The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	0	15397	3696428		Klebsiella_phage(100.0%)	12	NA	NA
WP_005014703.1|2212_3070_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|3122_3620_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|3740_5156_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|5165_6350_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|6346_7945_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|9127_9373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|9783_9969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|10124_11036_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|11157_12000_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|12202_13576_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_153566136.1|13566_13722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014726.1|13885_15397_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
>prophage 2
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	31271	37832	3696428	transposase	Ralstonia_virus(66.67%)	6	NA	NA
WP_005011985.1|31271_32492_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|32899_33802_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|33798_34668_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|34664_35516_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|35512_36337_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|36611_37832_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 3
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	41016	44532	3696428		Salmonella_phage(50.0%)	2	NA	NA
WP_005014780.1|41016_43110_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	55.8	2.4e-107
WP_005014781.1|43125_44532_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	28.2	1.5e-20
>prophage 4
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	49420	50878	3696428	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_005014796.1|49420_50878_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	30.0	7.5e-39
>prophage 5
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	54154	55741	3696428		Moraxella_phage(100.0%)	1	NA	NA
WP_005014808.1|54154_55741_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.5	2.9e-36
>prophage 6
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	67663	68485	3696428		Bacillus_virus(100.0%)	1	NA	NA
WP_005019742.1|67663_68485_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	8.0e-30
>prophage 7
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	71904	72453	3696428		Lactobacillus_phage(100.0%)	1	NA	NA
WP_005014837.1|71904_72453_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	32.3	1.5e-11
>prophage 8
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	76358	78953	3696428		Klosneuvirus(100.0%)	1	NA	NA
WP_005019754.1|76358_78953_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	21.1	5.5e-24
>prophage 9
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	84248	85094	3696428		Rhodococcus_phage(100.0%)	1	NA	NA
WP_005014860.1|84248_85094_+	hypothetical protein	NA	A0A1I9SA48	Rhodococcus_phage	35.1	2.4e-37
>prophage 10
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	95280	96443	3696428	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_101557807.1|95280_96443_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
>prophage 11
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	115105	119785	3696428		Escherichia_phage(100.0%)	1	NA	NA
WP_005014902.1|115105_119785_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	28.4	1.1e-27
>prophage 12
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	125571	126691	3696428	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_101557860.1|125571_126691_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.4	3.1e-56
>prophage 13
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	133902	136602	3696428		Anomala_cuprea_entomopoxvirus(50.0%)	3	NA	NA
WP_005014922.1|133902_134661_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.7	7.4e-14
WP_005014928.1|134657_135587_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_005014929.1|135612_136602_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	43.8	1.4e-65
>prophage 14
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	143782	147067	3696428	transposase	Ralstonia_virus(50.0%)	3	NA	NA
WP_005012861.1|143782_145003_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005014939.1|145058_145397_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_005014941.1|145432_147067_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.4	6.0e-85
>prophage 15
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	151314	157068	3696428		Streptococcus_phage(50.0%)	5	NA	NA
WP_005014954.1|151314_153588_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	42.7	1.7e-125
WP_005014957.1|153743_154517_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005014960.1|154529_155435_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005014962.1|155431_156304_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_005014963.1|156318_157068_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.1	6.2e-29
>prophage 16
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	166783	175342	3696428	tRNA	Salmonella_phage(20.0%)	9	NA	NA
WP_005014985.1|166783_167299_+	hypothetical protein	NA	T1SAR8	Salmonella_phage	44.6	3.9e-06
WP_005019785.1|167571_167790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023853053.1|167859_168012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014990.1|167977_168214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014991.1|168504_169860_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.5	2.1e-83
WP_026087904.1|169906_171247_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.9	5.4e-76
WP_005014999.1|171348_171981_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_005015005.1|171980_174350_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	2.2e-80
WP_005019797.1|174382_175342_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	40.2	2.4e-57
>prophage 17
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	182342	184508	3696428		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_005015022.1|182342_184508_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	26.9	7.8e-24
>prophage 18
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	191154	192411	3696428		Phage_21(100.0%)	1	NA	NA
WP_005015031.1|191154_192411_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	64.8	1.2e-11
>prophage 19
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	197010	203101	3696428		Tupanvirus(33.33%)	3	NA	NA
WP_005015039.1|197010_199761_+	insulinase family protein	NA	A0A2K9LA15	Tupanvirus	28.1	1.5e-19
WP_005019808.1|199929_201075_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	60.8	4.0e-19
WP_005015048.1|201175_203101_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.7	2.7e-145
>prophage 20
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	240799	244421	3696428	transposase	Leptospira_phage(50.0%)	3	NA	NA
WP_101557744.1|240799_241919_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015154.1|242479_243058_-	TIGR01841 family phasin	NA	NA	NA	NA	NA
WP_005012861.1|243200_244421_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
>prophage 21
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	248976	250350	3696428		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_005015164.1|248976_250350_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	1.8e-50
>prophage 22
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	255380	260041	3696428	transposase	Bacillus_phage(50.0%)	5	NA	NA
WP_005015171.1|255380_256220_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-62
WP_005019846.1|256241_257099_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_005015173.1|257171_258290_-	porin	NA	NA	NA	NA	NA
WP_005015175.1|258276_258891_-	magnesium transporting ATPase P-type 1	NA	NA	NA	NA	NA
WP_101557744.1|258920_260041_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
>prophage 23
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	266482	275478	3696428		Bacillus_phage(40.0%)	9	NA	NA
WP_005019849.1|266482_268072_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	4.3e-64
WP_005015184.1|268071_268617_+	crossover junction endodeoxyribonuclease RuvC	NA	A0A088FT24	Mycobacterium_phage	30.8	3.5e-05
WP_005015187.1|268700_269273_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_005019851.1|269276_270044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015190.1|270075_270411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015191.1|270334_271402_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.5	2.1e-06
WP_005015192.1|271398_273219_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	33.9	8.7e-77
WP_005015193.1|273334_274543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015194.1|274776_275478_+	response regulator	NA	W8CYM9	Bacillus_phage	36.6	2.8e-31
>prophage 24
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	279489	291155	3696428	tRNA,transposase	Planktothrix_phage(40.0%)	12	NA	NA
WP_005015199.1|279489_281250_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	52.4	2.2e-170
WP_005015201.1|281435_282278_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_005015204.1|282371_283187_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_005015207.1|283190_283463_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_005012365.1|283584_284805_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.2e-183
WP_005015209.1|284856_285078_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_005015210.1|285273_285807_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_005015211.1|285857_287531_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.9	2.9e-42
WP_005015212.1|287630_288512_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005015213.1|288661_289171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015214.1|289188_290184_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.6	7.7e-19
WP_005015215.1|290180_291155_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	2.9e-18
>prophage 25
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	295996	303585	3696428		Lactobacillus_phage(33.33%)	7	NA	NA
WP_005015224.1|295996_297049_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	2.7e-06
WP_005015226.1|297075_298983_-	LTA synthase family protein	NA	NA	NA	NA	NA
WP_005015228.1|299203_300364_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	36.0	1.2e-47
WP_005015230.1|300492_301434_-	membrane protein	NA	NA	NA	NA	NA
WP_005015232.1|301430_302063_-	LysE family translocator	NA	NA	NA	NA	NA
WP_005015233.1|302197_302527_+	YbaN family protein	NA	NA	NA	NA	NA
WP_005015236.1|302535_303585_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	43.1	1.7e-69
>prophage 26
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	311011	315227	3696428		Lactobacillus_phage(50.0%)	3	NA	NA
WP_005015263.1|311011_312394_-	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	24.5	7.2e-15
