346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158242113.1|1552327_1552951_+	antibiotic acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	39.8	4.1e-10
>prophage 109
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1556681	1559990	5875750		Catovirus(33.33%)	3	NA	NA
WP_015269325.1|1556681_1557716_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	34.7	2.7e-38
WP_015269326.1|1557719_1558832_+	NAD-dependent epimerase/dehydratase family protein	NA	E3SLG9	Synechococcus_phage	33.3	9.3e-05
WP_015269327.1|1558859_1559990_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	48.1	5.4e-101
>prophage 110
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1563285	1570495	5875750		Escherichia_phage(50.0%)	6	NA	NA
WP_015269331.1|1563285_1565283_+	polysaccharide biosynthesis protein	NA	K7Y9E1	Megavirus	25.9	2.1e-15
WP_015269332.1|1565465_1566008_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.2	6.6e-49
WP_015269333.1|1566134_1567205_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.2	1.0e-85
WP_015269334.1|1567201_1568098_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	2.2e-28
WP_043936075.1|1568103_1568985_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	62.2	2.2e-102
WP_193385035.1|1569178_1570495_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	35.5	1.7e-26
>prophage 111
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1575701	1583231	5875750		Acinetobacter_phage(50.0%)	7	NA	NA
WP_015269342.1|1575701_1576463_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	46.1	1.2e-08
WP_015269344.1|1577383_1579324_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.6	1.1e-21
WP_015269345.1|1579407_1580598_-	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_015269346.1|1580890_1581493_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_015269347.1|1581623_1581995_-	glutaredoxin	NA	NA	NA	NA	NA
WP_013971502.1|1582054_1582600_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	65.6	3.4e-61
WP_013971503.1|1582670_1583231_-	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	34.8	2.8e-18
>prophage 112
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1618391	1620071	5875750		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_015269378.1|1618391_1620071_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.4	1.7e-50
>prophage 113
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1624720	1627556	5875750		Canarypox_virus(50.0%)	2	NA	NA
WP_015269382.1|1624720_1625209_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	37.7	9.6e-23
WP_015269383.1|1625198_1627556_-	response regulator	NA	A0A1V0SGX0	Hokovirus	29.5	9.3e-47
>prophage 114
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1642960	1647541	5875750		Anomala_cuprea_entomopoxvirus(50.0%)	4	NA	NA
WP_013971560.1|1642960_1643893_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	1.4e-22
WP_015269397.1|1643889_1644669_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015269398.1|1644552_1645185_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_043936088.1|1645327_1647541_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332B9	Clostridium_botulinum_C_phage	25.6	1.8e-15
>prophage 115
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1658179	1659172	5875750		Salinibacter_virus(100.0%)	1	NA	NA
WP_015269407.1|1658179_1659172_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.7	4.8e-13
>prophage 116
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1663773	1664010	5875750		Ralstonia_phage(100.0%)	1	NA	NA
WP_013971576.1|1663773_1664010_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	49.3	1.8e-11
>prophage 117
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1667474	1669086	5875750		Erwinia_phage(50.0%)	2	NA	NA
WP_015269414.1|1667474_1668107_+	dTMP kinase	NA	W8D0J5	Erwinia_phage	38.6	1.7e-24
WP_015269415.1|1668099_1669086_+	DNA polymerase III subunit delta'	NA	A0A2I7S9S8	Vibrio_phage	27.4	2.2e-05
>prophage 118
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1687383	1691224	5875750		Cyanophage(50.0%)	2	NA	NA
WP_003260273.1|1687383_1687827_+	Hsp20 family protein	NA	M4QDX9	Cyanophage	36.4	1.0e-18
WP_015269429.1|1687927_1691224_-	PAS domain S-box protein	NA	A0A127AWB9	Bacillus_phage	31.2	2.5e-13
>prophage 119
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1707403	1708909	5875750		Mollivirus(100.0%)	1	NA	NA
WP_013971613.1|1707403_1708909_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	9.4e-85
>prophage 120
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1721117	1721663	5875750		Escherichia_phage(100.0%)	1	NA	NA
WP_003260150.1|1721117_1721663_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	45.2	9.4e-19
>prophage 121
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1761868	1763416	5875750		Hepacivirus(100.0%)	1	NA	NA
WP_039614530.1|1761868_1763416_+	AMP-binding protein	NA	Q75ZG1	Hepacivirus	27.0	8.3e-44
>prophage 122
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1771064	1773026	5875750		Tetraselmis_virus(100.0%)	1	NA	NA
WP_015269476.1|1771064_1773026_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	44.6	4.6e-140
>prophage 123
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1783177	1786258	5875750		Leptospira_phage(100.0%)	1	NA	NA
WP_015269486.1|1783177_1786258_+	MexW/MexI family multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.6	8.7e-53
>prophage 124
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1796973	1799349	5875750		Hokovirus(100.0%)	1	NA	NA
WP_015269493.1|1796973_1799349_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.2	2.2e-181
>prophage 125
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1806271	1807942	5875750		Catovirus(100.0%)	1	NA	NA
WP_015269497.1|1806271_1807942_-	bifunctional protein-serine/threonine kinase/phosphatase	NA	A0A1V0SBS0	Catovirus	31.1	3.4e-11
>prophage 126
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1815738	1823928	5875750		Bacillus_phage(50.0%)	4	NA	NA
WP_015269502.1|1815738_1818129_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.5	7.8e-17
WP_015269503.1|1818265_1819723_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_004376110.1|1819909_1820254_-	YggL family protein	NA	NA	NA	NA	NA
WP_015269504.1|1820295_1823928_-	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	30.2	3.8e-39
>prophage 127
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1827652	1832723	5875750		Ostreococcus_tauri_virus(33.33%)	6	NA	NA
WP_015269506.1|1827652_1828861_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	32.5	3.7e-39
WP_004376101.1|1828932_1829172_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_015269507.1|1829280_1829712_+	peptidase M15	NA	A0A2H4FSA1	Methylophilaceae_phage	44.5	9.7e-27
WP_015269508.1|1829777_1830086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015269509.1|1830137_1831022_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_015269510.1|1831157_1832723_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	57.7	3.8e-44
>prophage 128
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1838326	1843522	5875750		Cedratvirus(33.33%)	4	NA	NA
WP_015269513.1|1838326_1839469_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A285PXZ1	Cedratvirus	28.6	1.2e-20
WP_015269514.1|1839563_1839737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015269515.1|1839949_1841713_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.8	2.6e-57
WP_015269516.1|1841905_1843522_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	2.4e-17
>prophage 129
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1849497	1859088	5875750		Catovirus(25.0%)	8	NA	NA
WP_015269520.1|1849497_1850385_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.1	6.0e-07
WP_015269521.1|1850368_1851028_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_043935470.1|1851017_1851914_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_015269523.1|1852289_1852799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015269524.1|1853149_1854085_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	28.9	9.8e-32
WP_015269525.1|1854141_1854945_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_015269526.1|1855012_1856938_-	transglycosylase SLT domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	38.6	8.8e-11
WP_015269527.1|1857159_1859088_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.0	2.4e-53
>prophage 130
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1864631	1869447	5875750		Catovirus(50.0%)	5	NA	NA
WP_015269531.1|1864631_1867241_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	33.4	1.3e-89
WP_043935471.1|1867499_1868015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004376430.1|1868065_1868299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015269532.1|1868348_1868825_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_004376420.1|1868838_1869447_-	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	53.8	3.3e-12
>prophage 131
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1873281	1876590	5875750		Choristoneura_murinana_nucleopolyhedrovirus(100.0%)	1	NA	NA
WP_015269536.1|1873281_1876590_-	DEAD/DEAH box helicase	NA	V9XTV7	Choristoneura_murinana_nucleopolyhedrovirus	31.2	6.7e-51
>prophage 132
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1887795	1893125	5875750		Planktothrix_phage(33.33%)	5	NA	NA
WP_169774647.1|1887795_1888479_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	42.5	2.4e-40
WP_015269544.1|1888540_1889782_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_043935476.1|1890000_1891353_-	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_015269546.1|1891349_1892030_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.7	1.5e-26
WP_015269547.1|1892294_1893125_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A126HGP3	Vibrio_phage	35.8	3.5e-33
>prophage 133
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1899877	1942918	5875750	head,tRNA,lysis,terminase,integrase,tail	Pseudomonas_phage(65.79%)	57	1896663:1896679	1923179:1923195
1896663:1896679	attL	GCTGGGCAAGCACGTGA	NA	NA	NA	NA
WP_015269553.1|1899877_1900804_-	transaldolase	NA	A0A127KNC6	Cyanophage	32.9	1.9e-11
WP_015269554.1|1901099_1902110_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_015269555.1|1902209_1903337_+|integrase	site-specific integrase	integrase	L7TP61	Pseudomonas_virus	76.1	7.8e-169
WP_015269556.1|1903320_1903599_-	pyocin activator PrtN family protein	NA	A0A2K8HN48	Pseudomonas_phage	69.1	2.8e-27
WP_015269557.1|1903652_1903865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015269558.1|1903875_1905177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015269559.1|1905337_1907272_-	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	75.3	6.4e-304
WP_015269560.1|1907344_1907956_-	hypothetical protein	NA	A0A2H4JC30	uncultured_Caudovirales_phage	48.8	8.8e-50
WP_015269561.1|1908267_1908579_-	hypothetical protein	NA	A0A2H4JAQ1	uncultured_Caudovirales_phage	54.9	5.2e-22
WP_015269562.1|1908620_1908815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004573814.1|1908818_1909484_-	3'-5' exonuclease	NA	A0A059VJT9	Pseudomonas_phage	71.7	4.1e-93
WP_015269563.1|1909547_1910201_-	hypothetical protein	NA	A0A059VFZ1	Pseudomonas_phage	72.9	3.8e-83
WP_004573816.1|1910212_1910845_-	AAA family ATPase	NA	A0A059VF62	Pseudomonas_phage	72.6	3.3e-84
WP_155252248.1|1910853_1911000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015269564.1|1911120_1911315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015269565.1|1911311_1911542_-	hypothetical protein	NA	K4PAA5	Pseudomonas_phage	47.4	3.2e-13
WP_015269566.1|1911538_1911793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038409491.1|1911813_1912047_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_015269567.1|1912043_1912406_-	hypothetical protein	NA	A0A2H4JGG9	uncultured_Caudovirales_phage	78.3	1.3e-19
WP_015269568.1|1912900_1913104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144050971.1|1913135_1913393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015269570.1|1914002_1914263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015269571.1|1914264_1914939_-	helix-turn-helix transcriptional regulator	NA	A0A0A0YR73	Pseudomonas_phage	46.7	2.1e-12
WP_015269572.1|1915053_1915251_+	helix-turn-helix domain-containing protein	NA	A0A2H4JF66	uncultured_Caudovirales_phage	59.0	4.0e-12
WP_015269573.1|1915282_1915477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015269574.1|1915515_1915713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043935487.1|1915784_1916774_+	replication protein	NA	Q9MC55	Pseudomonas_phage	54.7	6.1e-93
WP_015269576.1|1916770_1918111_+	replicative DNA helicase	NA	Q9MC54	Pseudomonas_phage	72.0	1.5e-179
WP_015269577.1|1918110_1918764_+	hypothetical protein	NA	A0A0S2SYE7	Pseudomonas_phage	46.3	4.1e-45
WP_015269578.1|1918831_1919074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015269579.1|1919073_1919349_+	hypothetical protein	NA	A0A2H4JG78	uncultured_Caudovirales_phage	37.0	7.8e-06
WP_015269580.1|1919345_1919744_+	recombination protein NinB	NA	A0A059VG13	Pseudomonas_phage	86.4	1.2e-63
WP_015269581.1|1919743_1920346_+	recombination protein NinG	NA	L7TH85	Pseudomonas_virus	52.3	2.7e-51
WP_015269582.1|1920500_1920869_+	hypothetical protein	NA	W6MVN8	Pseudomonas_phage	38.1	1.5e-15
WP_015269583.1|1921036_1921330_+	hypothetical protein	NA	A0A0U1UNM6	Pseudomonas_phage	47.7	2.1e-12
WP_015269584.1|1921316_1921826_+	glycoside hydrolase family protein	NA	I6NW41	Burkholderia_virus	60.9	9.9e-55
WP_015269585.1|1921822_1922050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015269586.1|1922054_1922507_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_015269587.1|1922503_1922749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015269588.1|1922756_1923299_+|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	68.2	8.4e-52
1923179:1923195	attR	GCTGGGCAAGCACGTGA	NA	NA	NA	NA
WP_015269589.1|1923276_1924773_+	hypothetical protein	NA	K4NWT7	Pseudomonas_phage	67.1	7.6e-196
WP_015269590.1|1924784_1925048_+	hypothetical protein	NA	W6MVK3	Pseudomonas_phage	54.7	1.2e-11
WP_015269591.1|1925050_1926745_+|head,tail	head-tail connector protein	head,tail	W6MYA0	Pseudomonas_phage	59.1	9.0e-193
WP_015269592.1|1926745_1927051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015269593.1|1927047_1927755_+	hypothetical protein	NA	W6MWW5	Pseudomonas_phage	67.9	1.3e-44
WP_015269594.1|1927765_1928758_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	57.0	1.8e-105
WP_015269595.1|1928797_1929244_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	58.2	1.1e-33
WP_015269596.1|1929253_1929706_+	hypothetical protein	NA	A0A2H4J6K8	uncultured_Caudovirales_phage	44.0	5.2e-07
WP_015269597.1|1929760_1930396_+	hypothetical protein	NA	W6MVD9	Pseudomonas_phage	53.6	2.1e-54
WP_015269598.1|1930392_1932717_+	hypothetical protein	NA	W6MWW6	Pseudomonas_phage	71.6	0.0e+00
WP_102059663.1|1932718_1933162_+	hypothetical protein	NA	W6MW30	Pseudomonas_phage	58.7	3.4e-43
WP_015269600.1|1933161_1933632_+	hypothetical protein	NA	W6MVK9	Pseudomonas_phage	61.4	8.9e-42
WP_043935488.1|1933634_1935743_+	hypothetical protein	NA	W6MYA2	Pseudomonas_phage	65.4	1.6e-244
WP_043936099.1|1936591_1937494_+	hypothetical protein	NA	W6MVE3	Pseudomonas_phage	58.3	8.1e-84
WP_015269603.1|1937493_1940061_+	hypothetical protein	NA	W6MWW8	Pseudomonas_phage	83.6	0.0e+00
WP_015269604.1|1940061_1940319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015269605.1|1940548_1942918_+	hypothetical protein	NA	W6MW31	Pseudomonas_phage	51.0	4.6e-46
>prophage 134
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1948213	1950725	5875750		Pseudomonas_phage(50.0%)	3	NA	NA
WP_015269608.1|1948213_1948420_-	hypothetical protein	NA	A0A2D1GNR5	Pseudomonas_phage	36.9	6.5e-05
WP_015269609.1|1948660_1949278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015269610.1|1949255_1950725_-	AAA family ATPase	NA	A0A2I7RNF1	Vibrio_phage	26.1	9.4e-05
>prophage 135
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	1986985	1991180	5875750	tRNA	Mycobacterium_phage(50.0%)	6	NA	NA
WP_015269640.1|1986985_1987984_-	alpha/beta hydrolase	NA	R4JMP9	Mycobacterium_phage	22.8	1.2e-06
WP_013971818.1|1988059_1988497_-	DedA family protein	NA	NA	NA	NA	NA
WP_015269641.1|1988496_1988925_-	DUF411 domain-containing protein	NA	NA	NA	NA	NA
WP_015269642.1|1988939_1989170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015269643.1|1989194_1989845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015269644.1|1989860_1991180_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	70.1	3.8e-146
>prophage 136
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2005794	2007441	5875750		Staphylococcus_phage(100.0%)	1	NA	NA
WP_013971830.1|2005794_2007441_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	39.3	1.6e-82
>prophage 137
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2027604	2029413	5875750		Acinetobacter_phage(100.0%)	1	NA	NA
WP_015269667.1|2027604_2029413_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	50.2	6.7e-170
>prophage 138
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2036774	2038583	5875750		Planktothrix_phage(100.0%)	1	NA	NA
WP_015269669.1|2036774_2038583_+	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	25.1	1.5e-07
>prophage 139
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2047636	2049523	5875750		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_015269677.1|2047636_2049523_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.5	4.1e-29
>prophage 140
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2055675	2065091	5875750		Bacillus_virus(40.0%)	7	NA	NA
WP_015269684.1|2055675_2057241_+	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	59.6	7.6e-45
WP_015269685.1|2057254_2058940_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	33.2	1.1e-22
WP_015269686.1|2058943_2059423_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_015269687.1|2059585_2060650_-	ornithine cyclodeaminase	NA	A0A1V0SL93	Klosneuvirus	53.2	2.4e-95
