The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_020089	Mycobacterium tuberculosis 7199-99, complete genome	4421197	2941784	2980056	4421197	tRNA,terminase,protease,head,capsid,integrase	Mycobacterium_phage(30.0%)	47	2970585:2970612	2980209:2980236
WP_003413486.1|2941784_2943863_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943971_2944199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2944195_2945581_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945925_2946426_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2946442_2946883_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2947029_2947707_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2947691_2948045_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2948057_2948483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2948479_2949154_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2949231_2950053_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2950188_2951082_+	universal stress protein TB31.7	NA	NA	NA	NA	NA
WP_003413594.1|2951084_2951903_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951917_2953099_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2953157_2953589_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2954102_2955344_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2955653_2956016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2956362_2957487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2957488_2958028_+	archease	NA	NA	NA	NA	NA
WP_010924557.1|2958167_2959466_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2959504_2959786_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959930_2960416_-	non-heme di-iron catalase	NA	NA	NA	NA	NA
WP_003908019.1|2960442_2960697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2960700_2963037_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2963065_2963308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2963308_2963986_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2964181_2964838_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2965000_2965447_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2965621_2965954_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2966073_2966433_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2966534_2966993_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2967128_2967509_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2967505_2969002_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|2969236_2969428_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
2970585:2970612	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2970718_2971150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2971146_2972145_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2972158_2972623_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003908028.1|2972610_2972862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899411.1|2973032_2974472_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2974479_2975013_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975165_2975792_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003899414.1|2975823_2976147_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2976226_2976472_-	type II toxin-antitoxin system antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2976468_2977896_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2977897_2978290_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2978286_2978547_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2978563_2978926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2978928_2980056_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2980209:2980236	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