WP_026087812.1|312397_313414_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015268.1|313838_315227_-	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	32.7	5.7e-52
>prophage 27
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	318374	321137	3696428		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_005015272.1|318374_321137_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	30.1	3.8e-76
>prophage 28
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	338234	340188	3696428		uncultured_virus(100.0%)	2	NA	NA
WP_005015299.1|338234_338522_+	co-chaperone GroES	NA	A0A221S4A8	uncultured_virus	52.1	5.3e-21
WP_005015300.1|338556_340188_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	59.1	4.3e-168
>prophage 29
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	346596	348297	3696428		Orpheovirus(50.0%)	2	NA	NA
WP_005015321.1|346596_347115_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2I2L4Y7	Orpheovirus	32.8	2.0e-10
WP_005019888.1|347124_348297_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	M4QPK3	Synechococcus_phage	41.5	3.4e-34
>prophage 30
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	355392	356163	3696428		Planktothrix_phage(100.0%)	1	NA	NA
WP_005015347.1|355392_356163_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	7.5e-22
>prophage 31
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	361640	362465	3696428		uncultured_Mediterranean_phage(100.0%)	2	NA	NA
WP_005015356.1|361640_362153_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.9	2.5e-29
WP_005015357.1|362210_362465_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.4	2.6e-19
>prophage 32
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	367494	372239	3696428	transposase	Acinetobacter_phage(50.0%)	2	NA	NA
WP_005015370.1|367494_369564_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	28.9	5.4e-06
WP_005011985.1|371018_372239_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 33
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	380942	382466	3696428		Mollivirus(100.0%)	1	NA	NA
WP_005015385.1|380942_382466_-	carboxylesterase family protein	NA	A0A0M4JT58	Mollivirus	31.3	1.5e-26
>prophage 34
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	404884	405835	3696428		Tupanvirus(100.0%)	1	NA	NA
WP_005015421.1|404884_405835_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L8D8	Tupanvirus	35.5	1.2e-42
>prophage 35
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	421025	422336	3696428		Bacillus_phage(100.0%)	1	NA	NA
WP_005019920.1|421025_422336_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.4	6.2e-08
>prophage 36
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	425364	426750	3696428		Bacillus_phage(100.0%)	1	NA	NA
WP_005015461.1|425364_426750_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.5	1.3e-51
>prophage 37
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	431718	444443	3696428	transposase	Chrysochromulina_ericina_virus(20.0%)	11	NA	NA
WP_005015470.1|431718_433638_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A0N9QYX6	Chrysochromulina_ericina_virus	27.0	6.9e-24
WP_005015471.1|433652_434777_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_005019921.1|434777_436133_-	membrane protein	NA	NA	NA	NA	NA
WP_005015472.1|436134_437160_-	SDR family oxidoreductase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	44.9	9.0e-71
WP_005015473.1|437186_438461_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	NA	NA	NA	NA
WP_005015474.1|438560_439664_-	glycosyl transferase family 4 protein 1	NA	NA	NA	NA	NA
WP_005011985.1|440038_441259_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005019922.1|441726_442386_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_005015477.1|442511_442943_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005015478.1|442986_443958_+	thymidylate synthase	NA	A0A142IIU2	Enterobacteria_phage	33.4	1.2e-53
WP_005015479.1|443954_444443_+	dihydrofolate reductase	NA	A0A0S2MU93	Bacillus_phage	39.1	1.4e-26
>prophage 38
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	454046	455696	3696428		Planktothrix_phage(100.0%)	1	NA	NA
WP_005015500.1|454046_455696_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	4.4e-19
>prophage 39
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	460960	463834	3696428		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_005015512.1|460960_463834_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.7	6.5e-260
>prophage 40
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	470613	471177	3696428		Pseudomonas_phage(100.0%)	1	NA	NA
WP_005015532.1|470613_471177_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	74.1	5.8e-72
>prophage 41
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	478479	480555	3696428	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_005015542.1|478479_480555_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	23.6	3.8e-28
>prophage 42
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	484345	487298	3696428		Chrysochromulina_ericina_virus(50.0%)	3	NA	NA
WP_005015556.1|484345_485296_-	arginase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	34.3	4.0e-25
WP_005015559.1|485362_486625_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_005015563.1|486614_487298_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.6	1.0e-25
>prophage 43
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	490697	491459	3696428		Bacillus_virus(100.0%)	1	NA	NA
WP_005015573.1|490697_491459_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.1	6.5e-10
>prophage 44
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	498359	499037	3696428		Bacillus_virus(100.0%)	1	NA	NA
WP_005015595.1|498359_499037_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.5	9.5e-29
>prophage 45
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	517768	518638	3696428		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_005015647.1|517768_518638_-	nitroreductase	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	31.7	2.6e-23
>prophage 46
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	542374	543262	3696428		Lactobacillus_phage(100.0%)	1	NA	NA
WP_005015704.1|542374_543262_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	29.7	1.4e-08
>prophage 47
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	547291	624351	3696428	tRNA,integrase,transposase	Ralstonia_virus(21.43%)	56	550146:550205	598733:599303
WP_005019978.1|547291_548071_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|548093_549041_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|549042_549243_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|549577_550697_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
550146:550205	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|551018_551735_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|551731_552625_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|552788_554009_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|554161_555244_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|556923_557907_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|557969_559382_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|559499_560342_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|560620_561229_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|561244_561865_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|561930_562638_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|562642_563365_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|563351_563642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|563717_564938_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|565662_566514_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|566565_567819_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|567995_568784_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|568903_569818_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|569950_571843_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|572028_573408_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|573852_574149_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|577949_578552_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|578685_579144_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|579145_579745_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|579753_580563_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|580597_581452_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|581571_582159_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|582155_583535_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|584039_584186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|591857_593198_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|593211_594063_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|594074_595340_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|595401_597306_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|599281_600136_-	hypothetical protein	NA	NA	NA	NA	NA
598733:599303	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|600128_600923_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|601138_602089_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|602691_603489_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|603528_604182_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|604162_605227_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|605390_607616_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|607861_609706_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|609822_610695_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|610741_612442_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|612504_613704_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|613714_614593_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|614699_615737_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|615817_616222_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|616233_617691_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|618333_618930_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|619090_619549_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|620326_621298_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|621419_621839_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|623130_624351_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
>prophage 48
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	636746	647061	3696428	tRNA,transposase	Klosneuvirus(50.0%)	8	NA	NA
WP_005015883.1|636746_637172_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.9	2.4e-22
WP_005015887.1|637491_640371_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	1.1e-137
WP_005015889.1|640424_641645_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
WP_005015892.1|641693_642557_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_005015895.1|642556_643150_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_005015897.1|643441_643702_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_005015899.1|644201_644453_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_005020050.1|644439_647061_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.5	2.8e-84