WP_015269688.1|2060911_2062660_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_015269689.1|2062884_2063979_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	24.9	6.1e-09
WP_015269690.1|2063978_2065091_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.5	2.6e-15
>prophage 142
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2147763	2151261	5875750		Bacillus_phage(50.0%)	3	NA	NA
WP_015269743.1|2147763_2149119_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	24.1	2.6e-09
WP_015269744.1|2149119_2149584_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_015269745.1|2150457_2151261_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	38.2	6.6e-37
>prophage 143
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2155677	2163112	5875750		Dickeya_phage(50.0%)	3	NA	NA
WP_013971946.1|2155677_2159385_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	66.7	3.9e-15
WP_015269747.1|2159568_2161869_+	fatty acid cis/trans isomerase	NA	NA	NA	NA	NA
WP_015269748.1|2162077_2163112_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	30.1	4.4e-17
>prophage 144
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2172078	2174439	5875750		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_015269756.1|2172078_2174439_+	DNA polymerase II	NA	A0A0N7KVW0	Yellowstone_lake_phycodnavirus	26.4	2.2e-32
>prophage 145
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2183552	2184839	5875750		Bacillus_phage(100.0%)	1	NA	NA
WP_015269763.1|2183552_2184839_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	21.9	5.9e-11
>prophage 146
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2198290	2204730	5875750		Lactobacillus_phage(25.0%)	6	NA	NA
WP_015269772.1|2198290_2199067_-	ParA family protein	NA	E9LUK9	Lactobacillus_phage	22.6	4.5e-06
WP_015269773.1|2199233_2200805_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	5.9e-21
WP_003260897.1|2200883_2201363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015269774.1|2201571_2202912_-	OprD family porin	NA	NA	NA	NA	NA
WP_015269775.1|2202928_2203717_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.3	4.0e-10
WP_015269776.1|2203713_2204730_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.4	9.3e-12
>prophage 147
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2211309	2212062	5875750		Moraxella_phage(100.0%)	1	NA	NA
WP_003260907.1|2211309_2212062_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	40.4	1.7e-39
>prophage 148
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2216130	2222986	5875750		uncultured_marine_virus(25.0%)	7	NA	NA
WP_003260953.1|2216130_2216556_+	HD domain-containing protein	NA	A0A0F7L746	uncultured_marine_virus	51.9	5.4e-30
WP_003260955.1|2216568_2216811_-	DUF1654 domain-containing protein	NA	A0A2H4J8G7	uncultured_Caudovirales_phage	48.1	6.9e-14
WP_015269784.1|2216942_2218031_-	asparaginase	NA	NA	NA	NA	NA
WP_013971996.1|2218435_2219392_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015269785.1|2219413_2220967_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	3.5e-10
WP_015269786.1|2220963_2221959_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015269787.1|2221963_2222986_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.6	5.5e-36
>prophage 149
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2226451	2229944	5875750	tRNA	Morganella_phage(33.33%)	4	NA	NA
WP_003250656.1|2226451_2226664_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	61.2	2.9e-16
WP_015269791.1|2226826_2227132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015269792.1|2227470_2229393_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	5.9e-124
WP_013972005.1|2229392_2229944_+	translation initiation factor IF-3	NA	A0A2I7S9Q1	Vibrio_phage	38.6	3.2e-14
>prophage 150
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2234129	2290432	5875750	integrase,terminase,capsid,holin	Pseudomonas_phage(40.98%)	87	2232201:2232216	2265704:2265719
2232201:2232216	attL	ACGACGCCAGCATCGA	NA	NA	NA	NA
WP_003250679.1|2234129_2234432_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.0e-11
WP_003250681.1|2234412_2234769_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015269795.1|2235041_2236223_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	70.4	2.6e-162
WP_137188652.1|2236108_2236507_-	hypothetical protein	NA	A0A059VFY6	Pseudomonas_phage	69.7	1.9e-45
WP_015269796.1|2236527_2236704_-	hypothetical protein	NA	A0A2H4J7S3	uncultured_Caudovirales_phage	94.8	4.3e-26
WP_015269797.1|2236718_2237456_-	metallophosphoesterase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	82.0	8.0e-122
WP_015269798.1|2237748_2238144_-	DUF2591 domain-containing protein	NA	A0A125RNP6	Pseudomonas_phage	35.6	8.6e-14
WP_128637132.1|2238140_2238410_-	hypothetical protein	NA	A0A2H4J0W8	uncultured_Caudovirales_phage	89.4	4.2e-44
WP_015269800.1|2238406_2238616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015269801.1|2238612_2238885_-	hypothetical protein	NA	A0A2H4J399	uncultured_Caudovirales_phage	70.0	8.0e-27
WP_080604917.1|2238881_2239073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043935519.1|2239797_2240328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015269805.1|2240336_2241998_-	DNA cytosine methyltransferase	NA	Q6V7R9	Burkholderia_virus	43.4	2.3e-108
WP_015269806.1|2242065_2242623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015269807.1|2242637_2243183_-	hypothetical protein	NA	J9Q748	Salmonella_phage	34.5	1.5e-19
WP_085986369.1|2243245_2243578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015269809.1|2243783_2244149_-	hypothetical protein	NA	A0A2H4J0L9	uncultured_Caudovirales_phage	90.1	6.9e-58
WP_015269810.1|2244230_2244773_-	hypothetical protein	NA	A0A2H4J7C8	uncultured_Caudovirales_phage	46.0	3.7e-07
WP_015269811.1|2244769_2245597_-	hypothetical protein	NA	A0A2H4JAZ0	uncultured_Caudovirales_phage	47.7	6.3e-59
WP_015269812.1|2245593_2246406_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A1P8DTH1	Proteus_phage	56.7	3.0e-85
WP_015269813.1|2246416_2246851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080604853.1|2246907_2247447_-	HNH endonuclease	NA	A0A2I7S0H7	Vibrio_phage	46.0	2.6e-37
WP_158242114.1|2247445_2247583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015269816.1|2247587_2247788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015269817.1|2247784_2247988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015269818.1|2247984_2248401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015269819.1|2248413_2248659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015269820.1|2248679_2248922_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_174824247.1|2248918_2249320_-	hypothetical protein	NA	B5WZX2	Pseudomonas_phage	84.2	7.1e-32
WP_015269822.1|2249693_2250092_-	hypothetical protein	NA	A0A0K1LLV9	Rhodobacter_phage	41.4	1.9e-08
WP_015269823.1|2250118_2250685_-	hypothetical protein	NA	J7I0S5	Pseudomonas_phage	55.5	2.8e-58
WP_015269824.1|2251205_2251532_+	DUF1654 domain-containing protein	NA	A0A2D1GND3	Pseudomonas_phage	66.7	3.2e-30
WP_015269825.1|2251577_2251955_-	hypothetical protein	NA	A0A1V0E899	Vibrio_phage	37.2	9.7e-15
WP_015269826.1|2252071_2252878_-	LexA family transcriptional regulator	NA	A0A2D1GNH0	Pseudomonas_phage	48.2	7.5e-65
WP_009397152.1|2252981_2253197_+	helix-turn-helix transcriptional regulator	NA	K7PMD5	Enterobacterial_phage	53.5	1.0e-13
WP_015269827.1|2253227_2253416_+	hypothetical protein	NA	B5WZX7	Pseudomonas_phage	58.1	9.4e-11
WP_015269828.1|2253676_2253883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015269829.1|2253900_2254113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015269831.1|2254447_2255437_+	replication protein	NA	Q9MC55	Pseudomonas_phage	52.9	1.3e-90
WP_015269832.1|2255433_2256774_+	replicative DNA helicase	NA	Q9MC54	Pseudomonas_phage	72.2	1.1e-177
WP_015269833.1|2256773_2257427_+	hypothetical protein	NA	A0A0S2SYE7	Pseudomonas_phage	45.9	2.4e-45
WP_015269578.1|2257494_2257737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015269834.1|2257736_2258327_+	hypothetical protein	NA	K4NWM6	Pseudomonas_phage	82.2	3.3e-25
WP_156351862.1|2258313_2258490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015269835.1|2258482_2258950_+	recombination protein NinB	NA	A0A0H5AUD0	Pseudomonas_phage	79.4	6.7e-66
WP_015269836.1|2258946_2259513_+	HNH endonuclease	NA	R9R4B7	Vibrio_phage	40.8	8.3e-18
WP_155273745.1|2259509_2259665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015269837.1|2259664_2260258_+	recombination protein NinG	NA	A0A2H4JGI2	uncultured_Caudovirales_phage	61.9	2.4e-60
WP_015269838.1|2260254_2260398_+	hypothetical protein	NA	A0A2H4J3D6	uncultured_Caudovirales_phage	93.6	3.9e-17
WP_015269839.1|2260397_2261078_+	hypothetical protein	NA	A0A2H4IZI6	uncultured_Caudovirales_phage	89.8	8.8e-107
WP_015269840.1|2261262_2261463_+	hypothetical protein	NA	A0A2H4JES7	uncultured_Caudovirales_phage	75.8	5.9e-19
WP_015269841.1|2261451_2261751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029886017.1|2261891_2262224_+|holin	phage holin, lambda family	holin	A0A2H4J1U5	uncultured_Caudovirales_phage	90.0	1.0e-52
WP_015269843.1|2262281_2262512_+	hypothetical protein	NA	A0A1S6UB66	Serratia_phage	62.0	3.7e-17
WP_015269844.1|2262521_2262956_+	20S proteasome subunits A/B	NA	A0A2H4J821	uncultured_Caudovirales_phage	98.6	6.7e-76
WP_015269845.1|2262965_2263484_+	hypothetical protein	NA	A0A2H4J2I6	uncultured_Caudovirales_phage	76.4	2.7e-63
WP_015269846.1|2263486_2264974_+|terminase	phage terminase large subunit	terminase	A0A2H4J2I1	uncultured_Caudovirales_phage	95.7	2.6e-281
WP_015269847.1|2264982_2266407_+	DUF4055 domain-containing protein	NA	A0A2H4J5M6	uncultured_Caudovirales_phage	35.6	2.1e-70
2265704:2265719	attR	ACGACGCCAGCATCGA	NA	NA	NA	NA
WP_015269848.1|2266396_2267443_+|capsid	minor capsid protein	capsid	A0A1B0VMF3	Pseudomonas_phage	34.2	1.7e-45
WP_015269849.1|2267560_2268271_+	hypothetical protein	NA	A0A2H4J0Y0	uncultured_Caudovirales_phage	62.6	1.6e-39
WP_015269850.1|2268283_2269252_+	hypothetical protein	NA	R9TJ64	Synechococcus_phage	66.0	1.6e-114
WP_015269851.1|2269300_2269903_+	hypothetical protein	NA	A0A1B0VMF7	Pseudomonas_phage	37.3	5.2e-10
WP_015269852.1|2269942_2270335_+	hypothetical protein	NA	A0A0H5AUF0	Pseudomonas_phage	32.3	2.5e-05
WP_015269853.1|2270337_2270718_+	hypothetical protein	NA	A0A059VA70	Pseudomonas_phage	52.0	2.2e-30
WP_015269854.1|2270720_2271149_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	45.3	1.6e-26
WP_015269855.1|2271145_2271550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015269856.1|2271676_2272198_+	KilA-N domain-containing protein	NA	A0A0H5ARR4	Pseudomonas_phage	60.6	7.5e-58
WP_015269857.1|2272264_2273434_+	Ig-like domain-containing protein	NA	A0A059VG08	Pseudomonas_phage	38.7	1.0e-54
WP_015269858.1|2273491_2273932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043936117.1|2274039_2274282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015269860.1|2274309_2274759_-	helix-turn-helix domain-containing protein	NA	A0A2H4JA00	uncultured_Caudovirales_phage	56.2	5.9e-43
WP_158467595.1|2274891_2275062_+	hypothetical protein	NA	A0A2H4J2A5	uncultured_Caudovirales_phage	69.6	6.9e-13
WP_015269861.1|2275136_2275976_+	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	48.6	8.8e-24
WP_015269862.1|2275972_2276548_+	hypothetical protein	NA	G1D3R9	Mycobacterium_virus	36.9	2.1e-32
WP_015269863.1|2276540_2276999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015269864.1|2277354_2277651_+	hypothetical protein	NA	S4TR42	Salmonella_phage	41.5	5.1e-11
WP_193385036.1|2280469_2280613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015269866.1|2280639_2281092_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	41.6	3.4e-30
WP_015269867.1|2281088_2281568_+	DUF1833 family protein	NA	J7I404	Pseudomonas_phage	43.9	2.4e-26
WP_015269868.1|2281570_2281975_+	CHAP domain-containing protein	NA	B5WZT7	Pseudomonas_phage	45.9	4.8e-28
WP_015269869.1|2281943_2284994_+	hypothetical protein	NA	B5WZT8	Pseudomonas_phage	42.4	3.9e-223
WP_015269870.1|2285051_2287211_+	hypothetical protein	NA	A0A0H5ARL8	Pseudomonas_phage	32.8	1.6e-16
WP_137137313.1|2287291_2288527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015269872.1|2288860_2289349_+	glycoside hydrolase family 104 protein	NA	Q9MC90	Pseudomonas_phage	64.2	1.1e-53
WP_015269873.1|2289345_2289861_+	DUF2514 family protein	NA	NA	NA	NA	NA
WP_015269874.1|2289927_2290236_+	hypothetical protein	NA	A0A2H4JER5	uncultured_Caudovirales_phage	69.5	2.9e-33
WP_015269875.1|2290225_2290432_+	hypothetical protein	NA	A0A2H4J7A7	uncultured_Caudovirales_phage	42.9	1.3e-05
>prophage 151
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2293955	2296109	5875750	transposase	Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_015269879.1|2293955_2295008_+	ADP-ribosylglycohydrolase family protein	NA	A0A1J0FA18	Only_Syngen_Nebraska_virus	22.2	9.0e-10
WP_085986357.1|2295252_2296109_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	40.5	1.5e-18
>prophage 152
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2314008	2317296	5875750		Gordonia_phage(100.0%)	1	NA	NA
WP_015269896.1|2314008_2317296_+	DEAD/DEAH box helicase	NA	A0A160DHD3	Gordonia_phage	26.2	7.4e-34
>prophage 153
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2324995	2327109	5875750		Aeropyrum_pernix_spindle-shaped_virus(50.0%)	2	NA	NA
WP_015269901.1|2324995_2326648_-	DNA cytosine methyltransferase	NA	G3CB01	Aeropyrum_pernix_spindle-shaped_virus	24.4	1.9e-17
WP_015269902.1|2326677_2327109_+	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	60.0	3.8e-39
>prophage 154
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2330598	2332852	5875750		Pandoravirus(50.0%)	2	NA	NA
WP_015269907.1|2330598_2331267_+	HD domain-containing protein	NA	S4W232	Pandoravirus	30.5	9.5e-13
WP_015269908.1|2331814_2332852_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.3	8.0e-19
>prophage 155
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2349142	2350420	5875750		Pandoravirus(100.0%)	1	NA	NA
WP_015269919.1|2349142_2350420_-	bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	29.0	9.0e-20
>prophage 156
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2369992	2376221	5875750		uncultured_Caudovirales_phage(25.0%)	7	NA	NA
WP_003259987.1|2369992_2370274_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	60.2	3.2e-23
WP_015269938.1|2370289_2370922_-	BRCT domain-containing protein	NA	A0A0U4J8W4	Pseudomonas_phage	65.3	3.3e-76
WP_023662326.1|2370938_2371334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015269940.1|2371422_2372331_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013972046.1|2372622_2373927_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.2	2.8e-45
WP_015269941.1|2373957_2375199_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_015269942.1|2375198_2376221_+	histone deacetylase family protein	NA	A0A2K9L473	Tupanvirus	34.3	5.7e-25
>prophage 157
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2381144	2382014	5875750		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_015269946.1|2381144_2382014_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	37.6	1.1e-05
>prophage 158
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2393422	2400166	5875750		Bacillus_phage(66.67%)	5	NA	NA
WP_015269953.1|2393422_2394781_-	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	66.3	2.3e-29
WP_043935540.1|2394798_2395662_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.8	4.8e-09
WP_015269955.1|2395752_2397081_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_015269956.1|2397082_2398423_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_015269957.1|2398429_2400166_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	28.2	2.1e-24
>prophage 159
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2413501	2416018	5875750		Bacillus_phage(100.0%)	1	NA	NA
WP_015269961.1|2413501_2416018_+	UvrD-helicase domain-containing protein	NA	S5MMD7	Bacillus_phage	33.8	4.2e-05
>prophage 160
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2429753	2430416	5875750		Bacillus_phage(100.0%)	1	NA	NA
WP_015269969.1|2429753_2430416_+	response regulator	NA	W8CYM9	Bacillus_phage	35.9	4.6e-28
>prophage 161
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2461145	2462879	5875750		Lactobacillus_phage(100.0%)	1	NA	NA
WP_015269993.1|2461145_2462879_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	25.6	1.3e-21
>prophage 162
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2470352	2474531	5875750		Planktothrix_phage(50.0%)	3	NA	NA
WP_015270001.1|2470352_2471372_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	2.1e-27
WP_015270002.1|2471621_2472449_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015270003.1|2472677_2474531_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	3.4e-36
>prophage 163
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2479635	2481714	5875750		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_015270007.1|2479635_2481714_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.5	1.8e-25
>prophage 164
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2493890	2497994	5875750		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_015270017.1|2493890_2495516_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.8	3.9e-52
WP_015270018.1|2495624_2495945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015270019.1|2496092_2497994_-	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	38.3	4.1e-69
>prophage 165
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2501889	2502921	5875750		Cyanophage(100.0%)	1	NA	NA
WP_015270022.1|2501889_2502921_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SXE6	Cyanophage	39.1	1.1e-52
>prophage 166
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2512264	2517152	5875750		Bacillus_thuringiensis_phage(33.33%)	6	NA	NA
WP_015270030.1|2512264_2513035_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q56AQ6	Bacillus_thuringiensis_phage	39.9	5.7e-38
