The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_019940	Thioflavicoccus mobilis 8321, complete sequence	4048921	849046	878087	4048921	transposase,plate,tail	Pseudomonas_phage(33.33%)	26	NA	NA
WP_015279765.1|849046_850612_+|tail	phage tail sheath family protein	tail	S5VZH4	Pseudomonas_phage	26.2	2.3e-09
WP_015279766.1|850622_851147_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_015279767.1|851151_851850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157633638.1|852623_852794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015279769.1|852790_854101_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_015279770.1|854097_855984_+	ATP-binding protein	NA	A0A2D2W2C3	Stenotrophomonas_phage	30.2	2.0e-07
WP_015279771.1|855980_856235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015279773.1|858005_858665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015279774.1|858716_859079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083884791.1|859101_860211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015279776.1|860207_860729_+	hypothetical protein	NA	J9PUM0	Bacillus_phage	34.1	3.3e-05
WP_015279777.1|860731_861052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015279778.1|861160_861526_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_015279779.1|861522_864171_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_041603390.1|864167_866972_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_015279781.1|866968_869191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015279782.1|869243_871823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015279783.1|871832_872729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015279784.1|872794_873088_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_083884651.1|873065_873290_+	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_157633639.1|873568_874003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157633640.1|873999_874365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015279787.1|874459_874933_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_015279788.1|874942_875791_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157633641.1|875717_876668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086014990.1|876955_878087_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_019940	Thioflavicoccus mobilis 8321, complete sequence	4048921	2242729	2282521	4048921	tRNA,transposase	Burkholderia_phage(20.0%)	33	NA	NA
WP_015280925.1|2242729_2243689_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	56.6	6.8e-89
WP_157633720.1|2243905_2245390_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_157633721.1|2245867_2246695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015280928.1|2247298_2248726_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_015280929.1|2248851_2249622_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_086014994.1|2249764_2250996_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	79.2	7.6e-125
WP_157633722.1|2251065_2251611_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.2	3.7e-47
WP_051021901.1|2252185_2252494_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_015280931.1|2252964_2253753_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_015280932.1|2254447_2254720_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_015280933.1|2254716_2255832_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_015280934.1|2255831_2258111_-	AsmA family protein	NA	NA	NA	NA	NA
WP_015280935.1|2258377_2260198_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.0	6.7e-45
WP_015280936.1|2260760_2260961_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_015280937.1|2261039_2261837_+	thiazole synthase	NA	NA	NA	NA	NA
WP_083884796.1|2261833_2262586_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_015280939.1|2262585_2263206_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_015280940.1|2263202_2263997_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_015280941.1|2264072_2265062_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_041603661.1|2265274_2265463_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_157633723.1|2265521_2265836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015280943.1|2265848_2266334_-	bacterioferritin	NA	NA	NA	NA	NA
WP_015280944.1|2266377_2266842_-	bacterioferritin	NA	NA	NA	NA	NA
WP_015280945.1|2267144_2267354_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_015280947.1|2267613_2267901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157633724.1|2268037_2269300_+	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_051021903.1|2269385_2273504_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.3	1.3e-16
WP_015280950.1|2274006_2275068_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_015280951.1|2275060_2278294_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_051022005.1|2278296_2279736_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_015280953.1|2279999_2281397_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_172637464.1|2281493_2281862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041603665.1|2281792_2282521_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_019940	Thioflavicoccus mobilis 8321, complete sequence	4048921	2820045	2886742	4048921	transposase,protease,integrase	Paramecium_bursaria_Chlorella_virus(22.22%)	58	2830612:2830636	2850690:2850714
WP_015281405.1|2820045_2821968_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0BXI2	Ostreococcus_lucimarinus_virus	42.9	3.7e-118
WP_041604455.1|2822093_2822711_-	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_015281407.1|2822867_2823827_+	glutathione synthase	NA	NA	NA	NA	NA