>prophage 49
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	654908	656029	3696428	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_101557770.1|654908_656029_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
>prophage 50
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	669608	675085	3696428		Bacillus_virus(66.67%)	4	NA	NA
WP_005015965.1|669608_671924_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.1	1.0e-77
WP_005020060.1|671937_672525_-	YcxB family protein	NA	NA	NA	NA	NA
WP_005015968.1|672524_674486_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	1.6e-92
WP_005020063.1|674758_675085_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	44.1	9.6e-19
>prophage 51
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	687046	687718	3696428		Synechococcus_phage(100.0%)	1	NA	NA
WP_005015979.1|687046_687718_+	HAD family hydrolase	NA	A0A1D8KNV9	Synechococcus_phage	28.3	1.7e-06
>prophage 52
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	695830	707139	3696428	transposase	uncultured_virus(25.0%)	9	NA	NA
WP_005015994.1|695830_698551_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	29.9	6.5e-68
WP_005015995.1|698567_699233_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KU27	Synechococcus_phage	32.8	3.1e-16
WP_005015996.1|699318_699792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005016002.1|699799_700420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005016004.1|701663_702038_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_005016008.1|702126_703380_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.6	5.1e-28
WP_005016011.1|703376_704234_-	proline/glycine betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_005016013.1|704373_705369_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005011985.1|705918_707139_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 53
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	711884	713105	3696428	transposase	Ralstonia_virus(100.0%)	1	NA	NA
WP_005016023.1|711884_713105_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
>prophage 54
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	717658	730173	3696428	tRNA,transposase	Staphylococcus_phage(25.0%)	11	NA	NA
WP_005016033.1|717658_720316_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	38.7	7.5e-170
WP_005016042.1|720327_721005_+	lipoprotein	NA	NA	NA	NA	NA
WP_005016043.1|721004_722054_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_005016044.1|722077_723337_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.2	1.9e-94
WP_005016045.1|723343_723733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005016046.1|723884_724169_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_005016047.1|724165_724555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005016049.1|724567_725731_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005016057.1|725757_727518_-	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.5	3.5e-14
WP_005016059.1|727514_728816_-	TolC family protein	NA	NA	NA	NA	NA
WP_101557886.1|729053_730173_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
>prophage 55
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	743853	744396	3696428		Clostridium_phage(100.0%)	1	NA	NA
WP_005016070.1|743853_744396_-	3'-5' exonuclease	NA	A0A0A7RWA3	Clostridium_phage	29.7	7.2e-11
>prophage 56
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	794448	795735	3696428		Bacillus_phage(100.0%)	1	NA	NA
WP_005016176.1|794448_795735_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	1.9e-14
>prophage 57
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	814871	820554	3696428	transposase	Ralstonia_virus(50.0%)	5	NA	NA
WP_005011985.1|814871_816092_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017686012.1|817113_817716_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_017686013.1|817844_818039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017686014.1|818035_818503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080691265.1|818841_820554_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	1.8e-31
>prophage 58
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	835974	837959	3696428		Planktothrix_phage(100.0%)	2	NA	NA
WP_005016280.1|835974_836970_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.9	1.7e-18
WP_005016282.1|836966_837959_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	26.5	2.8e-13
>prophage 59
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	862275	863073	3696428		Planktothrix_phage(100.0%)	1	NA	NA
WP_005020175.1|862275_863073_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.6	6.0e-06
>prophage 60
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	877950	883132	3696428		Bacillus_virus(33.33%)	4	NA	NA
WP_005020184.1|877950_878796_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	1.5e-26
WP_005016386.1|880169_880385_-	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_005016388.1|881649_882378_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	7.4e-11
WP_005016390.1|882367_883132_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.8	8.3e-13
>prophage 61
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	901406	902696	3696428		Pandoravirus(100.0%)	1	NA	NA
WP_005016436.1|901406_902696_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	27.4	4.6e-16
>prophage 62
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	906235	923853	3696428	tRNA	Pandoravirus(25.0%)	11	NA	NA
WP_005016441.1|906235_907024_+	ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	25.6	2.7e-14
WP_005016442.1|907020_907731_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.3	1.1e-11
WP_005016444.1|907803_909372_-	tetratricopeptide repeat protein	NA	D6PFH9	uncultured_phage	24.5	8.2e-15
WP_005020191.1|909464_910253_-	META and DUF4377 domain-containing protein	NA	NA	NA	NA	NA
WP_005016454.1|910953_916716_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	39.7	8.3e-198
WP_005016455.1|916722_917853_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	39.9	3.0e-35
WP_005016456.1|917860_918493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005016457.1|918507_919344_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	A0A291ATS8	Pandoravirus	36.5	4.5e-20
WP_005016458.1|919340_920711_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005016459.1|920707_922675_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	42.3	1.2e-36
WP_005016461.1|922671_923853_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	69.6	4.9e-12
>prophage 63
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	928442	929297	3696428		Synechococcus_phage(100.0%)	1	NA	NA
WP_005016475.1|928442_929297_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	41.4	1.7e-11
>prophage 64
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	936293	948471	3696428	tRNA,transposase	uncultured_Caudovirales_phage(20.0%)	11	NA	NA
WP_005016489.1|936293_937670_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	30.5	2.0e-17
WP_005016496.1|937745_938378_-	membrane protein	NA	NA	NA	NA	NA
WP_005016498.1|938497_940351_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.5	1.3e-83
WP_005016501.1|940347_941304_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_005016502.1|941356_942406_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.4	1.0e-69
WP_005016507.1|942660_943356_+	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_005016510.1|943352_944051_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_005016511.1|944050_945409_+	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	36.3	4.4e-25
WP_005016512.1|945405_945879_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_005016516.1|945951_947352_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|947351_948471_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
>prophage 65
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	969533	970067	3696428		Synechococcus_phage(100.0%)	1	NA	NA
WP_005016562.1|969533_970067_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.6	7.5e-13
>prophage 66
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	975225	976368	3696428		Streptococcus_phage(100.0%)	1	NA	NA
WP_005016569.1|975225_976368_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.0	3.2e-37
>prophage 67
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	988933	990054	3696428	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_101557831.1|988933_990054_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
>prophage 68
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1008826	1014281	3696428		Escherichia_phage(25.0%)	5	NA	NA
WP_005016630.1|1008826_1009540_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A0A0RPC6	Escherichia_phage	41.4	1.6e-47
WP_005016651.1|1009552_1010095_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	45.8	1.1e-27
WP_005016652.1|1010200_1011109_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.7	4.4e-05
WP_005016653.1|1011200_1013057_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_076879512.1|1013240_1014281_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.2	4.3e-20
>prophage 69
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1022907	1031072	3696428	transposase	Ralstonia_virus(33.33%)	8	NA	NA
WP_005016668.1|1022907_1024128_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
WP_032826408.1|1024445_1026377_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1026849_1027969_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879513.1|1027972_1028221_+	DUF934 domain-containing protein	NA	NA	NA	NA	NA
WP_005016690.1|1028238_1028805_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_005016691.1|1028807_1029134_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_005016692.1|1029174_1029984_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005016693.1|1029989_1031072_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	40.7	3.3e-07
>prophage 70
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1044598	1046907	3696428		Caulobacter_phage(50.0%)	2	NA	NA
WP_005016699.1|1044598_1045432_+	metallophosphoesterase	NA	A0A067XQN2	Caulobacter_phage	28.3	4.8e-22
WP_005020211.1|1045428_1046907_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	63.6	1.5e-159
>prophage 71
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1061104	1062238	3696428		Streptococcus_phage(100.0%)	1	NA	NA
WP_005016716.1|1061104_1062238_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	44.5	3.4e-63
>prophage 72
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1066962	1074837	3696428	transposase	Ralstonia_virus(33.33%)	8	NA	NA
WP_005011985.1|1066962_1068183_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_153566143.1|1068244_1068388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005016732.1|1068611_1069505_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005016734.1|1069606_1070404_+	pH-regulated membrane protein	NA	A0A1D7XFL1	Escherichia_phage	29.5	8.6e-21