WP_038410392.1|2513193_2513715_+	chalcone isomerase family protein	NA	NA	NA	NA	NA
WP_015270032.1|2513758_2515285_+	cryptochrome/photolyase family protein	NA	A0A1V0SE91	Indivirus	27.6	7.6e-50
WP_015270033.1|2515281_2515464_+	DUF2256 domain-containing protein	NA	NA	NA	NA	NA
WP_015270034.1|2515401_2515890_-	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
WP_015270035.1|2515889_2517152_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	28.8	2.8e-34
>prophage 167
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2521061	2529935	5875750		Enterobacteria_phage(33.33%)	8	NA	NA
WP_015270040.1|2521061_2521949_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	54.9	1.2e-15
WP_003257627.1|2522166_2523351_+	porin	NA	NA	NA	NA	NA
WP_015270041.1|2523620_2524784_+	FIST C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_015270042.1|2524752_2526648_+	PAS domain-containing sensor histidine kinase	NA	A0A2K9L5I4	Tupanvirus	28.8	1.5e-15
WP_015270043.1|2526818_2527484_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015270044.1|2527541_2528102_-	PQQ-dependent catabolism-associated CXXCW motif protein	NA	NA	NA	NA	NA
WP_013972167.1|2528406_2529198_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015270045.1|2529194_2529935_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	32.1	1.3e-10
>prophage 168
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2548129	2549782	5875750		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_015270057.1|2548129_2549782_-	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.9	9.5e-38
>prophage 169
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2561096	2561351	5875750		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_015270068.1|2561096_2561351_+	glutaredoxin 3	NA	A0A2H4N7T8	Lake_Baikal_phage	38.5	3.1e-09
>prophage 170
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2571639	2573892	5875750		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_015270078.1|2571639_2572356_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	79.8	9.2e-107
WP_015270079.1|2572359_2573421_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_013972227.1|2573535_2573892_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	61.1	6.7e-34
>prophage 171
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2585241	2586753	5875750		Bacillus_phage(100.0%)	1	NA	NA
WP_080604863.1|2585241_2586753_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	6.9e-19
>prophage 172
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2616198	2618751	5875750		Bacillus_phage(100.0%)	1	NA	NA
WP_015270112.1|2616198_2618751_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.4	1.1e-13
>prophage 173
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2621779	2624149	5875750		Bacillus_virus(50.0%)	2	NA	NA
WP_003256804.1|2621779_2622613_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.9	9.9e-28
WP_015270116.1|2622625_2624149_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	33.9	2.3e-70
>prophage 174
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2645729	2649347	5875750		Klosneuvirus(50.0%)	2	NA	NA
WP_015270140.1|2645729_2648600_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	A0A1V0SKB7	Klosneuvirus	25.2	5.9e-11
WP_015270141.1|2648609_2649347_+	3-oxoacyl-ACP reductase FabG	NA	W8CYX9	Bacillus_phage	44.9	4.5e-08
>prophage 175
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2667668	2668583	5875750	integrase	Virus_Rctr85(100.0%)	1	2664210:2664225	2672394:2672409
2664210:2664225	attL	CCTGGACGTGGACAGC	NA	NA	NA	NA
WP_015270152.1|2667668_2668583_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	32.9	1.1e-32
WP_015270152.1|2667668_2668583_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	32.9	1.1e-32
2672394:2672409	attR	CCTGGACGTGGACAGC	NA	NA	NA	NA
>prophage 176
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2684298	2686685	5875750		Vibrio_phage(50.0%)	2	NA	NA
WP_015270167.1|2684298_2684865_-	nicotinamide mononucleotide transporter	NA	R9TJK1	Vibrio_phage	25.8	2.4e-09
WP_015270168.1|2685050_2686685_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	46.7	1.1e-33
>prophage 177
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2691650	2692250	5875750		Morganella_phage(100.0%)	1	NA	NA
WP_015270174.1|2691650_2692250_-	cupin domain-containing protein	NA	A0A1W6JNY2	Morganella_phage	41.4	6.5e-05
>prophage 178
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2718228	2719182	5875750		Bacteriophage(100.0%)	1	NA	NA
WP_085986371.1|2718228_2719182_+	RHS repeat-associated core domain-containing protein	NA	B6SD27	Bacteriophage	49.5	1.6e-18
>prophage 179
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2734816	2738137	5875750		Tupanvirus(50.0%)	3	NA	NA
WP_013972511.1|2734816_2736403_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.3	2.2e-60
WP_102059411.1|2736962_2737340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015270213.1|2737471_2738137_-	SOS response-associated peptidase family protein	NA	A0A2H4J991	uncultured_Caudovirales_phage	69.8	1.1e-93
>prophage 180
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2775788	2780611	5875750		Staphylococcus_phage(33.33%)	6	NA	NA
WP_043936142.1|2775788_2777429_+	fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.4	2.8e-26
WP_015270242.1|2777748_2778249_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	43.6	9.8e-23
WP_015270243.1|2778253_2778496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015270244.1|2778492_2779236_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_015270245.1|2779312_2779828_-	DUF3016 domain-containing protein	NA	NA	NA	NA	NA
WP_015270246.1|2779903_2780611_+	metallophosphoesterase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	51.1	8.6e-65
>prophage 181
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2790048	2790954	5875750		Bacteriophage(100.0%)	1	NA	NA
WP_085986362.1|2790048_2790954_+	RHS repeat-associated core domain-containing protein	NA	B6SD27	Bacteriophage	39.2	2.7e-18
>prophage 182
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2795283	2796339	5875750		Serratia_phage(100.0%)	1	NA	NA
WP_015270260.1|2795283_2796339_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A1Z1LZD8	Serratia_phage	48.0	1.2e-83
>prophage 183
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2809394	2809898	5875750		Synechococcus_phage(100.0%)	1	NA	NA
WP_015270272.1|2809394_2809898_+	peroxiredoxin	NA	H8ZMV3	Synechococcus_phage	45.8	2.7e-20
>prophage 184
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2818204	2818969	5875750		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_015270282.1|2818204_2818969_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.0	2.1e-08
>prophage 185
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2838238	2839066	5875750		Bacillus_virus(100.0%)	1	NA	NA
WP_015270300.1|2838238_2839066_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.9	4.1e-34
>prophage 186
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2872180	2873257	5875750		Synechococcus_phage(100.0%)	1	NA	NA
WP_015270328.1|2872180_2873257_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	V5UTY8	Synechococcus_phage	40.7	4.4e-12
>prophage 187
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2880345	2886765	5875750	protease	Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_015270333.1|2880345_2884128_+	PAS domain-containing protein	NA	Q6XLV6	Feldmannia_irregularis_virus	27.0	2.2e-21
WP_015270334.1|2884209_2884608_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_015270335.1|2884733_2885285_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	NA	NA	NA	NA
WP_003259456.1|2885307_2885682_-	low affinity iron permease family protein	NA	A0A1C9EHA1	Mycobacterium_phage	44.7	3.0e-08
WP_015270336.1|2885847_2886765_+	DUF72 domain-containing protein	NA	A0A2K9L4F5	Tupanvirus	23.3	7.1e-11
>prophage 188
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2896993	2898795	5875750		Mycobacterium_phage(50.0%)	2	NA	NA
WP_015270347.1|2896993_2897815_-	Ku protein	NA	A0A218M9C0	Mycobacterium_phage	31.1	2.4e-26
WP_013972638.1|2897889_2898795_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	53.0	1.2e-74
>prophage 189
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2920738	2926464	5875750	integrase	Bacillus_phage(50.0%)	4	NA	NA
WP_015270366.1|2920738_2923060_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.2	5.8e-17
WP_015270367.1|2923301_2924252_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_015270368.1|2924241_2925237_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_015270369.1|2925324_2926464_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.0	1.2e-39
>prophage 190
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2934263	2934956	5875750		Xanthomonas_phage(100.0%)	1	NA	NA
WP_080604873.1|2934263_2934956_-	conjugal transfer protein TraX	NA	A0A1W6DY89	Xanthomonas_phage	25.9	4.0e-06
>prophage 191
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2942162	2946076	5875750		Synechococcus_phage(50.0%)	4	NA	NA
WP_015270382.1|2942162_2943173_-	ring-hydroxylating dioxygenase ferredoxin reductase family protein	NA	A0A0E3F6W9	Synechococcus_phage	38.5	1.1e-09
WP_015270383.1|2943246_2943732_-	benzoate 1,2-dioxygenase small subunit	NA	NA	NA	NA	NA
WP_015270384.1|2943728_2945087_-	benzoate 1,2-dioxygenase large subunit	NA	NA	NA	NA	NA
WP_015270385.1|2945170_2946076_-	RHS repeat-associated core domain-containing protein	NA	B6SD27	Bacteriophage	69.8	1.1e-19
>prophage 192
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2952922	2953444	5875750		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_015270391.1|2952922_2953444_-	acyloxyacyl hydrolase	NA	A0A2H4J0I5	uncultured_Caudovirales_phage	66.7	1.6e-55
>prophage 193
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2985230	2986208	5875750		Tupanvirus(100.0%)	1	NA	NA
WP_015270414.1|2985230_2986208_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	36.3	4.6e-48
>prophage 194
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	2996915	3005769	5875750		Streptomyces_phage(33.33%)	7	NA	NA
WP_015270423.1|2996915_2999996_-	error-prone DNA polymerase	NA	A0A0K1Y906	Streptomyces_phage	28.2	8.6e-101
WP_015270424.1|2999992_3001411_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_015270425.1|3001417_3002038_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_025339260.1|3002037_3002655_-	repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	41.5	2.5e-07
WP_015270426.1|3003035_3003437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015270427.1|3003433_3003751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102059441.1|3004053_3005769_-	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	22.5	2.4e-07
>prophage 195
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3010478	3012098	5875750		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_015270433.1|3010478_3012098_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.3	1.5e-24
>prophage 196
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3015927	3019056	5875750		Leptospira_phage(100.0%)	1	NA	NA
WP_015270437.1|3015927_3019056_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.7	3.2e-55
>prophage 197
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3047307	3048960	5875750		Staphylococcus_phage(100.0%)	1	NA	NA
WP_043936168.1|3047307_3048960_-	acyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	25.1	9.2e-25
>prophage 198
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3073313	3074624	5875750		Burkholderia_virus(100.0%)	1	NA	NA
WP_015270478.1|3073313_3074624_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	42.2	8.2e-85
>prophage 199
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3084987	3092182	5875750		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_015270484.1|3084987_3089223_-	RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	37.6	1.4e-32
WP_015270485.1|3089227_3089689_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_043935662.1|3089729_3090317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015270487.1|3090328_3092182_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	2.4e-66
>prophage 200
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3101110	3103708	5875750		Agrobacterium_phage(100.0%)	1	NA	NA
WP_015270494.1|3101110_3103708_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	30.2	1.8e-88
>prophage 201
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3115749	3118266	5875750		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_015270500.1|3115749_3118266_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	35.6	5.6e-159
>prophage 202
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3125111	3126074	5875750		Streptococcus_phage(100.0%)	1	NA	NA
WP_015270505.1|3125111_3126074_-	D-glycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	30.0	7.2e-22
>prophage 203
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3150545	3155112	5875750		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_015270528.1|3150545_3153818_+	transporter substrate-binding domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	32.0	1.1e-40
WP_015270529.1|3153792_3155112_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.9	4.8e-16
>prophage 204
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3160614	3164804	5875750		Bacillus_phage(66.67%)	3	NA	NA
WP_015270535.1|3160614_3162108_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.7	1.2e-07
WP_015270536.1|3162405_3163866_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	3.3e-10
WP_015270537.1|3164219_3164804_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	45.9	5.3e-28
>prophage 205
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3174045	3175662	5875750		Bacillus_phage(100.0%)	1	NA	NA
WP_015270544.1|3174045_3175662_+	response regulator	NA	W8CYM9	Bacillus_phage	31.3	9.0e-09
>prophage 206
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3183392	3184964	5875750		Moraxella_phage(100.0%)	1	NA	NA
WP_015270550.1|3183392_3184964_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.2	1.4e-38
>prophage 207
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3195259	3195733	5875750		Tupanvirus(100.0%)	1	NA	NA
WP_015270556.1|3195259_3195733_+	VOC family protein	NA	A0A2K9L4N3	Tupanvirus	41.6	1.6e-22
>prophage 208
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3206916	3216014	5875750		Bacillus_phage(50.0%)	6	NA	NA
WP_015270562.1|3206916_3208215_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	6.5e-18
WP_003259958.1|3208221_3208923_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.0	6.2e-31
WP_015270563.1|3209204_3210380_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_015270564.1|3210391_3213520_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.6	6.3e-51
WP_015270565.1|3213581_3214157_+	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_015270566.1|3214340_3216014_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	29.7	1.8e-28
>prophage 209
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3226198	3232673	5875750		Bacillus_phage(50.0%)	3	NA	NA
WP_015270574.1|3226198_3227932_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	2.2e-45
WP_015270575.1|3227933_3229844_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_015270577.1|3230570_3232673_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.2	3.6e-26
>prophage 210
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3237926	3241207	5875750		Bacteriophage(50.0%)	3	NA	NA
WP_080604883.1|3237926_3238949_-	RHS repeat-associated core domain-containing protein	NA	A0A1W5K0N1	Bacteriophage	39.4	2.4e-23
WP_015270586.1|3239527_3239764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015270587.1|3240358_3241207_-	curli production assembly/transport component CsgG	NA	M1ICK2	Pelagibacter_phage	43.5	6.1e-41
>prophage 211
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3276138	3278139	5875750		Phage_TP(100.0%)	1	NA	NA
WP_015270614.1|3276138_3278139_+	U32 family peptidase	NA	Q6DW11	Phage_TP	29.1	2.8e-20
>prophage 212
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3286610	3287948	5875750		Bacillus_phage(100.0%)	1	NA	NA
WP_015270620.1|3286610_3287948_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	39.7	2.8e-80
>prophage 213
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3295576	3297079	5875750		Burkholderia_virus(100.0%)	1	NA	NA
WP_015270626.1|3295576_3297079_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.5	3.1e-56
>prophage 214
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3306658	3309754	5875750	tRNA	Tupanvirus(50.0%)	2	NA	NA
WP_013972907.1|3306658_3308041_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	31.9	2.5e-44
WP_015270632.1|3308050_3309754_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	62.4	4.9e-207
>prophage 215
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3315302	3315683	5875750		Burkholderia_phage(100.0%)	1	NA	NA
WP_015270635.1|3315302_3315683_+	hypothetical protein	NA	B5TA91	Burkholderia_phage	30.6	4.9e-06
>prophage 216
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3330384	3332175	5875750		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_015270645.1|3330384_3332175_-	gamma-glutamyltransferase	NA	Q5GF27	Diachasmimorpha_longicaudata_entomopoxvirus	26.2	7.9e-14
>prophage 217
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3335938	3337889	5875750		Klosneuvirus(50.0%)	2	NA	NA
WP_015270649.1|3335938_3336838_+	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	37.9	1.5e-42
WP_015270650.1|3337370_3337889_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	39.9	7.1e-16
>prophage 218
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3344830	3345577	5875750		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_015270654.1|3344830_3345577_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	32.1	1.8e-20
>prophage 219
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3355026	3356649	5875750		Staphylococcus_phage(100.0%)	1	NA	NA
