The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019035	Salmonella enterica subsp. enterica serovar Gallinarum str. 9184 isolate ATCC 9184 chromosome, complete genome	4609911	1940432	1949601	4609911	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_000569176.1|1940432_1941380_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	1.6e-10
WP_000824853.1|1941363_1942095_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1942075_1942183_-	protein YohO	NA	NA	NA	NA	NA
WP_001240413.1|1942242_1942974_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	1.3e-100
WP_000272845.1|1943196_1944882_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598635.1|1944878_1945598_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950414.1|1945644_1946112_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_000703145.1|1946868_1947327_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_000195340.1|1947567_1949601_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 2
NZ_CP019035	Salmonella enterica subsp. enterica serovar Gallinarum str. 9184 isolate ATCC 9184 chromosome, complete genome	4609911	2016793	2027300	4609911		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144951.1|2016793_2018197_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|2018374_2019268_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|2019644_2020730_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|2020729_2021629_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857535.1|2021676_2022555_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|2022555_2023107_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000018223.1|2023112_2024087_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|2024102_2024876_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565913.1|2024880_2025960_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|2025986_2027300_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 3
NZ_CP019035	Salmonella enterica subsp. enterica serovar Gallinarum str. 9184 isolate ATCC 9184 chromosome, complete genome	4609911	2808652	2907780	4609911	tRNA,protease,holin,lysis,integrase,portal,tail,terminase	Enterobacteria_phage(27.66%)	98	2860603:2860632	2907916:2907945
WP_001221017.1|2808652_2809348_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128804.1|2809405_2811316_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.6	5.0e-91
WP_000029550.1|2811446_2811791_+	RidA family protein	NA	NA	NA	NA	NA
WP_000457328.1|2811796_2811976_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000978449.1|2812056_2813421_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	34.5	3.6e-43
WP_000381529.1|2813424_2814003_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000624273.1|2814266_2815631_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001192536.1|2815768_2817370_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000421815.1|2817391_2818951_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
WP_000150523.1|2819423_2820392_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406920.1|2820444_2821245_+	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_001518647.1|2821257_2822109_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_001518359.1|2823035_2823602_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010923.1|2823598_2824408_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_000730311.1|2824473_2826219_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_001062678.1|2826438_2826648_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001537930.1|2826660_2826804_-	YobF family protein	NA	NA	NA	NA	NA
WP_001000660.1|2827451_2827739_-	YebO family protein	NA	NA	NA	NA	NA
WP_000714548.1|2827809_2827953_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001236777.1|2828110_2828350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262195.1|2828561_2829353_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_000984498.1|2830827_2831709_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001091237.1|2831901_2833950_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000431401.1|2833969_2834656_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001674914.1|2834753_2835251_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207294.1|2835379_2836663_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001529852.1|2836631_2839265_+	PqiB family protein	NA	NA	NA	NA	NA
WP_001531515.1|2839342_2840782_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_024131108.1|2840899_2841136_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457838.1|2841246_2841438_+	YebW family protein	NA	NA	NA	NA	NA
WP_000986172.1|2841456_2842107_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	5.5e-58
WP_001134856.1|2842330_2842495_-	membrane protein	NA	NA	NA	NA	NA
WP_000182072.1|2842779_2843502_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_000422882.1|2844185_2844581_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
WP_000030934.1|2844910_2845387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025518.1|2845759_2846179_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001576019.1|2846551_2846821_+	hypothetical protein	NA	B6SCX2	Bacteriophage	47.9	3.1e-07
WP_001576018.1|2846986_2847127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233445.1|2850266_2851181_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000480735.1|2851313_2851472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848072.1|2851481_2852096_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000951652.1|2852583_2852730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457876.1|2853243_2853369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001576015.1|2853938_2854139_+	phage virulence factor PagK family protein	NA	NA	NA	NA	NA
WP_000348536.1|2856839_2857331_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	55.0	1.8e-40
WP_001576014.1|2857385_2857574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|2857638_2857806_+	lytic enzyme	NA	NA	NA	NA	NA
2860603:2860632	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_001536069.1|2861420_2862221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000161702.1|2862700_2863423_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000143173.1|2863624_2864194_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	91.0	1.5e-96
WP_000178848.1|2866214_2866457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001576012.1|2869920_2870625_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000606352.1|2870528_2871260_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	1.0e-113
WP_001152416.1|2871269_2871965_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|2872054_2872588_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2872704_2873202_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978295.1|2873300_2873633_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_077904894.1|2873629_2876617_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.0	1.1e-265
WP_010989009.1|2876696_2877026_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478861.1|2877022_2877421_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	6.6e-30
WP_000132759.1|2877466_2878216_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.2	2.4e-89
WP_000196703.1|2878227_2878629_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000453193.1|2878625_2879192_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
WP_000774239.1|2879172_2879472_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107906.1|2879464_2879788_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	60.4	2.9e-28
WP_078054984.1|2879878_2881960_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001009207.1|2881883_2883431_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_000196190.1|2883427_2883634_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989239.1|2883630_2885769_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	7.6e-290
WP_000371784.1|2885725_2886259_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|2886466_2886946_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2886963_2887416_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2887399_2887729_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001576005.1|2888004_2888691_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.1	1.1e-130
WP_000798704.1|2889051_2889501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001675188.1|2889874_2890399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|2890495_2891185_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|2891314_2891542_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_000940753.1|2891538_2892138_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000911593.1|2892201_2892450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|2893138_2895118_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_000529512.1|2895514_2896645_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000089414.1|2896931_2897327_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.1	2.9e-17
WP_158000546.1|2897339_2897882_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	75.5	4.1e-67
WP_000729536.1|2897793_2898792_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.3	4.1e-121
WP_001574210.1|2898838_2899333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001033913.1|2899319_2899574_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	9.1e-17
WP_001574209.1|2899672_2900071_+	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
WP_158001424.1|2900512_2900743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000103933.1|2901077_2901353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682660.1|2901356_2901563_+	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_000799627.1|2901638_2901974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000023718.1|2902114_2904805_+	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	72.5	5.7e-117
WP_001126031.1|2904797_2905628_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.3e-104
WP_000280163.1|2905674_2905860_+	DUF1187 family protein	NA	NA	NA	NA	NA
WP_000743301.1|2905958_2906387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001575998.1|2906447_2906726_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_000087636.1|2906700_2907780_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
2907916:2907945	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