WP_005016735.1|1070451_1071864_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_005016737.1|1071867_1072566_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005016739.1|1072639_1073389_-	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
WP_005016740.1|1073385_1074837_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	24.1	1.7e-19
>prophage 73
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1077884	1078142	3696428		Rhizobium_phage(100.0%)	1	NA	NA
WP_005016747.1|1077884_1078142_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	47.4	2.5e-14
>prophage 74
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1094705	1095926	3696428	transposase	Ralstonia_virus(100.0%)	1	NA	NA
WP_005011985.1|1094705_1095926_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 75
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1111978	1113541	3696428	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_005016811.1|1111978_1112926_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	42.2	1.4e-09
WP_005016812.1|1113028_1113541_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	45.1	1.0e-22
>prophage 76
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1122801	1123818	3696428		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_005016831.1|1122801_1123818_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	43.5	2.0e-75
>prophage 77
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1135311	1140857	3696428		Bacillus_phage(33.33%)	4	NA	NA
WP_005016855.1|1135311_1137234_+	branched-chain amino acid ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	25.1	2.6e-07
WP_005016861.1|1137252_1137975_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.1	1.4e-14
WP_005016863.1|1138022_1138721_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_005016864.1|1138859_1140857_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	22.5	2.2e-36
>prophage 79
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1201000	1205423	3696428		Stx2-converting_phage(50.0%)	5	NA	NA
WP_025341266.1|1201000_1202272_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.8	2.6e-67
WP_005017017.1|1202408_1203056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005017018.1|1203087_1203660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005017020.1|1203682_1204609_-	MCE family protein	NA	NA	NA	NA	NA
WP_005017022.1|1204595_1205423_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.6	4.7e-22
>prophage 80
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1210807	1214257	3696428		Enterobacteria_phage(50.0%)	4	NA	NA
WP_005017033.1|1210807_1211380_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	46.9	9.8e-35
WP_005017035.1|1211376_1212258_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	59.2	1.3e-97
WP_005017039.1|1212254_1213154_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	29.7	3.5e-18
WP_005017042.1|1213150_1214257_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	44.2	3.0e-80
>prophage 81
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1220860	1226818	3696428	tRNA	Catovirus(66.67%)	4	NA	NA
WP_005017062.1|1220860_1222651_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	24.5	5.5e-07
WP_005017064.1|1222692_1223328_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	29.0	1.2e-12
WP_005017066.1|1223330_1223645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005017068.1|1225195_1226818_-	dehydrogenase	NA	A0A1V0S9J5	Catovirus	29.6	5.4e-46
>prophage 82
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1234956	1236030	3696428		Planktothrix_phage(100.0%)	1	NA	NA
WP_005017086.1|1234956_1236030_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	2.6e-28
>prophage 83
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1245424	1246507	3696428		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_005017108.1|1245424_1246507_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	33.2	1.1e-45
>prophage 84
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1249953	1257814	3696428	transposase	Moumouvirus(33.33%)	5	NA	NA
WP_005017117.1|1249953_1251891_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	27.9	2.2e-25
WP_005016594.1|1252024_1252975_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005017119.1|1253056_1253764_-	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_005017120.1|1253827_1256464_+	DNA topoisomerase III	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	26.3	8.0e-23
WP_005017122.1|1256593_1257814_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.1e-181
>prophage 85
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1268340	1279897	3696428	transposase	Staphylococcus_phage(40.0%)	10	NA	NA
WP_005011985.1|1268340_1269561_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005017154.1|1269956_1270625_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	40.7	2.3e-35
WP_050557343.1|1272017_1272515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685324.1|1272556_1272787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020262.1|1273337_1275791_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	1.7e-112
WP_005017160.1|1275870_1276980_-	DNA polymerase III subunit beta	NA	R9TRR6	Rhizobium_phage	29.7	1.6e-41
WP_005017163.1|1276982_1278440_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_005017166.1|1278985_1279120_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_005017168.1|1279241_1279613_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_005017170.1|1279609_1279897_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	52.2	1.8e-13
>prophage 86
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1285938	1287920	3696428		Planktothrix_phage(100.0%)	2	NA	NA
WP_005017182.1|1285938_1286973_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.7	2.4e-15
WP_005017185.1|1286948_1287920_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	6.0e-16
>prophage 87
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1305932	1306124	3696428		Lactococcus_phage(100.0%)	1	NA	NA
WP_005017217.1|1305932_1306124_+	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	65.5	1.4e-14
>prophage 88
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1310059	1326060	3696428		Natrialba_phage(16.67%)	12	NA	NA
WP_005017224.1|1310059_1310854_+	ParA family protein	NA	Q8JL10	Natrialba_phage	33.7	1.6e-19
WP_005017225.1|1310938_1311856_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	35.4	1.2e-13
WP_005017228.1|1311848_1312256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005017230.1|1312710_1313901_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	29.9	8.9e-14
WP_005017233.1|1314197_1314578_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_005020265.1|1314586_1315120_+	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	31.2	6.4e-12
WP_005017239.1|1315178_1315610_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_005017241.1|1315612_1316311_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_005017243.1|1316555_1317080_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_005017245.1|1317164_1317545_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_005017247.1|1317706_1321819_+	DNA-directed RNA polymerase subunit beta	NA	A0A146JCU1	Tokyovirus	30.5	9.6e-23
WP_005017250.1|1321818_1326060_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	24.9	1.6e-68
>prophage 89
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1334603	1337973	3696428		Streptococcus_phage(50.0%)	2	NA	NA
WP_005017269.1|1334603_1336706_+	elongation factor G	NA	A0A1S5SF82	Streptococcus_phage	26.1	6.6e-60
WP_005017271.1|1336782_1337973_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	29.9	8.9e-14
>prophage 90
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1351927	1352755	3696428		Pandoravirus(100.0%)	1	NA	NA
WP_005017310.1|1351927_1352755_+	aspartyl/asparaginyl beta-hydroxylase domain-containing protein	NA	S4VR59	Pandoravirus	37.7	7.8e-25
>prophage 91
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1381543	1390672	3696428	transposase	uncultured_Mediterranean_phage(25.0%)	6	NA	NA
WP_005020279.1|1381543_1384402_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.4	3.9e-297
WP_005017404.1|1384577_1385762_+	MFS transporter	NA	NA	NA	NA	NA
WP_005017406.1|1385993_1386506_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.9	2.0e-39
WP_005012650.1|1387474_1388425_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020296.1|1388550_1389003_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	47.4	1.0e-34
WP_005017410.1|1389016_1390672_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SHV8	Klosneuvirus	28.5	2.5e-22
>prophage 92
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1404346	1409345	3696428		Klosneuvirus(50.0%)	3	NA	NA
WP_005017437.1|1404346_1405537_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.5	5.4e-19
WP_005017439.1|1405593_1405839_+	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_005017441.1|1407737_1409345_-	methylcrotonyl-CoA carboxylase subunit beta	NA	A0A1B2ITV7	Pike_perch_iridovirus	73.6	2.1e-21
>prophage 93
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1446443	1453134	3696428		Tupanvirus(33.33%)	6	NA	NA
WP_005017529.1|1446443_1448051_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	37.2	1.2e-13
WP_005017532.1|1448076_1448706_-	LysE family transporter	NA	NA	NA	NA	NA
WP_005017535.1|1448736_1450062_-	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	29.0	3.9e-42
WP_005017538.1|1450298_1450904_+	LemA family protein	NA	NA	NA	NA	NA
WP_080601047.1|1450884_1451742_+	YgcG family protein	NA	NA	NA	NA	NA
WP_005017543.1|1451775_1453134_-	GTPase/DUF3482 domain-containing protein	NA	A0A0R6PFW5	Moraxella_phage	37.0	6.5e-53
>prophage 94
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1462422	1464403	3696428		uncultured_Mediterranean_phage(100.0%)	2	NA	NA
WP_005017564.1|1462422_1463553_+	PDZ domain-containing protein	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	37.2	3.0e-11
WP_005017566.1|1463617_1464403_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	34.4	5.0e-29
>prophage 95
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1474624	1479195	3696428		Brazilian_cedratvirus(50.0%)	6	NA	NA
WP_005017608.1|1474624_1475434_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.8	2.8e-19
WP_005017611.1|1475570_1476197_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005017613.1|1476222_1477014_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_005017615.1|1477078_1477567_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_005017617.1|1477579_1478362_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_005017621.1|1478358_1479195_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	3.7e-22
>prophage 96
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1487825	1495662	3696428	transposase	Ralstonia_virus(50.0%)	8	NA	NA
WP_005011985.1|1487825_1489046_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005017628.1|1489161_1489905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005017629.1|1490074_1491181_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.1	1.4e-32