WP_015270661.1|3355026_3356649_+	acyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	26.9	2.6e-32
>prophage 220
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3361359	3363504	5875750		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_013972951.1|3361359_3363504_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.5	2.1e-21
>prophage 221
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3367647	3368259	5875750		Acinetobacter_phage(100.0%)	1	NA	NA
WP_015270668.1|3367647_3368259_+	cell wall hydrolase	NA	A0A172Q0A7	Acinetobacter_phage	34.7	1.4e-15
>prophage 222
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3389654	3391745	5875750		Bacillus_virus(100.0%)	1	NA	NA
WP_015270685.1|3389654_3391745_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	36.8	4.0e-25
>prophage 223
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3410895	3412978	5875750		Planktothrix_phage(50.0%)	2	NA	NA
WP_013972988.1|3410895_3411678_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	1.4e-31
WP_015270696.1|3412168_3412978_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A2P9FI75	Pseudomonas_phage	28.7	3.2e-07
>prophage 224
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3438512	3440261	5875750		Vibrio_phage(100.0%)	1	NA	NA
WP_015270714.1|3438512_3440261_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	27.8	7.0e-23
>prophage 225
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3449012	3449834	5875750		Bacillus_virus(100.0%)	1	NA	NA
WP_015270724.1|3449012_3449834_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	1.3e-27
>prophage 226
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3457035	3457869	5875750		Mycobacterium_phage(100.0%)	1	NA	NA
WP_015270729.1|3457035_3457869_+	alpha/beta fold hydrolase	NA	A0A0B5A484	Mycobacterium_phage	26.7	1.7e-06
>prophage 227
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3461303	3461867	5875750		Ralstonia_phage(100.0%)	1	NA	NA
WP_013973032.1|3461303_3461867_+	NUDIX hydrolase	NA	A0A1L7N1W6	Ralstonia_phage	29.8	1.6e-05
>prophage 228
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3476044	3477244	5875750		Agrobacterium_phage(100.0%)	1	NA	NA
WP_015270742.1|3476044_3477244_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.4	5.8e-45
>prophage 229
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3491532	3498353	5875750		Staphylococcus_phage(33.33%)	6	NA	NA
WP_015270754.1|3491532_3492357_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	32.0	1.2e-30
WP_043935690.1|3492493_3494590_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.5	1.1e-14
WP_015270756.1|3494718_3495213_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013973066.1|3495872_3496163_-	muconolactone Delta-isomerase	NA	NA	NA	NA	NA
WP_015270757.1|3496211_3497339_-	muconate cycloisomerase family protein	NA	NA	NA	NA	NA
WP_015270758.1|3497474_3498353_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	26.3	3.1e-11
>prophage 230
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3516228	3519967	5875750		Hokovirus(50.0%)	3	NA	NA
WP_015270771.1|3516228_3518481_-	response regulator	NA	A0A1V0SGX0	Hokovirus	33.7	1.1e-39
WP_015270772.1|3518477_3519254_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015270773.1|3519250_3519967_-	response regulator	NA	W8CYM9	Bacillus_phage	33.9	1.3e-28
>prophage 231
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3525240	3525909	5875750		Planktothrix_phage(100.0%)	1	NA	NA
WP_015270778.1|3525240_3525909_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	1.0e-22
>prophage 232
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3537556	3538413	5875750	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
WP_085986357.1|3537556_3538413_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	40.5	1.5e-18
>prophage 233
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3553510	3553966	5875750		Pandoravirus(100.0%)	1	NA	NA
WP_015270799.1|3553510_3553966_-	nucleoside deaminase	NA	S4VYT2	Pandoravirus	37.3	3.2e-12
>prophage 234
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3559081	3565159	5875750		Bacillus_phage(50.0%)	4	NA	NA
WP_015270804.1|3559081_3560308_-	hybrid sensor histidine kinase/response regulator	NA	W8CYF6	Bacillus_phage	25.9	8.3e-15
WP_015270805.1|3560301_3560877_-	chemotaxis protein CheB	NA	NA	NA	NA	NA
WP_003259474.1|3560873_3561695_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_015270806.1|3561691_3565159_-	response regulator	NA	A0A1V0SGX0	Hokovirus	39.9	1.5e-32
>prophage 235
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3571512	3573876	5875750		Pseudomonas_phage(100.0%)	4	NA	NA
WP_015270814.1|3571512_3571998_-	glycoside hydrolase family 104 protein	NA	Q9MC90	Pseudomonas_phage	58.6	2.0e-44
WP_015270815.1|3572062_3572428_-	hypothetical protein	NA	A0A059VK40	Pseudomonas_phage	79.6	4.3e-36
WP_015270816.1|3572590_3573415_+	LexA family transcriptional regulator	NA	A0A2D1GNH0	Pseudomonas_phage	60.8	7.2e-63
WP_043935705.1|3573552_3573876_-	DUF1654 domain-containing protein	NA	A0A2D1GND3	Pseudomonas_phage	70.8	2.7e-29
>prophage 236
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3582822	3583569	5875750		Bacillus_virus(100.0%)	1	NA	NA
WP_015270826.1|3582822_3583569_+	metal ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.3	2.4e-09
>prophage 237
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3589738	3590650	5875750		Enterococcus_phage(100.0%)	1	NA	NA
WP_015270834.1|3589738_3590650_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.3	1.0e-33
>prophage 238
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3596971	3600388	5875750		Acanthamoeba_polyphaga_mimivirus(50.0%)	4	NA	NA
WP_015270840.1|3596971_3597991_+	alpha/beta hydrolase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	39.9	2.9e-61
WP_015270841.1|3598045_3598768_+	pirin family protein	NA	NA	NA	NA	NA
WP_015270842.1|3598894_3599188_-	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_015270843.1|3599266_3600388_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	M4QPK3	Synechococcus_phage	39.5	1.5e-34
>prophage 239
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3603517	3611270	5875750		Bacillus_virus(33.33%)	6	NA	NA
WP_013973156.1|3603517_3604666_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	1.1e-29
WP_015270846.1|3604905_3606213_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015270847.1|3606505_3607570_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.7	1.4e-37
WP_015270848.1|3607647_3608877_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_015270849.1|3609017_3609944_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015270850.1|3610115_3611270_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7C038	Faustovirus	30.6	7.3e-29
>prophage 240
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3618392	3619445	5875750		Tupanvirus(100.0%)	1	NA	NA
WP_015270858.1|3618392_3619445_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	43.9	6.8e-82
>prophage 241
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3623570	3624470	5875750		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_015270864.1|3623570_3624470_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	35.3	8.5e-33
>prophage 242
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3628061	3633021	5875750		Bacillus_virus(33.33%)	4	NA	NA
WP_015270868.1|3628061_3629624_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	33.9	1.1e-38
WP_004375926.1|3629748_3630312_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_015270869.1|3630637_3631993_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	30.3	1.2e-49
WP_013973181.1|3632181_3633021_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.2	7.3e-63
>prophage 243
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3638552	3641175	5875750		Bacillus_virus(33.33%)	3	NA	NA
WP_015270876.1|3638552_3639644_+	molybdenum ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	8.2e-14
WP_015270877.1|3639701_3640724_+	DNA topoisomerase IB	NA	A0A0G2Y4T8	Acanthamoeba_polyphaga_mimivirus	30.7	1.0e-37
WP_004375914.1|3640977_3641175_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	55.6	7.5e-11
>prophage 244
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3645976	3647389	5875750		Tupanvirus(50.0%)	2	NA	NA
WP_015270884.1|3645976_3646987_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	26.9	4.1e-28
WP_015270885.1|3647152_3647389_+	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	52.3	6.7e-14
>prophage 245
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3654531	3741087	5875750	plate,capsid,head,holin,tRNA,lysis,terminase,protease,tail,portal	uncultured_Caudovirales_phage(40.0%)	95	NA	NA
WP_015270897.1|3654531_3655104_+	hypothetical protein	NA	A0A2H4J2D5	uncultured_Caudovirales_phage	74.8	6.1e-61
WP_015270898.1|3655255_3655939_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_043935721.1|3656585_3656798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015270900.1|3657197_3657464_+	hypothetical protein	NA	A0A2H4J399	uncultured_Caudovirales_phage	74.7	7.0e-28
WP_015270902.1|3657784_3658804_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	25.5	2.0e-22
WP_015270903.1|3659001_3659712_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003257405.1|3659768_3660086_+	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015270904.1|3660332_3661400_+	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_015270905.1|3661436_3662204_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.3e-18
WP_015270906.1|3662204_3663026_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015270907.1|3663177_3663528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015270908.1|3663642_3663933_+	RcnB family protein	NA	NA	NA	NA	NA
WP_080604890.1|3664062_3664257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015270910.1|3664331_3664715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015270911.1|3664853_3666683_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_015270912.1|3666820_3668245_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.8	9.4e-18
WP_015270913.1|3668246_3669008_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_015270914.1|3669106_3670012_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_137188568.1|3670239_3670575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015270915.1|3670850_3671429_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_015270916.1|3671549_3671750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015270917.1|3672070_3672256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015270919.1|3673370_3673688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015270920.1|3673846_3674890_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	78.0	3.3e-153
WP_043936208.1|3674889_3676641_-|terminase	terminase ATPase subunit family protein	terminase	A0A2H4JGK4	uncultured_Caudovirales_phage	79.9	3.8e-271
WP_015270922.1|3676793_3677648_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	65.6	6.9e-93
WP_015270923.1|3677687_3678698_+|capsid	phage major capsid protein, P2 family	capsid	A0A2H4JCR7	uncultured_Caudovirales_phage	65.6	1.5e-118
WP_015270924.1|3678701_3679403_+|terminase	phage P2 small terminase subunit gpM-like protein	terminase	Q9ZXM2	Pseudomonas_virus	60.9	1.4e-70
WP_015270925.1|3679508_3679985_+|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	59.5	1.8e-42
WP_015270926.1|3679984_3680197_+|tail	tail protein X	tail	A0A2H4J946	uncultured_Caudovirales_phage	72.1	1.7e-21
WP_015270927.1|3680239_3680554_+|holin	phage holin, lambda family	holin	A0A2H4JFM8	uncultured_Caudovirales_phage	54.0	6.2e-23
WP_015270928.1|3680550_3681408_+	DUF3380 domain-containing protein	NA	Q9ZXL6	Pseudomonas_virus	64.2	4.8e-94
WP_015270929.1|3681407_3681872_+|lysis	phage lysis regulatory protein, LysB family	lysis	Q9ZXL5	Pseudomonas_virus	43.9	2.1e-19
WP_015270930.1|3681946_3682480_+|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	60.1	4.4e-53
WP_015270931.1|3682472_3682928_+	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	63.3	2.4e-44
WP_043936210.1|3682989_3683547_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	65.1	2.4e-62
WP_015270933.1|3683543_3683888_+	GPW/gp25 family protein	NA	Q9ZXK9	Pseudomonas_virus	60.5	9.4e-33
WP_015270934.1|3683884_3684799_+|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	73.3	7.9e-119
WP_015270935.1|3684795_3685407_+|tail	phage tail protein I	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	68.3	1.1e-76
WP_015270936.1|3685399_3687313_+|tail	phage tail protein	tail	A0A077K818	Ralstonia_phage	50.7	2.6e-87
WP_080604891.1|3687386_3687746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015270938.1|3687833_3689006_+|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	75.8	1.1e-170
WP_015270939.1|3689020_3689536_+|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	69.0	2.6e-66
WP_015270940.1|3689565_3689916_+|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	56.1	9.0e-23
WP_015270941.1|3689924_3690044_+|tail	GpE family phage tail protein	tail	E5E3U7	Burkholderia_phage	66.7	4.0e-07
WP_015270942.1|3690033_3693315_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	46.4	4.6e-137
WP_015270943.1|3693321_3693762_+|tail	phage tail protein	tail	A0A2H4JG54	uncultured_Caudovirales_phage	71.9	2.4e-57
WP_015270944.1|3693758_3695042_+	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	77.5	7.0e-182
WP_015270945.1|3695150_3695531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043935729.1|3695772_3696660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043936212.1|3697051_3697381_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	50.5	6.7e-20
WP_015270948.1|3697466_3697676_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_015270949.1|3697705_3698179_+	hypothetical protein	NA	A0A2H4JG61	uncultured_Caudovirales_phage	63.4	5.1e-53
WP_015270950.1|3698175_3698475_+	ogr/Delta-like zinc finger family protein	NA	Q9ZXJ1	Pseudomonas_virus	46.8	3.8e-14
WP_015270951.1|3698471_3698846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015270952.1|3698915_3699161_+	hypothetical protein	NA	A0A2H4JGL7	uncultured_Caudovirales_phage	53.8	4.1e-14
WP_043936213.1|3699172_3701896_+	toprim domain-containing protein	NA	A0A2H4J936	uncultured_Caudovirales_phage	76.3	0.0e+00
WP_173585848.1|3702240_3702558_+	hypothetical protein	NA	A0A0U4JP55	Pseudomonas_phage	61.0	5.8e-29
WP_015270955.1|3702554_3702770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015270956.1|3702823_3703411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015270957.1|3703407_3703767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043935732.1|3703826_3704066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015270958.1|3704055_3705861_+	DNA cytosine methyltransferase	NA	A0A0U1T6D1	Pseudomonas_phage	71.3	2.6e-222
WP_025339762.1|3705977_3707147_+	DUF3596 domain-containing protein	NA	A0A2H4JGM5	uncultured_Caudovirales_phage	65.6	2.6e-151
WP_003251184.1|3707490_3708162_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	91.0	2.1e-105
WP_015270960.1|3708478_3709858_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	51.1	1.6e-27
WP_013973276.1|3710137_3710530_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	79.1	9.3e-53
WP_015270961.1|3710531_3710891_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	62.5	1.8e-34
WP_015270962.1|3710890_3711187_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	62.6	2.5e-26
WP_015270963.1|3711183_3711519_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	75.7	1.7e-42
WP_015270964.1|3711515_3712520_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	79.2	3.1e-153
WP_015270965.1|3712612_3713572_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_013973282.1|3713689_3715081_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003258877.1|3715081_3716362_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	54.4	2.6e-96
WP_015270966.1|3716392_3716767_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	44.6	1.2e-09
WP_013973284.1|3716763_3718089_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.3	1.5e-78
WP_015270967.1|3718101_3718737_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_161551404.1|3718799_3721289_-	DNA translocase FtsK 4TM domain-containing protein	NA	A0A218M9A2	Mycobacterium_phage	50.6	9.7e-87
WP_015270969.1|3721734_3722415_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_013973288.1|3722470_3723178_+	arginyltransferase	NA	NA	NA	NA	NA
WP_002553999.1|3723280_3723499_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_013973289.1|3723670_3725941_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.0	7.3e-166
WP_013973290.1|3725971_3726334_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.2	4.8e-11
WP_013973291.1|3726563_3726824_+	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	60.0	2.5e-14
WP_015270970.1|3726898_3728155_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	75.9	3.8e-15
WP_013973293.1|3728582_3730808_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_015270971.1|3731010_3731451_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_015270972.1|3731511_3732636_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_015270973.1|3732632_3733259_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_015270974.1|3733496_3734867_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.8	6.9e-111
WP_013973298.1|3734948_3736115_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003258855.1|3736107_3736536_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015270975.1|3736697_3738653_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.6	2.5e-29
WP_015270976.1|3738886_3740176_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_015270977.1|3740256_3741087_+	alpha/beta hydrolase	NA	A0A291AV30	Mycobacterium_phage	29.1	1.3e-11
>prophage 246
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3747317	3749955	5875750		Acanthamoeba_castellanii_mimivirus(50.0%)	4	NA	NA
WP_015270984.1|3747317_3747863_+	lipocalin family protein	NA	A0A1E1EXN3	Acanthamoeba_castellanii_mimivirus	39.3	1.6e-18