WP_015281408.1|2823810_2824896_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_041603746.1|2824952_2825819_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_015281410.1|2825912_2826476_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_015281411.1|2826476_2826878_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_015281412.1|2826864_2827416_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_015281413.1|2827436_2828423_+	aspartate carbamoyltransferase catalytic subunit	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	34.7	5.5e-33
WP_015281414.1|2828415_2829720_+	dihydroorotase	NA	NA	NA	NA	NA
WP_015281415.1|2829716_2830604_+	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
2830612:2830636	attL	GGTCCGCGCAGCGGACCCTACGGCT	NA	NA	NA	NA
WP_015281416.1|2830641_2831412_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_015281417.1|2831416_2832127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015281418.1|2832237_2833764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015281419.1|2833772_2834552_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_015281420.1|2834849_2836742_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_015281421.1|2836831_2837185_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_015281422.1|2837395_2838280_+	hydrogenase nickel incorporation protein HypB	NA	NA	NA	NA	NA
WP_015281423.1|2838406_2838937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015281424.1|2839037_2839637_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_015281425.1|2839732_2839960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015281426.1|2840077_2840320_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_051022024.1|2840645_2841671_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	44.1	1.8e-63
WP_015281428.1|2841689_2842064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157633757.1|2842267_2842621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015281429.1|2842779_2843217_+	PH domain-containing protein	NA	A0A075E0D8	Dickeya_phage	33.6	1.7e-10
WP_015281430.1|2843659_2844376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015281431.1|2844387_2845227_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_083884732.1|2845338_2845632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015281433.1|2845609_2845816_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_086014998.1|2845812_2846043_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_015281435.1|2846303_2846519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041603747.1|2846618_2848199_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	32.8	3.6e-10
WP_015281437.1|2848474_2850184_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_015281438.1|2850521_2850725_+	hypothetical protein	NA	NA	NA	NA	NA
2850690:2850714	attR	AGCCGTAGGGTCCGCTGCGCGGACC	NA	NA	NA	NA
WP_015281439.1|2851192_2853103_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.8	3.6e-49
WP_015281440.1|2853248_2855837_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_157633864.1|2856028_2858851_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.0	9.7e-301
WP_015281442.1|2858986_2860537_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_015281443.1|2860553_2861081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083884735.1|2861067_2861523_-	cytochrome c	NA	NA	NA	NA	NA
WP_015281445.1|2861506_2862253_-	cytochrome c	NA	NA	NA	NA	NA
WP_015281446.1|2862348_2863800_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_051021918.1|2864165_2865092_+	transporter	NA	NA	NA	NA	NA
WP_015281448.1|2865340_2866387_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015281449.1|2866424_2869109_-	DNA polymerase I	NA	S5M8J1	Bacillus_phage	27.9	5.1e-65
WP_041603749.1|2869230_2869881_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_041603750.1|2870645_2872115_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_015281453.1|2872298_2873684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015281454.1|2873747_2874857_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_015281455.1|2875054_2875522_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_015281456.1|2875496_2876132_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_015281457.1|2876395_2877850_+	ribonuclease G	NA	NA	NA	NA	NA
WP_015281458.1|2877849_2881845_+	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_015281459.1|2882320_2882527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015281460.1|2882883_2883714_+	carbon-nitrogen hydrolase family protein	NA	M1HHT1	Paramecium_bursaria_Chlorella_virus	24.3	2.6e-12
WP_015281461.1|2883857_2885300_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_015281462.1|2885392_2886742_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 1
NC_019941	Thioflavicoccus mobilis 8321 plasmid pTHIMO01, complete sequence	88600	63208	70223	88600	transposase	Leptospira_phage(33.33%)	8	NA	NA
WP_157633897.1|63208_63859_-	AAA family ATPase	NA	A0A2H4JGZ2	uncultured_Caudovirales_phage	39.3	4.4e-15
WP_015282539.1|63910_64438_-	3'-5' exonuclease	NA	A0A1D9C9N8	Salinivibrio_phage	38.9	2.6e-18
WP_015282540.1|64569_64812_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_015279036.1|65417_67007_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.2	3.2e-43
WP_015279037.1|67016_67379_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	37.7	2.7e-14
WP_015279038.1|67378_67681_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_015282542.1|67695_68994_+	Retron-type reverse transcriptase	NA	A0A0C5K882	ANMV-1_virus	25.5	1.6e-19
WP_015282543.1|69179_70223_-	hypothetical protein	NA	S5WA20	Leptospira_phage	29.2	9.2e-23