WP_005017630.1|1491191_1492031_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_005017631.1|1492088_1492778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005017632.1|1492874_1493327_+	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|1493330_1494551_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005017633.1|1494774_1495662_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	38.5	2.1e-39
>prophage 97
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1503503	1505120	3696428		Flavobacterium_phage(100.0%)	1	NA	NA
WP_005017651.1|1503503_1505120_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	38.2	1.5e-08
>prophage 98
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1512319	1520052	3696428		Chrysochromulina_ericina_virus(33.33%)	6	NA	NA
WP_005017671.1|1512319_1513693_+	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	35.1	6.7e-29
WP_080601017.1|1513791_1515084_+	MFS transporter	NA	NA	NA	NA	NA
WP_005017677.1|1515175_1516498_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.8	1.3e-74
WP_005017679.1|1516494_1517550_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_005017681.1|1517550_1518072_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005017701.1|1518219_1520052_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	48.4	5.0e-157
>prophage 99
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1529260	1530433	3696428		Oenococcus_phage(100.0%)	1	NA	NA
WP_005017728.1|1529260_1530433_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	29.6	1.5e-34
>prophage 100
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1536419	1537640	3696428	transposase	Ralstonia_virus(100.0%)	1	NA	NA
WP_005011985.1|1536419_1537640_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 101
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1548789	1550397	3696428		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_005020340.1|1548789_1550397_-	acetolactate synthase large subunit	NA	G9E4W7	Ostreococcus_lucimarinus_virus	27.1	4.6e-05
>prophage 102
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1570785	1578659	3696428	transposase	Ralstonia_virus(50.0%)	8	NA	NA
WP_005011985.1|1570785_1572006_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005017843.1|1572246_1573113_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_005017848.1|1573117_1574359_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_005017865.1|1574524_1575535_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	36.3	1.0e-18
WP_005020354.1|1575552_1576773_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.0e-182
WP_005017867.1|1576735_1576981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005017869.1|1577082_1577613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005017870.1|1577615_1578659_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	51.6	4.9e-16
>prophage 103
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1584267	1585053	3696428		Staphylococcus_phage(100.0%)	1	NA	NA
WP_005017894.1|1584267_1585053_-	heme ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	2.8e-08
>prophage 104
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1604433	1606362	3696428		Tupanvirus(100.0%)	1	NA	NA
WP_005017943.1|1604433_1606362_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	30.6	3.5e-15
>prophage 105
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1609801	1613800	3696428		Acinetobacter_phage(75.0%)	4	NA	NA
WP_005017953.1|1609801_1610590_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	53.4	4.2e-68
WP_005017955.1|1610586_1611618_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.9	1.8e-71
WP_005017958.1|1611634_1612198_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	61.5	6.2e-66
WP_005017960.1|1612279_1613800_-	anthranilate synthase component I	NA	S4VNU7	Pandoravirus	32.1	6.2e-44
>prophage 106
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1619268	1621211	3696428	tRNA	Streptococcus_phage(50.0%)	2	NA	NA
WP_005017975.1|1619268_1620222_+	D-2-hydroxyacid dehydrogenase family protein	NA	M1NSB9	Streptococcus_phage	29.3	1.1e-14
WP_005017976.1|1620260_1621211_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	67.2	1.8e-94
>prophage 107
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1625420	1626914	3696428		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_005017985.1|1625420_1626914_+	DUF1254 domain-containing protein	NA	M1I2Z8	Paramecium_bursaria_Chlorella_virus	29.9	2.4e-40
>prophage 108
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1639844	1645869	3696428		Planktothrix_phage(66.67%)	5	NA	NA
WP_005018012.1|1639844_1641905_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.8	1.7e-100
WP_005018015.1|1641927_1642962_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_005018017.1|1642976_1643882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005018019.1|1643884_1644895_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.5	2.7e-19
WP_005018021.1|1644891_1645869_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.3	1.3e-15
>prophage 109
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1675596	1676379	3696428		Streptococcus_phage(100.0%)	1	NA	NA
WP_005018082.1|1675596_1676379_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	28.6	1.4e-20
>prophage 110
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1693608	1698005	3696428		Caulobacter_phage(25.0%)	6	NA	NA
WP_005018121.1|1693608_1694202_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	34.2	3.6e-16
WP_005018122.1|1694215_1694674_-	YraN family protein	NA	NA	NA	NA	NA
WP_005018123.1|1694715_1695648_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_005018125.1|1695644_1696202_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	45.1	9.0e-25
WP_005018127.1|1696218_1697136_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	47.2	2.1e-15
WP_005018129.1|1697132_1698005_-	RNase adapter RapZ	NA	A0A1P8D5W0	Corynebacterium_phage	40.0	1.3e-09
>prophage 111
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1705910	1708579	3696428		Staphylococcus_phage(50.0%)	4	NA	NA
WP_005018145.1|1705910_1706696_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	5.0e-21
WP_005018148.1|1706740_1707349_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_005018150.1|1707345_1707969_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_005018153.1|1707973_1708579_-	HAD-IIIA family hydrolase	NA	E3T535	Cafeteria_roenbergensis_virus	27.4	1.0e-10
>prophage 112
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1716817	1720826	3696428		Bacillus_phage(66.67%)	3	NA	NA
WP_005018166.1|1716817_1718560_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	21.1	2.1e-11
WP_032826421.1|1718556_1720212_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.0	4.0e-20
WP_005018178.1|1720277_1720826_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	2.4e-30
>prophage 113
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1734832	1738224	3696428		Catovirus(33.33%)	3	NA	NA
WP_005018215.1|1734832_1736032_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	42.8	2.7e-90
WP_005018218.1|1736205_1737513_-	phosphate regulon sensor histidine kinase PhoR	NA	A0A1V0SGX0	Hokovirus	27.3	3.0e-18
WP_005018221.1|1737525_1738224_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	37.6	1.0e-33
>prophage 114
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1741386	1744531	3696428	transposase	Ralstonia_virus(50.0%)	3	NA	NA
WP_005011985.1|1741386_1742607_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005018236.1|1743066_1743801_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005020393.1|1743802_1744531_+	ABC transporter ATP-binding protein	NA	M1H3A1	Paramecium_bursaria_Chlorella_virus	28.9	3.2e-06
>prophage 115
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1750169	1758420	3696428		uncultured_Mediterranean_phage(50.0%)	7	NA	NA
WP_005018260.1|1750169_1751321_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L470	Tupanvirus	41.8	1.7e-81
WP_005018261.1|1751406_1752048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005018262.1|1752044_1753598_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4QMK7	Micromonas_pusilla_virus	32.2	4.6e-34
WP_005018263.1|1755010_1755874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005018272.1|1755908_1756397_+	D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	39.2	8.4e-19
WP_005018274.1|1756409_1757735_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_005018276.1|1757739_1758420_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	34.7	1.0e-14
>prophage 116
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1762713	1766484	3696428		Dickeya_phage(100.0%)	1	NA	NA
WP_005020395.1|1762713_1766484_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	50.8	1.9e-09
>prophage 117
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1774991	1780126	3696428		Planktothrix_phage(66.67%)	5	NA	NA
WP_005018298.1|1774991_1775663_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.2	2.3e-27
WP_005018300.1|1775917_1776934_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	43.5	1.9e-73
WP_005018302.1|1777040_1778231_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005018304.1|1778232_1779333_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005018305.1|1779385_1780126_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	7.5e-35
>prophage 118
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1801815	1802775	3696428		Barns_Ness_breadcrumb_sponge_sobemo-like_virus(100.0%)	1	NA	NA
WP_005018369.1|1801815_1802775_-	Nudix family hydrolase	NA	A0A221LFJ1	Barns_Ness_breadcrumb_sponge_sobemo-like_virus	53.4	1.1e-06
>prophage 119
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1810912	1812396	3696428		Brazilian_cedratvirus(50.0%)	2	NA	NA
WP_005018389.1|1810912_1811698_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.2	1.6e-11
WP_005018391.1|1811691_1812396_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.5	4.0e-14
>prophage 120
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1816678	1817473	3696428		Bacillus_phage(100.0%)	1	NA	NA
WP_005018400.1|1816678_1817473_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.8	1.4e-18
>prophage 121
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1822842	1828495	3696428	transposase	Staphylococcus_phage(50.0%)	5	NA	NA
WP_005018423.1|1822842_1824495_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	29.0	1.1e-46
WP_005018425.1|1824494_1824923_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005018432.1|1824944_1825349_+	RidA family protein	NA	NA	NA	NA	NA
WP_005018433.1|1825345_1827022_-	DUF342 domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|1827274_1828495_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 122
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1839963	1841844	3696428		Lactococcus_phage(100.0%)	1	NA	NA
WP_005018471.1|1839963_1841844_-	RNB domain-containing ribonuclease	NA	Q0GXV6	Lactococcus_phage	31.5	6.4e-06
>prophage 123
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1852518	1860767	3696428		Pseudomonas_phage(75.0%)	6	NA	NA