WP_102059521.1|3747958_3748405_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_015270986.1|3748421_3749381_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_015270987.1|3749415_3749955_+	hypothetical protein	NA	A0A097BYE2	Leuconostoc_phage	35.2	4.3e-24
>prophage 247
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3760564	3763101	5875750		Cyanophage(50.0%)	2	NA	NA
WP_015270994.1|3760564_3762070_-	glucose-6-phosphate dehydrogenase	NA	M4SP85	Cyanophage	36.6	6.1e-76
WP_137109124.1|3762066_3763101_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	R9TLE2	Synechococcus_phage	50.0	9.0e-87
>prophage 248
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3785467	3798431	5875750		Staphylococcus_phage(16.67%)	11	NA	NA
WP_015271007.1|3785467_3787150_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	28.3	1.8e-28
WP_013973339.1|3787473_3788637_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_015271008.1|3788656_3790264_+	propionyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	63.9	8.1e-18
WP_015271009.1|3790267_3791083_+	gamma-carboxygeranoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_015271010.1|3791079_3793032_+	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_043936214.1|3793201_3793864_-	helix-turn-helix domain-containing protein	NA	A0A286S2B2	Klebsiella_phage	35.4	1.7e-30
WP_015271012.1|3793971_3794625_-	helix-turn-helix domain-containing protein	NA	Q9KXF4	Enterobacteria_phage	34.2	9.5e-26
WP_015271013.1|3794755_3795067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015271014.1|3795505_3796021_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_015271015.1|3796074_3797265_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.5	3.1e-14
WP_102059516.1|3797504_3798431_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.2	5.9e-21
>prophage 249
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3802781	3803516	5875750		Planktothrix_phage(100.0%)	1	NA	NA
WP_015271020.1|3802781_3803516_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.6	3.7e-34
>prophage 250
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3809460	3811050	5875750		Salmonella_phage(100.0%)	1	NA	NA
WP_015271024.1|3809460_3811050_+	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	57.5	9.0e-54
>prophage 251
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3838044	3841711	5875750		Tupanvirus(50.0%)	2	NA	NA
WP_015271048.1|3838044_3840156_+	elongation factor G	NA	A0A2K9L6L3	Tupanvirus	25.0	1.2e-40
WP_015271049.1|3840268_3841711_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	7.4e-87
>prophage 252
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3861945	3863161	5875750		Pseudomonas_virus(100.0%)	3	NA	NA
WP_023662582.1|3861945_3862209_-	ogr/Delta-like zinc finger family protein	NA	Q9ZXJ1	Pseudomonas_virus	50.0	9.8e-14
WP_003261013.1|3862409_3862802_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015271057.1|3862798_3863161_-	hypothetical protein	NA	Q9ZXL8	Pseudomonas_virus	40.2	2.7e-06
>prophage 253
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3869623	3870880	5875750		Bradyrhizobium_phage(50.0%)	2	NA	NA
WP_015271063.1|3869623_3870382_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	46.6	2.5e-38
WP_003261021.1|3870433_3870880_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	52.2	4.3e-38
>prophage 254
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3880101	3884056	5875750		Acidithiobacillus_phage(66.67%)	5	NA	NA
WP_015271068.1|3880101_3881715_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	9.6e-19
WP_015271069.1|3882172_3882415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015271070.1|3882571_3882835_+	DUF3077 domain-containing protein	NA	NA	NA	NA	NA
WP_015271071.1|3883016_3883484_+	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	51.3	1.8e-34
WP_015271072.1|3883480_3884056_+	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	60.8	1.3e-55
>prophage 255
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3894082	3899516	5875750		Hokovirus(50.0%)	3	NA	NA
WP_015271076.1|3894082_3896737_-	sensor histidine kinase KdpD	NA	A0A1V0SGX0	Hokovirus	25.4	5.8e-05
WP_015271077.1|3896899_3897451_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_015271078.1|3897461_3899516_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	27.0	8.4e-28
>prophage 256
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3910485	3912417	5875750		Hokovirus(100.0%)	1	NA	NA
WP_015271087.1|3910485_3912417_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.1	1.3e-46
>prophage 257
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3917386	3919291	5875750		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_015271091.1|3917386_3919291_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.8	1.6e-113
>prophage 258
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3925898	3927335	5875750		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_013973439.1|3925898_3927335_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	1.4e-45
>prophage 259
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3948987	3952125	5875750		Dickeya_phage(50.0%)	2	NA	NA
WP_015271106.1|3948987_3950160_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	42.9	9.1e-11
WP_015271107.1|3950160_3952125_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	38.3	6.8e-35
>prophage 260
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3958433	3960666	5875750		Pandoravirus(50.0%)	2	NA	NA
WP_015271112.1|3958433_3959402_-	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	30.7	1.1e-14
WP_015271113.1|3959544_3960666_+	cupin-like domain-containing protein	NA	A0A1E1EUU2	Acanthamoeba_castellanii_mimivirus	37.3	2.5e-05
>prophage 261
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3978623	3992519	5875750		Staphylococcus_phage(50.0%)	2	NA	NA
WP_015271128.1|3978623_3979352_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	5.1e-12
WP_015271129.1|3979565_3992519_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.8	6.5e-142
>prophage 262
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	3995615	3996167	5875750		Beihai_hepe-like_virus(100.0%)	1	NA	NA
WP_015271133.1|3995615_3996167_+	3'-5' exoribonuclease	NA	A0A1L3KJF4	Beihai_hepe-like_virus	27.7	5.2e-09
>prophage 263
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4006822	4009297	5875750		uncultured_virus(100.0%)	1	NA	NA
WP_015271142.1|4006822_4009297_+	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	31.1	5.9e-76
>prophage 264
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4012709	4016767	5875750		Klosneuvirus(50.0%)	4	NA	NA
WP_009683910.1|4012709_4013258_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	34.2	9.1e-22
WP_003259670.1|4013402_4014005_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003259671.1|4014294_4014630_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_015271146.1|4014694_4016767_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	36.5	5.7e-48
>prophage 265
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4021304	4023635	5875750		Pseudomonas_phage(100.0%)	1	NA	NA
WP_015271152.1|4021304_4023635_-	NAD-dependent DNA ligase LigA	NA	A0A1Y0SVC9	Pseudomonas_phage	40.2	8.4e-141
>prophage 266
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4029389	4034253	5875750		Acinetobacter_phage(100.0%)	3	NA	NA
WP_015271156.1|4029389_4030844_+	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	47.2	8.1e-110
WP_015271157.1|4030836_4033236_+	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	48.2	4.5e-206
WP_015271158.1|4033407_4034253_+	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	30.9	1.2e-36
>prophage 267
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4037535	4039628	5875750		Moraxella_phage(50.0%)	2	NA	NA
WP_013973528.1|4037535_4038885_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.8	1.9e-65
WP_015271162.1|4038926_4039628_-	RHS repeat-associated core domain-containing protein	NA	A0A1W5K0N1	Bacteriophage	58.0	1.6e-26
>prophage 268
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4044159	4045515	5875750		Enterobacteria_phage(100.0%)	1	NA	NA
WP_015271164.1|4044159_4045515_+	purine permease	NA	Q9KX94	Enterobacteria_phage	29.2	1.4e-31
>prophage 269
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4050208	4051984	5875750		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_015271168.1|4050208_4051984_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	28.0	2.0e-41
>prophage 270
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4058831	4059653	5875750		Lactobacillus_phage(100.0%)	1	NA	NA
WP_015271173.1|4058831_4059653_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	38.0	4.0e-05
>prophage 271
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4066611	4070787	5875750		Acanthocystis_turfacea_Chlorella_virus(50.0%)	5	NA	NA
WP_015271179.1|4066611_4067274_-	hypothetical protein	NA	M1IB93	Acanthocystis_turfacea_Chlorella_virus	39.8	1.6e-33
WP_003254365.1|4067976_4068315_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_015271181.1|4068427_4068835_-	GFA family protein	NA	NA	NA	NA	NA
WP_015271182.1|4069009_4069798_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_015271183.1|4069848_4070787_-	2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	22.9	7.8e-13
>prophage 272
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4077887	4078520	5875750		Staphylococcus_phage(100.0%)	1	NA	NA
WP_013973564.1|4077887_4078520_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.8e-14
>prophage 273
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4094632	4095421	5875750		Natrialba_phage(100.0%)	1	NA	NA
WP_013973578.1|4094632_4095421_-	ParA family protein	NA	Q8JL10	Natrialba_phage	32.0	4.2e-12
>prophage 274
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4114860	4116552	5875750		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_015271214.1|4114860_4116552_-	fused response regulator/phosphatase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	32.7	9.4e-09
>prophage 275
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4136338	4137508	5875750		Tupanvirus(100.0%)	1	NA	NA
WP_043936228.1|4136338_4137508_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A2K9L0G1	Tupanvirus	31.1	7.9e-23
>prophage 276
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4143949	4147525	5875750		Escherichia_phage(100.0%)	1	NA	NA
WP_015271233.1|4143949_4147525_-	glycosyltransferase	NA	A0A291LAB8	Escherichia_phage	27.2	2.4e-14
>prophage 277
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4151244	4152399	5875750		Sulfitobacter_phage(100.0%)	1	NA	NA
WP_015271236.1|4151244_4152399_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A088F6W1	Sulfitobacter_phage	38.8	1.5e-21
>prophage 278
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4160480	4161410	5875750		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_015271245.1|4160480_4161410_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	4.7e-34
>prophage 279
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4172583	4173582	5875750		Bacillus_virus(100.0%)	1	NA	NA
WP_015271256.1|4172583_4173582_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	34.5	5.7e-14
>prophage 280
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4176934	4184259	5875750	tRNA	Pseudomonas_phage(33.33%)	5	NA	NA
WP_015271261.1|4176934_4177261_+	Arc family DNA-binding protein	NA	A0A1Y0SXL4	Pseudomonas_phage	75.4	9.9e-16
WP_015271262.1|4177342_4178785_-	magnesium transporter	NA	NA	NA	NA	NA
WP_003254503.1|4179959_4180148_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	61.5	8.0e-10
WP_013973645.1|4180314_4181550_-	aspartate kinase	NA	NA	NA	NA	NA
WP_015271263.1|4181634_4184259_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.7	1.5e-74
>prophage 281
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4192260	4200441	5875750		Klosneuvirus(33.33%)	7	NA	NA
WP_015271268.1|4192260_4193481_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	24.1	2.0e-21
WP_015271269.1|4193828_4194809_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_013973655.1|4194907_4195672_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.8	7.3e-09
WP_003260115.1|4195694_4196393_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003260113.1|4196389_4197079_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015271270.1|4197167_4197953_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015271271.1|4198479_4200441_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	38.1	6.3e-81
>prophage 282
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4213668	4214439	5875750		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_015271279.1|4213668_4214439_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.8	1.9e-20
>prophage 283
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4217946	4218624	5875750		Bacillus_phage(100.0%)	1	NA	NA
WP_013973673.1|4217946_4218624_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	6.4e-25
>prophage 284
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4224330	4232515	5875750		uncultured_virus(33.33%)	7	NA	NA
WP_015271287.1|4224330_4225143_-	UDP-2,3-diacylglucosamine diphosphatase	NA	A0A218MKA7	uncultured_virus	45.6	1.1e-63
WP_015271288.1|4225274_4226048_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015271289.1|4226222_4227113_+	EamA family transporter	NA	NA	NA	NA	NA
WP_003259082.1|4227114_4227396_-	SelT/SelW/SelH family protein	NA	NA	NA	NA	NA
WP_013973684.1|4227463_4229650_+	patatin-like phospholipase family protein	NA	A0A1V0SCG0	Catovirus	30.8	3.7e-13
WP_013973685.1|4229779_4230217_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015271290.1|4230367_4232515_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	33.2	9.9e-80
>prophage 285
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4236284	4237850	5875750		Salmonella_phage(100.0%)	1	NA	NA
WP_015271292.1|4236284_4237850_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	59.6	1.4e-43
>prophage 286
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4246391	4247753	5875750		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_039612590.1|4246391_4247753_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.8	5.6e-52
>prophage 287
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4253929	4257189	5875750		Mycobacterium_phage(33.33%)	3	NA	NA
WP_013973707.1|4253929_4254742_+	alpha/beta fold hydrolase	NA	A0A0B5A484	Mycobacterium_phage	36.3	4.2e-07
WP_015271301.1|4254735_4255293_+	peptidylprolyl isomerase A	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	35.7	2.1e-13
WP_015271302.1|4255356_4257189_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.1	5.8e-28
>prophage 288
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4261450	4265356	5875750		Catovirus(100.0%)	1	NA	NA
WP_015271306.1|4261450_4265356_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	32.4	3.1e-55
>prophage 289
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4268780	4272527	5875750		Staphylococcus_phage(50.0%)	2	NA	NA
WP_015271309.1|4268780_4270478_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.2	3.0e-31
WP_015271310.1|4270838_4272527_-	long-chain-fatty-acid--CoA ligase	NA	Q75ZG1	Hepacivirus	28.9	1.0e-42
>prophage 290
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4277040	4279236	5875750		Burkholderia_phage(66.67%)	5	NA	NA
WP_015271315.1|4277040_4277373_-	type II toxin-antitoxin system HicB family antitoxin	NA	R4JJS9	Burkholderia_phage	53.3	3.1e-25
WP_015271316.1|4277369_4277624_-	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	47.0	3.8e-15
WP_004375752.1|4277764_4278022_-	DUF2790 domain-containing protein	NA	NA	NA	NA	NA
WP_015271317.1|4278376_4278745_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015271318.1|4278699_4279236_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.5	4.4e-13
>prophage 291
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4287902	4326075	5875750		Tupanvirus(71.43%)	8	NA	NA
WP_015271324.1|4287902_4288763_+	formylglycine-generating enzyme family protein	NA	A0A7H6	Microcystis_virus	38.8	1.2e-39
WP_015271325.1|4288889_4291352_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_015271326.1|4291509_4300113_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	20.7	6.8e-79
WP_015271327.1|4300135_4306699_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	25.2	1.9e-137
WP_012273657.1|4306711_4310056_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.9	1.6e-100
WP_015271328.1|4310057_4317881_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	20.7	7.8e-90
WP_015271329.1|4317882_4324347_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.2	2.0e-128
WP_080604897.1|4324668_4326075_+	PAAR domain-containing protein	NA	A0A2H4JEI9	uncultured_Caudovirales_phage	43.5	3.7e-59
>prophage 292
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4329797	4334982	5875750		Planktothrix_phage(33.33%)	4	NA	NA
WP_015271335.1|4329797_4331450_+	cyclic peptide export ABC transporter	NA	G9BWD6	Planktothrix_phage	25.7	8.9e-12
WP_015271336.1|4331604_4332762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015271337.1|4332898_4333834_-	aspartyl/asparaginyl beta-hydroxylase domain-containing protein	NA	H8ZJK8	Ostreococcus_tauri_virus	39.9	8.0e-34
WP_013973746.1|4334007_4334982_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	49.8	1.6e-69
>prophage 293
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4351978	4352911	5875750		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_015271353.1|4351978_4352911_-	D-2-hydroxyacid dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	30.1	1.4e-06
>prophage 294
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4381686	4439716	5875750	capsid,head,holin,terminase,integrase,tail,protease,portal	uncultured_Caudovirales_phage(45.1%)	84	4383333:4383392	4438034:4438098
WP_015271374.1|4381686_4383048_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	40.9	4.8e-64
4383333:4383392	attL	TATGGCGGAGAGATAGGGATTTGAACCCTAGGTACTGTTGCCAGTACAACGGATTTCGAA	NA	NA	NA	NA