WP_005018506.1|1852518_1853646_+	membrane-bound O-acyltransferase	NA	A0A125RNP0	Pseudomonas_phage	32.3	9.3e-29
WP_005018508.1|1853657_1855094_+	D-alanine--poly(phosphoribitol) ligase	NA	A0A2K9L3I8	Tupanvirus	26.7	7.7e-28
WP_005018511.1|1855162_1855717_-	YggT family protein	NA	NA	NA	NA	NA
WP_005018512.1|1855880_1856318_-	histone H1-like DNA-binding protein	NA	NA	NA	NA	NA
WP_005018513.1|1856621_1857818_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A2H4P762	Pseudomonas_phage	28.3	6.6e-33
WP_005018514.1|1857839_1860767_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	43.9	2.8e-170
>prophage 124
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1872214	1873665	3696428		Staphylococcus_phage(50.0%)	2	NA	NA
WP_005018542.1|1872214_1872919_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	2.5e-11
WP_005018544.1|1872915_1873665_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.9	8.4e-10
>prophage 125
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1878383	1879940	3696428		Staphylococcus_phage(100.0%)	1	NA	NA
WP_005018559.1|1878383_1879940_-	benzoate-CoA ligase family protein	NA	A0A2H4PQU7	Staphylococcus_phage	31.8	2.2e-52
>prophage 126
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1893671	1905499	3696428	tRNA	Staphylococcus_phage(40.0%)	11	NA	NA
WP_005018588.1|1893671_1894043_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	57.8	4.3e-31
WP_005018602.1|1895143_1896271_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_005018612.1|1896279_1897695_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	42.7	6.7e-16
WP_005020410.1|1897974_1899204_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005018614.1|1899242_1899899_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_005018615.1|1900102_1901353_+	serine hydroxymethyltransferase	NA	A0A219YCZ0	Aeromonas_phage	52.2	2.8e-98
WP_005018616.1|1901513_1901999_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_005018617.1|1902003_1902966_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005018618.1|1902965_1903526_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_005018619.1|1903561_1904836_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	31.9	1.5e-38
WP_005018620.1|1904857_1905499_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	36.1	7.2e-26
>prophage 127
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1916467	1917688	3696428	transposase	Ralstonia_virus(100.0%)	1	NA	NA
WP_005012861.1|1916467_1917688_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
>prophage 128
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1934302	1940447	3696428	transposase	Bacillus_phage(33.33%)	7	NA	NA
WP_005018648.1|1934302_1935715_-	transglycosylase SLT domain-containing protein	NA	A0A223LD43	Bacillus_phage	29.3	2.1e-06
WP_005018649.1|1935722_1936532_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_005018650.1|1936549_1937314_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005018651.1|1937382_1937844_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	51.5	4.5e-38
WP_005018652.1|1937968_1939051_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005018653.1|1939066_1939264_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005012861.1|1939226_1940447_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
>prophage 129
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1943456	1949668	3696428	transposase	Bradyrhizobium_phage(33.33%)	4	NA	NA
WP_005018655.1|1943456_1944191_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	42.4	2.6e-40
WP_005011985.1|1944359_1945580_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005020417.1|1945954_1946941_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005020418.1|1946944_1949668_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	29.2	6.6e-20
>prophage 130
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1953072	1957855	3696428		Cronobacter_phage(50.0%)	5	NA	NA
WP_005018673.1|1953072_1954119_+	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	39.5	1.4e-58
WP_005018676.1|1954115_1955705_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_005018678.1|1955640_1956150_-	GtrA family protein	NA	NA	NA	NA	NA
WP_017685335.1|1956075_1956969_+	ChbG/HpnK family deacetylase	NA	NA	NA	NA	NA
WP_005018681.1|1956958_1957855_-	alpha/beta fold hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	33.1	6.5e-09
>prophage 131
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1963182	1965297	3696428		Streptococcus_phage(100.0%)	1	NA	NA
WP_005018697.1|1963182_1965297_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.1	6.0e-61
>prophage 132
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1973021	1974752	3696428	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_005018720.1|1973021_1974752_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	28.6	1.2e-11
>prophage 133
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	1979836	1984567	3696428	transposase	Ralstonia_virus(100.0%)	4	NA	NA
WP_005011985.1|1979836_1981057_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005018738.1|1981153_1982083_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005018740.1|1982241_1983147_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005011985.1|1983346_1984567_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 134
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2003637	2005446	3696428		Streptococcus_phage(100.0%)	1	NA	NA
WP_005011919.1|2003637_2005446_-	ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	29.5	2.5e-44
>prophage 135
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2025354	2026338	3696428		Xanthomonas_phage(100.0%)	1	NA	NA
WP_005011976.1|2025354_2026338_+	M23 family metallopeptidase	NA	A0A292GJG6	Xanthomonas_phage	47.7	1.2e-27
>prophage 136
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2030164	2040361	3696428	transposase	Ralstonia_virus(25.0%)	8	NA	NA
WP_005011985.1|2030164_2031385_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005011987.1|2031663_2032821_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_005011989.1|2032897_2034193_+	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	33.6	1.1e-62
WP_005011992.1|2034318_2034858_+	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_005011993.1|2035145_2035358_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_005011994.1|2035375_2037424_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	43.1	2.0e-66
WP_135238889.1|2037438_2037675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005011996.1|2038090_2040361_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.8	1.4e-36
>prophage 137
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2082051	2086082	3696428	tRNA,transposase	Bacillus_phage(50.0%)	4	NA	NA
WP_005012063.1|2082051_2082786_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	36.3	1.3e-34
WP_005012067.1|2082921_2083872_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012069.1|2083965_2085228_+|tRNA	bifunctional tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB/ribosomal protein alanine acetyltransferase RimI	tRNA	NA	NA	NA	NA
WP_005018858.1|2085227_2086082_+	uracil-DNA glycosylase	NA	L7TNG6	Rhizobium_phage	24.0	1.1e-05
>prophage 138
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2092341	2095201	3696428		Ralstonia_phage(50.0%)	2	NA	NA
WP_005012075.1|2092341_2094426_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	44.2	1.8e-147
WP_005012076.1|2094430_2095201_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	6.8e-31
>prophage 139
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2099113	2099791	3696428		Bacillus_virus(100.0%)	1	NA	NA
WP_005012090.1|2099113_2099791_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.9	6.9e-11
>prophage 140
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2103412	2105985	3696428		Brazilian_cedratvirus(50.0%)	2	NA	NA
WP_005012097.1|2103412_2105248_+	branched-chain amino acid ABC transporter ATP-binding protein/permease	NA	A0A2R8FG22	Brazilian_cedratvirus	29.0	1.8e-13
WP_005012100.1|2105244_2105985_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	26.8	1.4e-09
>prophage 141
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2117861	2119037	3696428		Agrobacterium_phage(100.0%)	1	NA	NA
WP_005012129.1|2117861_2119037_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	32.5	4.2e-48
>prophage 142
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2123273	2124587	3696428		Burkholderia_virus(100.0%)	1	NA	NA
WP_005012138.1|2123273_2124587_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	41.0	1.5e-83
>prophage 143
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2138116	2138899	3696428		Rhizobium_phage(100.0%)	1	NA	NA
WP_005012163.1|2138116_2138899_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	32.4	5.0e-13
>prophage 144
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2144409	2148047	3696428		Trichoplusia_ni_ascovirus(33.33%)	5	NA	NA
WP_005012188.1|2144409_2145159_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.0	2.7e-16
WP_005012191.1|2145376_2145616_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	48.5	1.6e-10
WP_005012192.1|2145787_2147017_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_005012193.1|2147019_2147451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012194.1|2147447_2148047_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	26.9	2.6e-06
>prophage 145
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2154403	2165125	3696428	transposase	Streptococcus_phage(20.0%)	11	NA	NA
WP_005012208.1|2154403_2156197_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	23.5	1.4e-23
WP_005012210.1|2156220_2157105_+	signal peptidase I	NA	NA	NA	NA	NA
WP_005012212.1|2157110_2157866_+	ribonuclease III	NA	M4QNJ2	Ostreococcus_lucimarinus_virus	33.5	1.5e-19
WP_005012216.1|2157862_2158753_+	GTPase Era	NA	NA	NA	NA	NA
WP_005012220.1|2158745_2159333_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_005012223.1|2159355_2160447_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.9	2.1e-17
WP_005012365.1|2160456_2161677_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.2e-183
WP_005012225.1|2162085_2162796_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_005012227.1|2162888_2163137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012228.1|2163155_2163593_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_005012229.1|2163610_2165125_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.9	7.3e-53
>prophage 146
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2171371	2181220	3696428	transposase	Ralstonia_virus(40.0%)	8	NA	NA
WP_005011985.1|2171371_2172592_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012244.1|2172759_2173095_+	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_005012247.1|2173290_2173956_-	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	34.5	1.6e-15
WP_005012248.1|2174201_2176091_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	30.7	2.4e-61
WP_005012249.1|2176087_2176495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012250.1|2176578_2177805_+	MFS transporter	NA	NA	NA	NA	NA
WP_005012252.1|2177954_2179934_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	43.6	6.1e-84
WP_005011985.1|2179999_2181220_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 147
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2189969	2191850	3696428		Planktothrix_phage(100.0%)	1	NA	NA
WP_005012277.1|2189969_2191850_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.8	2.0e-20
>prophage 148
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2197373	2208188	3696428		Acinetobacter_phage(20.0%)	9	NA	NA
WP_005012286.1|2197373_2199170_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	49.7	1.3e-165
WP_005012289.1|2199413_2201066_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.5	1.7e-156
WP_005018901.1|2201523_2202810_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	63.4	5.5e-150
WP_005012291.1|2202883_2203255_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_005012292.1|2203273_2203903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012293.1|2203982_2204903_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_005012294.1|2204941_2205463_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_005012299.1|2205485_2207153_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	33.4	9.8e-67
WP_005012301.1|2207348_2208188_-	UDP-2,3-diacylglucosamine diphosphatase	NA	A0A218MKA7	uncultured_virus	48.1	1.9e-66
>prophage 149
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2224929	2228074	3696428	transposase	Ralstonia_virus(50.0%)	3	NA	NA
WP_005012353.1|2224929_2225934_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005012355.1|2225961_2226831_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012356.1|2226997_2228074_+	putative 2-aminoethylphosphonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	1.9e-26
>prophage 150
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2233416	2237653	3696428	transposase	Synechococcus_phage(50.0%)	3	NA	NA
WP_005012364.1|2233416_2234100_-	Fe2+-dependent dioxygenase	NA	A0A1D8KSK5	Synechococcus_phage	39.5	3.9e-14
WP_005018941.1|2234109_2236293_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005012365.1|2236432_2237653_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.2e-183
>prophage 151
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2249726	2251154	3696428		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_005012371.1|2249726_2251154_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	1.6e-41
>prophage 152
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2262762	2264811	3696428		Bacillus_phage(100.0%)	1	NA	NA
WP_005012382.1|2262762_2264811_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	28.0	3.2e-75
>prophage 153
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2275496	2278099	3696428	transposase	Ralstonia_virus(50.0%)	4	NA	NA
WP_005011985.1|2275496_2276717_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012396.1|2276838_2277003_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_005012397.1|2277060_2277261_-	CsbD family protein	NA	NA	NA	NA	NA
WP_005012398.1|2277565_2278099_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	43.3	8.3e-12
>prophage 154
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2283721	2285998	3696428		Bacillus_phage(100.0%)	1	NA	NA
WP_005012399.1|2283721_2285998_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.3	6.6e-58
>prophage 155
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2298421	2302378	3696428	transposase	Leptospira_phage(33.33%)	3	NA	NA
WP_101557744.1|2298421_2299541_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005011985.1|2299614_2300835_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012418.1|2301403_2302378_-	tripartite tricarboxylate transporter substrate binding protein	NA	A0A1B1IU06	uncultured_Mediterranean_phage	24.3	9.6e-06
>prophage 156
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2308828	2314826	3696428		Bacillus_virus(33.33%)	4	NA	NA
WP_005012426.1|2308828_2311468_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.7	2.1e-103
WP_005012427.1|2311475_2312606_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.1	7.1e-77
WP_005012428.1|2312598_2313684_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_025341355.1|2313704_2314826_+	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	24.6	7.1e-13
>prophage 157
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2321748	2327254	3696428		Synechococcus_phage(25.0%)	6	NA	NA
WP_005012447.1|2321748_2322690_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	M4QF80	Synechococcus_phage	29.3	1.7e-12
WP_005012448.1|2322686_2323676_+	ADP-glyceromanno-heptose 6-epimerase	NA	M4PRR6	Cyanophage	31.9	1.7e-26
WP_005012449.1|2323764_2324142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012450.1|2324203_2325115_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	41.0	2.3e-49
WP_005012455.1|2325180_2326320_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_005012456.1|2326339_2327254_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	33.8	3.9e-41
>prophage 158
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2336561	2340594	3696428		Bacillus_virus(50.0%)	4	NA	NA
WP_005012478.1|2336561_2337626_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	1.7e-27
WP_005012482.1|2337622_2338351_+	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_005012483.1|2338364_2339273_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_005012484.1|2339286_2340594_+	sulfate adenylyltransferase	NA	A0A1V0SGC3	Hokovirus	27.2	4.2e-33
>prophage 159
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2344256	2345477	3696428	transposase	Ralstonia_virus(100.0%)	1	NA	NA
WP_005011985.1|2344256_2345477_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 160
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2349515	2350061	3696428		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_005012499.1|2349515_2350061_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	38.4	3.2e-27
>prophage 161
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2354712	2355801	3696428		Synechococcus_phage(100.0%)	1	NA	NA
WP_005012512.1|2354712_2355801_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	V5UTY8	Synechococcus_phage	43.6	2.6e-12
>prophage 162
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2358804	2360025	3696428	transposase	Ralstonia_virus(100.0%)	1	NA	NA
WP_005011985.1|2358804_2360025_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 163
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2372960	2374088	3696428		Mycoplasma_phage(100.0%)	1	NA	NA
WP_005012548.1|2372960_2374088_+	polyamine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	35.3	6.3e-25
>prophage 164
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2384473	2392909	3696428		Catovirus(33.33%)	3	NA	NA
WP_005012567.1|2384473_2388334_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	28.6	1.8e-47
WP_005012570.1|2388379_2389279_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	35.6	8.5e-33
WP_005012572.1|2389417_2392909_+	DNA polymerase III subunit alpha	NA	A0A0K1Y906	Streptomyces_phage	38.4	2.3e-187
>prophage 165
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2400770	2509407	3696428	tRNA,transposase,protease	Ralstonia_virus(16.13%)	97	NA	NA
WP_005012596.1|2400770_2402495_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	29.3	8.6e-50
WP_005011985.1|2402618_2403839_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|2403926_2404517_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|2404513_2404816_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|2404867_2405857_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|2405977_2406859_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|2407032_2407887_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|2407918_2408767_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|2408894_2410115_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|2410133_2410700_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|2410897_2412049_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|2412187_2413192_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|2413348_2414320_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|2414398_2415187_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|2415258_2415495_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|2415503_2416415_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|2416458_2418330_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|2418490_2419288_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|2419519_2419894_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|2419970_2420294_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|2420377_2420650_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|2420664_2421120_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|2421241_2422078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|2422074_2423448_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|2423524_2424481_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|2424568_2425546_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|2425670_2427326_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|2427374_2427839_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|2427835_2428297_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|2428522_2429710_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|2429706_2431011_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|2431007_2432417_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|2432610_2433730_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|2433865_2434885_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|2434893_2437599_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|2437738_2438392_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|2438454_2438817_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|2439383_2440844_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|2441106_2442180_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|2442264_2443485_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|2445242_2446363_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|2446336_2447836_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|2447849_2448953_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|2448957_2450208_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|2450204_2451650_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|2451646_2451961_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|2451962_2453081_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|2453263_2454484_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|2454583_2455450_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|2455510_2456491_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|2456637_2457558_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|2457566_2458679_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