WP_015271375.1|4383588_4384041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015271376.1|4384200_4384794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015271377.1|4384850_4385297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043935844.1|4385610_4385820_-	hypothetical protein	NA	A0A2H4JG60	uncultured_Caudovirales_phage	52.5	1.7e-08
WP_015271380.1|4385832_4386330_-	DUF2514 domain-containing protein	NA	A0A2H4J3Q6	uncultured_Caudovirales_phage	79.1	2.6e-44
WP_015271381.1|4386326_4386815_-	glycoside hydrolase family 104 protein	NA	Q9MC90	Pseudomonas_phage	64.2	2.9e-51
WP_080604922.1|4386870_4387164_-|tail	tail fiber assembly protein	tail	A0A2H4J9Z7	uncultured_Caudovirales_phage	53.7	3.2e-21
WP_085986373.1|4387907_4388237_-	HNH endonuclease	NA	I6WB06	Burkholderia_virus	62.3	8.7e-20
WP_043935845.1|4388368_4388599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015271385.1|4388595_4389159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015271386.1|4389155_4389470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015271387.1|4389466_4390240_-	Rha family transcriptional regulator	NA	A0A1V0E838	Vibrio_phage	48.5	7.1e-28
WP_015271388.1|4390236_4390533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015271389.1|4390529_4390763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015271390.1|4390771_4391080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_193385034.1|4391076_4391319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015271393.1|4391875_4392565_+	LexA family transcriptional regulator	NA	A0A2H4J868	uncultured_Caudovirales_phage	65.3	8.2e-52
WP_015271394.1|4392698_4393091_+	LuxR family transcriptional regulator	NA	A0A0A0YWH0	Pseudomonas_phage	61.7	1.2e-28
WP_015271395.1|4393799_4394366_+	hypothetical protein	NA	A0A2H4YEU5	Salmonella_virus	47.4	4.7e-45
WP_015271396.1|4394365_4394845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015271397.1|4394930_4395326_+	carbon storage regulator	NA	NA	NA	NA	NA
WP_015271398.1|4395322_4395466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015271399.1|4395462_4396194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016715552.1|4396190_4396355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015271400.1|4396351_4396672_+	hypothetical protein	NA	H2BDI8	Pseudomonas_virus	55.6	7.2e-19
WP_015271401.1|4396668_4397445_+	metallophosphoesterase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	57.5	1.0e-74
WP_015271402.1|4397632_4398823_+|integrase	site-specific integrase	integrase	A0A1B0Z061	Pseudomonas_phage	54.8	1.1e-112
WP_102059550.1|4399230_4399479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015271405.1|4399453_4400275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015271407.1|4400635_4400998_-	hypothetical protein	NA	J7HXL1	Pseudomonas_phage	50.9	3.1e-18
WP_015271408.1|4400994_4401447_-	hypothetical protein	NA	A0A2H4J6R1	uncultured_Caudovirales_phage	52.0	6.1e-32
WP_043936250.1|4401504_4401744_-|tail	tail fiber assembly protein	tail	A0A2H4J9Z7	uncultured_Caudovirales_phage	50.0	4.0e-14
WP_015271410.1|4402100_4402901_-	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	47.8	7.5e-41
WP_015271411.1|4402913_4403969_-	hypothetical protein	NA	A0A2H4JA10	uncultured_Caudovirales_phage	75.2	1.5e-153
WP_015271412.1|4403968_4407340_-	DUF1983 domain-containing protein	NA	A0A2H4J0B1	uncultured_Caudovirales_phage	58.9	0.0e+00
WP_015271413.1|4407336_4407735_-	hypothetical protein	NA	A0A2H4IYI8	uncultured_Caudovirales_phage	70.5	1.0e-54
WP_015271414.1|4407737_4408343_-	hypothetical protein	NA	A0A2H4J0R3	uncultured_Caudovirales_phage	78.5	6.6e-90
WP_015271415.1|4408342_4408927_-	hypothetical protein	NA	A0A2H4IYI9	uncultured_Caudovirales_phage	54.6	5.5e-57
WP_015271416.1|4408972_4412158_-|tail	phage tail tape measure protein	tail	A0A2H4J7J3	uncultured_Caudovirales_phage	32.6	1.1e-47
WP_103462141.1|4412214_4412721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015271417.1|4413005_4413335_-	hypothetical protein	NA	A0A2D1GNT5	Pseudomonas_phage	56.9	7.4e-27
WP_015271418.1|4413375_4413876_-	hypothetical protein	NA	A0A2D1GNF2	Pseudomonas_phage	84.0	4.2e-74
WP_015271419.1|4413931_4414318_-	DUF3168 domain-containing protein	NA	A0A2D1GNT4	Pseudomonas_phage	85.2	8.9e-56
WP_015271420.1|4414310_4414886_-	HK97 gp10 family phage protein	NA	A0A2D1GNN2	Pseudomonas_phage	56.3	6.2e-53
WP_015271421.1|4414889_4415060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015271422.1|4415068_4415395_-|head	phage head closure protein	head	A0A2D1GNG1	Pseudomonas_phage	59.6	2.5e-27
WP_015271423.1|4415394_4415694_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	73.7	1.0e-35
WP_015271424.1|4415693_4415912_-	hypothetical protein	NA	A0A2H4JG33	uncultured_Caudovirales_phage	44.3	8.9e-05
WP_015271425.1|4415961_4417161_-|capsid	phage major capsid protein	capsid	A0A2H4J8D1	uncultured_Caudovirales_phage	65.4	2.8e-148
WP_015271426.1|4417157_4417799_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JA51	uncultured_Caudovirales_phage	75.1	1.1e-87
WP_043935848.1|4417785_4419000_-|portal	phage portal protein	portal	A0A2H4JFN7	uncultured_Caudovirales_phage	71.5	9.3e-168
WP_015271428.1|4419002_4420691_-|terminase	terminase large subunit	terminase	A0A2H4JDK9	uncultured_Caudovirales_phage	82.7	3.4e-253
WP_015271429.1|4420687_4421233_-|terminase	terminase small subunit	terminase	Q3HQS6	Burkholderia_phage	46.5	3.7e-23
WP_043935849.1|4421387_4422023_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_015271431.1|4422031_4422370_-	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	52.9	1.7e-26
WP_015271432.1|4422369_4422693_-|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	64.2	2.7e-29
WP_015271435.1|4423629_4423818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015271436.1|4424134_4424644_-	acyloxyacyl hydrolase	NA	A0A2H4J0I5	uncultured_Caudovirales_phage	95.3	1.1e-85
WP_015271437.1|4425001_4425550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015271438.1|4425546_4425846_-	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	50.6	1.7e-17
WP_015271439.1|4425842_4426349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015271440.1|4426335_4427748_-	AAA family ATPase	NA	A0A0A0YUG7	Pseudomonas_phage	74.7	3.0e-186
WP_043936255.1|4427744_4428563_-	ATP-binding protein	NA	A0A2H4J2L2	uncultured_Caudovirales_phage	46.1	1.3e-56
WP_015271442.1|4429321_4429552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015271443.1|4429548_4430112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015271444.1|4430108_4430423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015271445.1|4430419_4431226_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	47.5	3.1e-26
WP_015271446.1|4431222_4431486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015271447.1|4431482_4431773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015271448.1|4431769_4432006_-	hypothetical protein	NA	A0A1B0VMK4	Pseudomonas_phage	44.6	1.1e-08
WP_015271449.1|4432002_4432308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144050979.1|4432304_4432565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080604898.1|4432881_4433199_-	Cro/Cl family transcriptional regulator	NA	A0A2H4J1L8	uncultured_Caudovirales_phage	64.9	1.3e-12
WP_015271451.1|4433310_4434057_+	helix-turn-helix domain-containing protein	NA	A0A0U1SXS9	Pseudomonas_phage	39.0	9.5e-38
WP_015271452.1|4434197_4434593_+	LuxR family transcriptional regulator	NA	A0A0A0YWH0	Pseudomonas_phage	67.5	1.7e-33
WP_015271453.1|4434683_4435079_+	carbon storage regulator	NA	NA	NA	NA	NA
WP_015271454.1|4435075_4435219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144050977.1|4435224_4436001_+	hypothetical protein	NA	F1C596	Cronobacter_phage	33.9	9.6e-25
WP_015271456.1|4436003_4436411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015271457.1|4436407_4436659_+	hypothetical protein	NA	B5WZU8	Pseudomonas_phage	56.6	1.3e-15
WP_015271458.1|4436948_4437926_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	69.2	3.0e-124
WP_004375217.1|4438216_4438927_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	37.9	1.9e-40
4438034:4438098	attR	TATGGCGGAGAGATAGGGATTTGAACCCTAGGTACTGTTGCCAGTACAACGGATTTCGAATCCGT	NA	NA	NA	NA
WP_015271459.1|4438957_4439716_-	MBL fold metallo-hydrolase	NA	A8ATK9	Listeria_phage	28.3	1.3e-18
>prophage 295
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4450892	4455158	5875750		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_015271465.1|4450892_4452956_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	53.8	4.1e-22
WP_015271466.1|4453111_4454071_+	cation transporter	NA	NA	NA	NA	NA
WP_080604899.1|4454441_4455158_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.9	9.4e-27
>prophage 296
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4461457	4468899	5875750	tRNA	uncultured_virus(25.0%)	9	NA	NA
WP_004375289.1|4461457_4462504_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	27.4	1.0e-05
WP_015271473.1|4462500_4463118_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_004375291.1|4463227_4463752_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_013973810.1|4463937_4464684_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_015271474.1|4464798_4466574_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	26.3	5.6e-12
WP_003254776.1|4466669_4466891_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_015271475.1|4466983_4467313_-	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013973814.1|4467551_4468025_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	37.1	1.4e-18
WP_015271476.1|4468305_4468899_+	cold shock domain-containing protein	NA	A0A1X9IGI9	Lactococcus_phage	48.3	2.3e-10
>prophage 297
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4480463	4482374	5875750		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_015271484.1|4480463_4482374_-	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	34.8	2.8e-78
>prophage 298
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4489723	4494077	5875750	tRNA	Enterobacteria_phage(50.0%)	4	NA	NA
WP_015271491.1|4489723_4490185_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	49.3	3.8e-37
WP_015271492.1|4490191_4490884_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_015271493.1|4491064_4492387_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_015271494.1|4492730_4494077_-	ATP-binding protein	NA	W8CYF6	Bacillus_phage	22.0	4.6e-06
>prophage 299
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4497311	4504804	5875750		Bacillus_phage(33.33%)	4	NA	NA
WP_015271497.1|4497311_4498919_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.5	1.4e-14
WP_015271498.1|4498915_4499614_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015271499.1|4500427_4503307_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	44.9	7.1e-182
WP_015271500.1|4503553_4504804_+	ribonucleotide-diphosphate reductase subunit beta	NA	K4K678	Caulobacter_phage	28.7	1.4e-30
>prophage 300
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4516107	4517004	5875750		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_015271513.1|4516107_4517004_-	nitrilase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	32.2	1.1e-29
>prophage 301
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4525369	4531202	5875750		Enterobacteria_phage(33.33%)	4	NA	NA
WP_015271515.1|4525369_4526266_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	52.8	2.2e-73
WP_015271516.1|4526269_4527361_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_043936262.1|4527491_4528565_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.8	8.6e-16
WP_015271518.1|4528616_4531202_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	35.0	1.8e-22
>prophage 302
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4538583	4541430	5875750		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_015271526.1|4538583_4541430_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.6	1.0e-15
>prophage 303
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4549226	4558593	5875750		Anomala_cuprea_entomopoxvirus(25.0%)	10	NA	NA
WP_013973920.1|4549226_4549994_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.6	4.9e-13
WP_013973921.1|4549994_4550696_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.7	1.4e-19
WP_015271530.1|4550939_4551614_+	lipoprotein	NA	NA	NA	NA	NA
WP_015271531.1|4551717_4553325_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015271532.1|4553574_4554750_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	55.2	2.9e-97
WP_013973925.1|4554819_4555284_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_015271533.1|4555430_4555664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015271534.1|4555704_4556352_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_015271535.1|4556370_4557348_-	OmpA family protein	NA	NA	NA	NA	NA
WP_015271536.1|4557447_4558593_-	EstA family serine hydrolase	NA	A0A2K9L1U3	Tupanvirus	26.8	1.5e-21
>prophage 304
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4575411	4577070	5875750		Bacillus_phage(100.0%)	1	NA	NA
WP_015271549.1|4575411_4577070_+	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	27.9	6.0e-08
>prophage 305
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4581911	4583016	5875750		Pseudomonas_phage(50.0%)	2	NA	NA
WP_003258001.1|4581911_4582478_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	73.1	8.1e-74
WP_003254922.1|4582806_4583016_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	59.0	1.2e-14
>prophage 306
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4598229	4602762	5875750		Escherichia_phage(33.33%)	3	NA	NA
WP_015271564.1|4598229_4600338_-	molybdopterin oxidoreductase family protein	NA	A0A077SK27	Escherichia_phage	23.0	1.6e-18
WP_015271565.1|4600735_4601656_+	ornithine carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	26.6	3.2e-19
WP_015271566.1|4601652_4602762_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	3.1e-24
>prophage 307
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4606337	4607093	5875750		Escherichia_phage(100.0%)	1	NA	NA
WP_015271570.1|4606337_4607093_+	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.7	3.3e-22
>prophage 308
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4615941	4616676	5875750		Planktothrix_phage(100.0%)	1	NA	NA
WP_015271575.1|4615941_4616676_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	2.2e-31
>prophage 309
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4620507	4621503	5875750		Mycobacterium_phage(100.0%)	1	NA	NA
WP_015271578.1|4620507_4621503_-	alpha/beta fold hydrolase	NA	A0A249XU20	Mycobacterium_phage	27.7	2.8e-05
>prophage 310
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4643671	4662561	5875750	protease,tRNA	Moraxella_phage(25.0%)	18	NA	NA
WP_015271587.1|4643671_4646092_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	38.9	1.3e-139
WP_015271588.1|4646262_4646655_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_015271589.1|4646802_4647546_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A0R6PHT7	Moraxella_phage	20.8	2.3e-07
WP_015271590.1|4647542_4648499_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_015271591.1|4648568_4648772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003258489.1|4649121_4649796_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.1	1.9e-29
WP_015271592.1|4649792_4651175_+	heavy metal sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.9	1.7e-19
WP_015271593.1|4651240_4651981_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_015271594.1|4652024_4652708_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_015271595.1|4652878_4653781_-	GTPase Era	NA	NA	NA	NA	NA
WP_003258487.1|4653773_4654463_-	ribonuclease III	NA	A0A1C9C5A7	Heterosigma_akashiwo_virus	39.9	1.5e-24
WP_003258486.1|4654624_4655479_-	signal peptidase I	NA	NA	NA	NA	NA
WP_013973995.1|4655484_4657284_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	39.3	5.7e-20
WP_015271597.1|4657486_4658680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015271598.1|4658759_4660193_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	32.3	1.5e-28
WP_015271599.1|4660382_4661345_-	MucB/RseB C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_015271600.1|4661357_4661948_-	anti sigma-E protein, RseA	NA	NA	NA	NA	NA
WP_003252049.1|4661979_4662561_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	23.5	8.2e-05
>prophage 311
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4675326	4676019	5875750		Macropodid_alphaherpesvirus(100.0%)	1	NA	NA
WP_015271608.1|4675326_4676019_-	uracil-DNA glycosylase	NA	A0A0Y0A6W9	Macropodid_alphaherpesvirus	46.8	8.2e-52
>prophage 312
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4697998	4698499	5875750		Salmonella_phage(100.0%)	1	NA	NA
WP_015271630.1|4697998_4698499_-	hypothetical protein	NA	J9Q7G7	Salmonella_phage	32.6	3.1e-08
>prophage 313
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4706993	4708313	5875750		Burkholderia_virus(100.0%)	1	NA	NA
WP_003258436.1|4706993_4708313_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.1	1.1e-44
>prophage 314
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4712716	4714354	5875750		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_015271639.1|4712716_4714354_-	5-guanidino-2-oxopentanoate decarboxylase	NA	E4WLQ6	Ostreococcus_tauri_virus	25.0	1.4e-25
>prophage 315
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4733635	4734925	5875750		Burkholderia_virus(100.0%)	1	NA	NA
WP_015271652.1|4733635_4734925_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.2	1.6e-37
>prophage 316
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4743447	4746967	5875750		Klebsiella_phage(50.0%)	2	NA	NA
WP_015271656.1|4743447_4744923_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	41.3	8.3e-78
WP_015271657.1|4745092_4746967_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.8	7.7e-28
>prophage 317
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4756119	4757040	5875750		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_015271664.1|4756119_4757040_-	iron-sulfur-binding ferredoxin reductase	NA	Q58M74	Prochlorococcus_phage	36.5	5.9e-05
>prophage 318
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4789972	4793017	5875750		Leptospira_phage(100.0%)	1	NA	NA
WP_015271690.1|4789972_4793017_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.4	5.4e-63
>prophage 319
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4796153	4799933	5875750		Bacillus_phage(33.33%)	4	NA	NA
WP_003255215.1|4796153_4796837_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.5	2.5e-29
WP_015271693.1|4797020_4797749_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_013974091.1|4797950_4799591_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	63.8	6.9e-174
WP_003260750.1|4799639_4799933_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	41.1	8.3e-14
>prophage 320
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4811524	4812469	5875750		Pterostylis_sanguinea_virus(100.0%)	1	NA	NA
WP_015271701.1|4811524_4812469_-	Nudix family hydrolase	NA	A0A288R5Z2	Pterostylis_sanguinea_virus	43.1	6.0e-05
>prophage 321
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4836831	4842202	5875750	protease	Streptococcus_phage(33.33%)	7	NA	NA
WP_043935900.1|4836831_4837707_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-43
WP_015271717.1|4837893_4839711_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_015271718.1|4839710_4840082_+	YraN family protein	NA	NA	NA	NA	NA
WP_012274070.1|4840168_4840762_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	30.7	1.2e-14
WP_015271720.1|4840758_4841337_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_003260792.1|4841500_4841719_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_015271721.1|4841770_4842202_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	62.7	2.0e-32
>prophage 322
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4857934	4867449	5875750		uncultured_Mediterranean_phage(50.0%)	8	NA	NA
WP_015271732.1|4857934_4859836_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	30.7	2.1e-33
WP_013974136.1|4859852_4860770_-	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_015271733.1|4861083_4861842_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_015271734.1|4862009_4863170_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	30.6	4.8e-12
WP_003251792.1|4863291_4864056_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	9.7e-30
WP_013974139.1|4864066_4865164_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_015271735.1|4865174_4866353_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_015271736.1|4866420_4867449_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	40.1	1.5e-70
>prophage 323
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4871424	4872819	5875750		Vibrio_phage(100.0%)	1	NA	NA
WP_013974146.1|4871424_4872819_-	PhoH family protein	NA	A0A2I7SAD7	Vibrio_phage	43.5	1.3e-96
>prophage 324
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4876228	4877545	5875750		Bacillus_phage(100.0%)	1	NA	NA
WP_003257136.1|4876228_4877545_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	31.0	6.8e-47
>prophage 325
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4887662	4892442	5875750		Pseudomonas_phage(50.0%)	4	NA	NA
WP_015271746.1|4887662_4889120_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	39.7	2.3e-72
WP_015271747.1|4889130_4890288_+	alginate O-acetyltransferase	NA	NA	NA	NA	NA
WP_013974158.1|4890304_4890952_+	alginate O-acetyltransferase AlgF	NA	NA	NA	NA	NA
WP_015271748.1|4890987_4892442_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.5	8.0e-57
>prophage 326
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4907145	4908120	5875750		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_015271760.1|4907145_4908120_+	D-glycerate dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	29.8	8.3e-26
>prophage 327
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4932572	4933505	5875750		Enterobacteria_phage(100.0%)	1	NA	NA
WP_015271783.1|4932572_4933505_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	54.2	1.3e-15
>prophage 328
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4960434	4967556	5875750	tRNA	Moraxella_phage(33.33%)	6	NA	NA
WP_015271803.1|4960434_4961730_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	39.0	1.1e-70
WP_015271804.1|4961726_4962812_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	A0A2K5B251	Erysipelothrix_phage	31.1	2.3e-16
WP_015271805.1|4962939_4963545_-	protocatechuate 3,4-dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_003251597.1|4963555_4964275_-	protocatechuate 3,4-dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_015271806.1|4964502_4965390_+	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_015271807.1|4965636_4967556_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.2	2.1e-20
>prophage 329
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	4989979	4995729	5875750		Virus_Rctr197k(50.0%)	2	NA	NA
WP_015271829.1|4989979_4992055_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.3	6.3e-23
WP_015271830.1|4992051_4995729_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.3	1.0e-07
>prophage 330
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5009570	5011295	5875750		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_015271834.1|5009570_5011295_-	acetolactate synthase 3 large subunit	NA	G9E4W7	Ostreococcus_lucimarinus_virus	29.1	3.5e-19
>prophage 331
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5018553	5019321	5875750		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_015271839.1|5018553_5019321_-	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.1	5.4e-12
>prophage 332
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5030853	5032242	5875750		Bacillus_virus(100.0%)	1	NA	NA
WP_015271847.1|5030853_5032242_+	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	39.5	3.9e-29
>prophage 333
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5036663	5038598	5875750		Staphylococcus_phage(100.0%)	1	NA	NA
WP_015271850.1|5036663_5038598_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	2.1e-81
>prophage 334
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5048325	5050866	5875750		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_015271856.1|5048325_5050866_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	23.6	3.8e-22
>prophage 335
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5056748	5058653	5875750	protease	Micromonas_pusilla_virus(100.0%)	1	NA	NA
WP_015271861.1|5056748_5058653_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	48.8	2.7e-113
>prophage 336
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5064259	5069730	5875750		Halovirus(33.33%)	4	NA	NA
WP_013974294.1|5064259_5065396_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.0	7.2e-45
WP_015271866.1|5065662_5066469_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_013974296.1|5066482_5067607_-	molecular chaperone DnaJ	NA	Q8QNB4	Ectocarpus_siliculosus_virus	29.5	6.7e-19
WP_015271867.1|5067804_5069730_-	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	49.8	3.7e-150
>prophage 337
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5074154	5074637	5875750		Staphylococcus_phage(100.0%)	1	NA	NA
WP_013974300.1|5074154_5074637_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	43.3	1.8e-26
>prophage 338
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5082814	5086862	5875750	integrase	Vibrio_phage(33.33%)	4	5078841:5078854	5084367:5084380
5078841:5078854	attL	TGCCAGCTTCTACC	NA	NA	NA	NA
WP_015271875.1|5082814_5084071_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	47.0	8.3e-111
WP_043935923.1|5084412_5084742_+	hypothetical protein	NA	NA	NA	NA	NA
5084367:5084380	attR	TGCCAGCTTCTACC	NA	NA	NA	NA
WP_015271877.1|5084813_5085782_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	44.4	3.8e-63
WP_080604904.1|5085857_5086862_+	YqaJ viral recombinase family protein	NA	A0A139ZPJ9	Marinitoga_camini_virus	45.9	2.2e-45
>prophage 339
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5094917	5105569	5875750		Diadromus_pulchellus_ascovirus(25.0%)	5	NA	NA
WP_015271885.1|5094917_5097014_-	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	32.7	6.1e-42
WP_043935925.1|5097053_5099951_-	DUF1156 domain-containing protein	NA	K9MDJ7	Sulfolobus_virus	24.7	2.2e-26
WP_015271889.1|5099963_5100605_-	TIGR02646 family protein	NA	NA	NA	NA	NA
WP_015271890.1|5100608_5102039_-	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	29.3	1.2e-12
WP_015271891.1|5102035_5105569_-	DUF3883 domain-containing protein	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	29.3	7.6e-53
>prophage 340
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5115815	5115995	5875750		Vibrio_phage(100.0%)	1	NA	NA
WP_043935929.1|5115815_5115995_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	54.2	3.6e-12
>prophage 341
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5120431	5121295	5875750		Burkholderia_virus(100.0%)	1	NA	NA
WP_015271907.1|5120431_5121295_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	47.3	1.4e-05
>prophage 342
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5131529	5135292	5875750		Tupanvirus(50.0%)	3	NA	NA
WP_015271914.1|5131529_5132444_+	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	25.1	7.3e-16
WP_015271915.1|5132592_5133834_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_015271916.1|5133960_5135292_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	1.6e-51
>prophage 343
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5150092	5152081	5875750		Hokovirus(100.0%)	1	NA	NA
WP_015271930.1|5150092_5152081_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	32.0	3.7e-28
>prophage 344
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5156521	5157520	5875750		Erwinia_phage(100.0%)	1	NA	NA
WP_013974342.1|5156521_5157520_+	PhoH family protein	NA	A0A1B2ICF6	Erwinia_phage	46.1	3.3e-46
>prophage 345
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5161971	5164578	5875750	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_015271934.1|5161971_5164578_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.4	1.9e-189
>prophage 346
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5171241	5173630	5875750		Stx2-converting_phage(50.0%)	2	NA	NA
WP_013974353.1|5171241_5172402_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	41.3	1.9e-69
WP_013974354.1|5172628_5173630_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	52.9	6.6e-18
>prophage 347
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5179307	5180579	5875750		Streptococcus_phage(100.0%)	1	NA	NA
WP_015271944.1|5179307_5180579_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.8	4.2e-94
>prophage 348
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5189421	5195423	5875750		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_015271952.1|5189421_5191029_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.4	3.6e-66
WP_015271953.1|5191211_5192507_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_015271954.1|5192651_5195423_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	27.1	5.1e-44
>prophage 349
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5217989	5221667	5875750		Brazilian_cedratvirus(33.33%)	5	NA	NA
WP_015271971.1|5217989_5218847_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	4.3e-10
WP_015271972.1|5219005_5219704_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.8	3.4e-13
WP_015271973.1|5219735_5220251_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_015271974.1|5220405_5220711_-	chaperone modulatory protein CbpM	NA	NA	NA	NA	NA
WP_013974397.1|5220713_5221667_-	curved DNA-binding protein	NA	A0A1V0SBY2	Catovirus	47.9	2.6e-08
>prophage 350
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5235164	5236753	5875750		Planktothrix_phage(50.0%)	2	NA	NA
WP_015271986.1|5235164_5235881_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.2	7.8e-13
WP_010955466.1|5235877_5236753_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	22.2	6.2e-12
>prophage 351
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5240785	5248258	5875750		Agrobacterium_phage(20.0%)	6	NA	NA
WP_015271989.1|5240785_5241991_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	35.2	2.3e-49
WP_013974414.1|5241994_5242822_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	46.6	1.7e-48
WP_169774654.1|5242902_5243355_-	azurin	NA	NA	NA	NA	NA
WP_015271991.1|5243701_5244289_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	24.4	8.0e-08
WP_013974417.1|5244443_5246744_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	95.0	2.6e-134
WP_015271992.1|5246860_5248258_-	replicative DNA helicase	NA	O80281	Escherichia_phage	59.5	1.9e-148
>prophage 352
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5251469	5254046	5875750		Lactococcus_phage(100.0%)	1	NA	NA
WP_015271993.1|5251469_5254046_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.6	4.2e-69
>prophage 353
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5263136	5266659	5875750		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_015272003.1|5263136_5265071_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.9	2.0e-18
WP_013974430.1|5265366_5266659_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	36.6	1.0e-71
>prophage 354
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5272994	5276317	5875750		Wolbachia_phage(50.0%)	2	NA	NA
WP_015272007.1|5272994_5274890_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.0	1.8e-93
WP_015272008.1|5274886_5276317_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	29.3	7.0e-13
>prophage 355
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5279606	5280149	5875750		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_015272012.1|5279606_5280149_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	38.0	6.7e-25
>prophage 356
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5290745	5299179	5875750	protease	Bacillus_virus(66.67%)	8	NA	NA
WP_015272018.1|5290745_5293004_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.1	5.7e-86
WP_015272019.1|5293014_5293533_-|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
WP_013974455.1|5293529_5294516_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_015272020.1|5294512_5296417_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.6	1.3e-94
WP_003258136.1|5296452_5297061_-	esterase	NA	NA	NA	NA	NA
WP_015272021.1|5297232_5298033_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_016501905.1|5298118_5298571_-	DUF1249 domain-containing protein	NA	NA	NA	NA	NA
WP_015272022.1|5298561_5299179_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	35.7	4.8e-19
>prophage 357
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5311366	5314727	5875750		Prochlorococcus_phage(50.0%)	2	NA	NA
WP_015272030.1|5311366_5312788_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A0K0KVL9	Prochlorococcus_phage	38.2	1.1e-18
WP_013974473.1|5312918_5314727_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	4.6e-54
>prophage 358
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5323011	5324769	5875750		Synechococcus_phage(100.0%)	1	NA	NA
WP_015272039.1|5323011_5324769_-	carbamoyltransferase	NA	E3SL71	Synechococcus_phage	31.4	9.4e-36
>prophage 359
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5338628	5341506	5875750		Mycobacterium_phage(50.0%)	2	NA	NA
WP_015272048.1|5338628_5340056_+	multidrug transporter subunit MdtD	NA	A0A0M3UL24	Mycobacterium_phage	28.8	3.1e-21
WP_013974490.1|5340120_5341506_+	ATP-dependent RNA helicase DbpA	NA	A0A1V0SBR7	Catovirus	31.1	6.1e-46
>prophage 360
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5347645	5349772	5875750		Bacillus_virus(100.0%)	1	NA	NA
WP_015272053.1|5347645_5349772_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	32.7	1.0e-20
>prophage 361
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5357449	5368871	5875750		uncultured_Caudovirales_phage(33.33%)	11	NA	NA
WP_015272060.1|5357449_5358640_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	57.1	2.1e-116
WP_015272061.1|5358785_5360486_+	NAD-dependent DNA ligase LigB	NA	G3M9X7	Bacillus_virus	22.4	1.6e-24
WP_015272062.1|5360618_5361011_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_015272063.1|5361168_5361615_-	cytochrome c	NA	NA	NA	NA	NA
WP_015272064.1|5361733_5362885_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_015272065.1|5362934_5363321_-	MAPEG family protein	NA	A0A2H4J146	uncultured_Caudovirales_phage	68.8	1.1e-40
WP_015272066.1|5363349_5364183_-	EamA family transporter	NA	NA	NA	NA	NA
WP_015272067.1|5364537_5365353_+	DUF3800 domain-containing protein	NA	A5X9G9	Aeromonas_virus	39.1	2.6e-49
WP_015272068.1|5365495_5366731_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	83.7	6.7e-105
WP_003257757.1|5366764_5367166_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_015272069.1|5367461_5368871_+	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	29.6	2.8e-38
>prophage 362
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5372220	5374104	5875750		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_015272073.1|5372220_5374104_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.5	1.5e-42
>prophage 363
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5381277	5389261	5875750		Bacillus_phage(66.67%)	4	NA	NA
WP_015272078.1|5381277_5386230_-	Hpt domain-containing protein	NA	W8CYM9	Bacillus_phage	35.0	2.4e-12
WP_015272079.1|5386278_5388333_-	type IV pili methyl-accepting chemotaxis transducer N-terminal domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.8	5.9e-21
WP_003257767.1|5388344_5388899_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_003257768.1|5388895_5389261_-	twitching motility response regulator PilH	NA	W8CYM9	Bacillus_phage	32.5	5.7e-12
>prophage 364
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5396731	5401487	5875750	protease	Erwinia_phage(50.0%)	4	NA	NA
WP_015272084.1|5396731_5398075_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.9	5.0e-45
WP_003249306.1|5398245_5398623_+	DUF971 domain-containing protein	NA	NA	NA	NA	NA
WP_015272085.1|5398892_5400572_+	class II poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_015272086.1|5400635_5401487_+	poly(3-hydroxyalkanoate) depolymerase	NA	A0A1L7N183	Ralstonia_phage	47.7	2.4e-69
>prophage 365
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5407094	5416905	5875750		uncultured_Caudovirales_phage(40.0%)	10	NA	NA
WP_015272092.1|5407094_5408714_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ES62	Bathycoccus_sp._RCC1105_virus	29.5	2.1e-37
WP_013974544.1|5408786_5409179_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_015272093.1|5409180_5409516_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_003259853.1|5409669_5409942_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_003259854.1|5409945_5410323_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_013974546.1|5410319_5411108_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	34.1	1.6e-30
WP_015272094.1|5411104_5411812_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_015272095.1|5411912_5413829_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.9	7.4e-18
WP_015272096.1|5414092_5416036_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	78.6	5.0e-14
WP_013974550.1|5416170_5416905_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.3	1.2e-21
>prophage 366
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5434320	5435853	5875750		Catovirus(100.0%)	1	NA	NA
WP_015272105.1|5434320_5435853_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.0	1.0e-78
>prophage 367
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5440795	5446231	5875750		Tupanvirus(33.33%)	5	NA	NA
WP_003259870.1|5440795_5441368_-	lipocalin family protein	NA	A0A2K9L4H1	Tupanvirus	33.1	1.7e-18
WP_003249234.1|5441364_5441619_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_013974567.1|5441914_5442511_-	DUF924 domain-containing protein	NA	NA	NA	NA	NA
WP_013974568.1|5442514_5443525_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	35.8	3.5e-51
WP_015272110.1|5443780_5446231_-	glycogen/starch/alpha-glucan phosphorylase	NA	A0A140XAG6	Dickeya_phage	44.3	6.1e-09
>prophage 368
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5450089	5450674	5875750		Cyanophage(100.0%)	1	NA	NA
WP_080604908.1|5450089_5450674_-	2OG-Fe(II) oxygenase	NA	A0A0C5AAT4	Cyanophage	39.0	5.0e-10
>prophage 369
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5457195	5458281	5875750		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_013974577.1|5457195_5458281_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	24.3	6.7e-08
>prophage 370
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5461739	5461994	5875750		Rhizobium_phage(100.0%)	1	NA	NA
WP_003249204.1|5461739_5461994_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	42.1	6.1e-13
>prophage 371
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5465765	5467082	5875750		Moraxella_phage(100.0%)	1	NA	NA
WP_015272120.1|5465765_5467082_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.7	1.3e-26
>prophage 372
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5472629	5479054	5875750	holin	Vibrio_phage(50.0%)	4	NA	NA
WP_015272123.1|5472629_5474633_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	27.7	2.7e-23
WP_003259891.1|5475109_5475766_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_015272124.1|5475805_5477278_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015272125.1|5477356_5479054_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	29.2	4.2e-49
>prophage 373
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5484585	5490288	5875750		Microcystis_phage(25.0%)	6	NA	NA
WP_015272127.1|5484585_5486046_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	37.2	3.7e-62
WP_015272128.1|5486173_5486608_+	thioredoxin TrxC	NA	A0A0A7CHH9	Dinoroseobacter_phage	34.7	5.7e-11
WP_013974594.1|5486604_5487378_-	ParA family protein	NA	NA	NA	NA	NA
WP_015272129.1|5487575_5488487_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.0	1.5e-08
WP_043935966.1|5488595_5489840_+	MFS transporter	NA	NA	NA	NA	NA
WP_015272131.1|5489940_5490288_-	NirD/YgiW/YdeI family stress tolerance protein	NA	A0A1I9LJU6	Stx_converting_phage	38.9	1.0e-10
>prophage 374
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5501413	5502682	5875750		Vibrio_phage(100.0%)	1	NA	NA
WP_080604909.1|5501413_5502682_-	type IV pilus secretin PilQ family protein	NA	R9TEZ5	Vibrio_phage	24.9	3.1e-20
>prophage 375
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5512943	5516748	5875750	tRNA	Tupanvirus(33.33%)	4	NA	NA
WP_013974613.1|5512943_5514680_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L2F0	Tupanvirus	36.3	1.5e-94
WP_003257831.1|5514681_5515380_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_013974614.1|5515526_5515946_-	TM2 domain-containing protein	NA	Q19CT9	Aeromonas_virus	45.6	9.5e-11
WP_043935972.1|5516112_5516748_+	C40 family peptidase	NA	A0A2H4PI41	Streptomyces_phage	39.8	4.6e-17
>prophage 376
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5522404	5523001	5875750		Cassava_brown_streak_virus(100.0%)	1	NA	NA
WP_015272150.1|5522404_5523001_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	A0A1K0ILF0	Cassava_brown_streak_virus	32.8	2.0e-14
>prophage 377
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5528520	5534277	5875750		Salicola_phage(33.33%)	5	NA	NA
WP_015272155.1|5528520_5529375_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	38.9	1.2e-39
WP_013974629.1|5529486_5530509_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013974630.1|5530505_5531177_-	cell division ATP-binding protein FtsE	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.3	8.6e-14
WP_015272156.1|5531179_5532691_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_015272157.1|5532921_5534277_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	25.1	5.0e-21
>prophage 378
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5545682	5549044	5875750		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_014861498.1|5545682_5546162_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.0	9.7e-28
WP_013974644.1|5546270_5546522_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	60.7	1.2e-21
WP_010955661.1|5546678_5547491_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	26.3	1.6e-17
WP_170976286.1|5547494_5548313_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_015272168.1|5548504_5549044_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	36.0	1.1e-19
>prophage 379
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5557007	5574836	5875750		Pseudomonas_phage(12.5%)	15	NA	NA
WP_015272174.1|5557007_5557523_-	dihydrofolate reductase	NA	F8SJN4	Pseudomonas_phage	40.9	1.3e-25
WP_043935982.1|5557577_5558969_+	DUF2868 domain-containing protein	NA	NA	NA	NA	NA
WP_015272176.1|5558961_5560326_+	GTPase/DUF3482 domain-containing protein	NA	A0A0R6PHS5	Moraxella_phage	42.6	3.2e-55
WP_015272177.1|5560451_5561000_-	HDIG domain-containing protein	NA	A0A2K9L141	Tupanvirus	48.0	4.1e-38
WP_015272178.1|5561114_5562140_-	putative 2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015272179.1|5562158_5563883_-	putative 2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_015272180.1|5563884_5564943_-	putative 2-aminoethylphosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	5.1e-29
WP_015272181.1|5565174_5566044_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015272182.1|5566053_5568267_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	40.4	4.8e-138
WP_015272183.1|5568351_5568795_+	cadmium resistance transcriptional regulator CadR	NA	NA	NA	NA	NA
WP_013974664.1|5568917_5569889_-	thymidylate synthase	NA	J7KKN7	Erwinia_phage	34.6	7.2e-54
WP_013974665.1|5569940_5570747_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_015272184.1|5570763_5571546_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_015272185.1|5571674_5572421_+	NRDE family protein	NA	A0A0M3ZEJ9	Turkeypox_virus	29.8	3.2e-25
WP_015272186.1|5572556_5574836_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.2	2.8e-16
>prophage 380
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5583621	5584851	5875750		Catovirus(100.0%)	1	NA	NA
WP_003258542.1|5583621_5584851_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	49.1	2.7e-106
>prophage 381
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5593057	5595648	5875750		Mycobacterium_phage(50.0%)	3	NA	NA
WP_043936295.1|5593057_5593876_+	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	36.0	1.3e-08
WP_015272203.1|5594005_5594878_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015272204.1|5594874_5595648_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.6	5.4e-36
>prophage 382
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5602285	5603275	5875750		Bacillus_virus(100.0%)	1	NA	NA
WP_013974693.1|5602285_5603275_-	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	6.7e-31
>prophage 383
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5615244	5616387	5875750		Bacillus_virus(100.0%)	1	NA	NA
WP_013974704.1|5615244_5616387_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	2.0e-26
>prophage 384
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5631400	5634274	5875750		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_015272227.1|5631400_5634274_-	glycine dehydrogenase (aminomethyl-transferring)	NA	M4QFZ1	Prochlorococcus_phage	52.0	4.8e-271
>prophage 385
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5647421	5650142	5875750		Staphylococcus_phage(100.0%)	1	NA	NA
WP_015272239.1|5647421_5650142_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	29.6	7.5e-24
>prophage 386
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5658880	5659207	5875750		Streptomyces_phage(100.0%)	1	NA	NA
WP_012274768.1|5658880_5659207_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	45.2	6.2e-18
>prophage 387
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5674181	5675081	5875750		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_015272253.1|5674181_5675081_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	33.7	7.7e-18
>prophage 388
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5686405	5686696	5875750		Serratia_phage(100.0%)	1	NA	NA
WP_015272266.1|5686405_5686696_+	DUF4031 domain-containing protein	NA	A0A023W4T9	Serratia_phage	38.8	8.8e-08
>prophage 389
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5707427	5709388	5875750		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_015272284.1|5707427_5708438_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	32.0	2.9e-45
WP_015272285.1|5708449_5709388_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	35.3	2.9e-36
>prophage 390
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5743856	5744675	5875750		Mycobacterium_phage(100.0%)	1	NA	NA
WP_015272311.1|5743856_5744675_-	alpha/beta hydrolase	NA	W8EKH7	Mycobacterium_phage	28.8	1.3e-16
>prophage 391
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5757865	5759875	5875750		Bacillus_phage(100.0%)	1	NA	NA
WP_015272320.1|5757865_5759875_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.5	7.3e-117
>prophage 392
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5779444	5782629	5875750		Methanothermobacter_phage(33.33%)	3	NA	NA
WP_003253409.1|5779444_5780656_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	31.6	4.3e-40
WP_015272329.1|5780661_5781117_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	61.2	1.4e-47
WP_015272330.1|5781228_5782629_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	32.2	1.6e-57
>prophage 393
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5787582	5788203	5875750		Bacillus_phage(100.0%)	1	NA	NA
WP_015272332.1|5787582_5788203_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	33.9	2.7e-14
>prophage 394
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5793807	5795916	5875750		Bordetella_phage(100.0%)	1	NA	NA
WP_015272335.1|5793807_5795916_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	42.1	3.7e-10
>prophage 395
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5805689	5805989	5875750		Burkholderia_virus(100.0%)	1	NA	NA
WP_013974808.1|5805689_5805989_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	49.4	1.2e-12
>prophage 396
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5809843	5817352	5875750		Bacillus_phage(75.0%)	7	NA	NA
WP_003253341.1|5809843_5810533_+	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	39.5	5.7e-37
WP_015272347.1|5810581_5811889_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	32.2	2.0e-27
WP_013974815.1|5812107_5813448_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_013974816.1|5813481_5814378_-	M23 family metallopeptidase	NA	A7XXS4	Thermus_virus	38.9	3.7e-12
WP_015272348.1|5814617_5815520_-	response regulator	NA	NA	NA	NA	NA
WP_013974818.1|5815684_5816455_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003258171.1|5816518_5817352_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.9	1.0e-11
>prophage 397
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5827850	5828342	5875750		Tetraselmis_virus(100.0%)	1	NA	NA
WP_003253304.1|5827850_5828342_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.4	2.6e-20
>prophage 398
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5833094	5834138	5875750		Tupanvirus(100.0%)	1	NA	NA
WP_015272358.1|5833094_5834138_+	histone deacetylase family protein	NA	A0A2K9L0J7	Tupanvirus	39.4	7.3e-44
>prophage 399
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5844582	5848744	5875750		Cyanophage(50.0%)	3	NA	NA
WP_015272365.1|5844582_5846025_+	glucose-6-phosphate dehydrogenase	NA	M4QQY0	Cyanophage	36.5	6.2e-78
WP_015272366.1|5846112_5846427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015272367.1|5846557_5848744_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.5	2.1e-117
>prophage 400
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5860734	5867010	5875750		Orpheovirus(33.33%)	3	NA	NA
WP_015272376.1|5860734_5861919_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	33.0	1.7e-36
WP_015272377.1|5862126_5863527_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.4	4.2e-47
WP_015272378.1|5864007_5867010_+	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	31.5	9.2e-07
>prophage 401
NC_019905	Pseudomonas putida HB3267, complete sequence	5875750	5870413	5872767	5875750		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_003090760.1|5870413_5871265_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	64.0	1.0e-96
WP_003090759.1|5871279_5872767_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	87.7	4.3e-239
>prophage 1
NC_019906	Pseudomonas putida HB3267 plasmid pPC9, complete sequence	80360	114	35382	80360	integrase,transposase	Virus_Rctr41k(21.43%)	36	1129:1188	35383:35584
WP_000845048.1|114_1128_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
1129:1188	attL	GGCAGCGCAAGTCAATCCTGGCGGATTCACTACCCCTGCGCGAAGGCCATCGGTGCCGCA	NA	NA	NA	NA
WP_043936525.1|1739_2504_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.2	4.0e-84
WP_000376623.1|3010_3511_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024193717.1|3638_4475_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000845048.1|4615_5629_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004574516.1|5929_6856_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	46.4	1.8e-41
WP_000164043.1|7183_7834_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_001973670.1|7939_9139_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|9170_10055_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000240536.1|10608_11460_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|11767_12583_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_000480968.1|12953_13790_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|13789_14593_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001067855.1|15032_15737_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018326.1|15893_16709_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_025999701.1|17072_17414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000091614.1|17429_17756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000741275.1|17779_18115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001172026.1|18129_18465_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_003151133.1|18445_18823_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_010465829.1|19014_19617_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	50.3	1.6e-40
WP_010799689.1|19600_22630_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_015272386.1|23473_23842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015272387.1|23874_24192_+	hypothetical protein	NA	I3UM57	Rhodobacter_phage	38.7	2.7e-10
WP_015272388.1|24195_25284_+	DNA cytosine methyltransferase	NA	A0A1V0DZ42	Salmonella_phage	30.2	1.7e-11
WP_015272389.1|25294_25555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000179844.1|25759_27439_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_011899345.1|27441_28341_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000376623.1|28397_28898_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|29025_29865_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|29858_30206_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_012300772.1|30397_31657_-	chloramphenicol efflux MFS transporter CmlA5	NA	S4TR35	Salmonella_phage	31.7	1.7e-26
WP_001206317.1|31878_32670_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_003159191.1|32739_33294_-	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_013263789.1|33401_34202_-	subclass B1 metallo-beta-lactamase VIM-1	NA	NA	NA	NA	NA
WP_000845048.1|34368_35382_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
35383:35584	attR	GGCAGCGCAAGTCAATCCTGGCGGATTCACTACCCCTGCGCGAAGGCCATCGGTGCCGCATCGAACGGCCGGTTGCGGAAAGTCCTCCCTGCGTCCGCTGATGGCCGGCAGCAGCCCGTCGTTGCCTGATGGATCCAACCCCTCCGCTGCTATAGTGCAGTCGGCTTCTGACGTTCAGTGCAGCCGTCTTCTGAAAACGACA	NA	NA	NA	NA