|2458760_2459582_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|2459657_2460266_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|2460403_2461780_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|2461841_2462285_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|2462351_2463008_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|2463050_2464170_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|2464339_2464621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|2465331_2466120_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|2466116_2467223_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|2467897_2469256_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|2469370_2469568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2469585_2470706_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|2470799_2471354_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|2471941_2473258_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|2473270_2474284_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|2474830_2475781_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|2475860_2476160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|2477520_2479179_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|2479327_2480548_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|2480665_2481949_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|2481952_2482894_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|2483003_2483462_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|2483842_2484463_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|2484870_2487291_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|2487398_2488136_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|2488182_2489427_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|2489749_2490022_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|2490605_2491334_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|2491355_2492273_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|2492272_2492782_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|2492898_2493570_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|2493679_2494747_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|2494766_2496611_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|2496747_2497935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|2498235_2499021_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|2499044_2500164_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|2500268_2501606_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|2501715_2502657_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|2502712_2503894_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|2504052_2504343_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|2504389_2505058_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|2505054_2505342_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|2505718_2506504_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|2506536_2507271_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2508186_2509407_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 166
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2514194	2570959	3696428	tRNA,transposase,protease	Ralstonia_virus(21.43%)	45	NA	NA
WP_005012808.1|2514194_2515145_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|2515226_2515706_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|2516917_2518117_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|2518262_2518640_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|2518663_2520445_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|2520453_2521191_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|2521475_2523035_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|2523094_2523853_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|2523949_2524606_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|2524759_2525524_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|2525538_2525718_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|2525743_2526778_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|2526774_2527188_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|2527184_2527769_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|2528121_2529480_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|2529573_2530152_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|2530276_2531397_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|2531469_2532726_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|2532829_2534035_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|2534098_2534548_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|2534680_2534926_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|2535150_2535465_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|2540718_2542824_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|2542877_2545187_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|2546540_2548208_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|2548210_2548876_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|2549008_2552815_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|2553040_2554186_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|2554304_2555234_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|2555230_2556307_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|2556303_2557110_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|2557106_2557838_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|2558214_2559453_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|2559500_2559839_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|2560086_2561037_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|2561355_2561538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|2561603_2562824_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|2562917_2564138_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|2564197_2564461_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|2564582_2566082_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_005012868.1|2566502_2566700_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|2566715_2567075_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|2567147_2568170_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|2568182_2570600_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_005012872.1|2570617_2570959_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	43.3	1.3e-13
>prophage 167
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2578561	2583240	3696428		Lake_Baikal_phage(25.0%)	6	NA	NA
WP_005012888.1|2578561_2578771_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	57.1	8.6e-13
WP_005012891.1|2579166_2579913_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	31.2	7.3e-22
WP_005012893.1|2579947_2581909_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	29.9	2.3e-27
WP_005012894.1|2582037_2582286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012896.1|2582415_2582694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012900.1|2582787_2583240_+	low affinity iron permease family protein	NA	G1JW61	Mycobacterium_phage	36.3	8.9e-07
>prophage 168
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2588156	2595350	3696428	transposase	Staphylococcus_phage(40.0%)	8	NA	NA
WP_005012922.1|2588156_2589956_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.4	8.7e-45
WP_080687431.1|2590024_2590480_+	2,5-diketo-D-gluconic acid reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.9e-20
WP_101557744.1|2590503_2591623_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012927.1|2591647_2592103_+	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	48.3	2.1e-35
WP_005012930.1|2592107_2593094_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_005012931.1|2593140_2593347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012933.1|2593343_2594519_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_005012934.1|2594696_2595350_+	serine/threonine protein phosphatase 1	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	47.7	6.3e-54
>prophage 169
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2601618	2604035	3696428	transposase	Ralstonia_virus(50.0%)	2	NA	NA
WP_005011985.1|2601618_2602839_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005019132.1|2603573_2604035_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	43.4	2.0e-17
>prophage 170
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2608683	2611576	3696428	transposase	Ralstonia_virus(50.0%)	2	NA	NA
WP_005011985.1|2608683_2609904_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012976.1|2609911_2611576_-	long-chain-fatty-acid--CoA ligase	NA	Q75ZG1	Hepacivirus	27.3	2.0e-40
>prophage 171
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2633662	2635756	3696428		Bacillus_phage(100.0%)	1	NA	NA
WP_005013017.1|2633662_2635756_+	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	29.2	1.2e-61
>prophage 172
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2642241	2643927	3696428		Planktothrix_phage(100.0%)	1	NA	NA
WP_005013037.1|2642241_2643927_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	1.3e-13
>prophage 173
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2662004	2662679	3696428		Clostridium_phage(100.0%)	1	NA	NA
WP_005019165.1|2662004_2662679_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	34.5	7.6e-10
>prophage 174
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2666448	2666973	3696428		Rhizobium_phage(100.0%)	1	NA	NA
WP_005013100.1|2666448_2666973_+	RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	28.1	2.2e-09
>prophage 175
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2685417	2685921	3696428		Cyanophage(100.0%)	1	NA	NA
WP_005013152.1|2685417_2685921_+	peroxiredoxin	NA	A0A0C5AE74	Cyanophage	43.0	1.5e-26
>prophage 176
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2691141	2693745	3696428		Agrobacterium_phage(100.0%)	1	NA	NA
WP_005013156.1|2691141_2693745_+	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	33.3	5.2e-123
>prophage 177
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2699393	2699774	3696428		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_005013192.1|2699393_2699774_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	45.4	3.6e-17
>prophage 178
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2720182	2721181	3696428		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_005013244.1|2720182_2721181_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	30.2	9.2e-20
>prophage 179
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2725412	2728538	3696428		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_005013249.1|2725412_2728538_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.8	1.1e-23
>prophage 180
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2736907	2740235	3696428		Staphylococcus_phage(50.0%)	3	NA	NA
WP_005013267.1|2736907_2738452_+	malonyl-CoA synthase	NA	A0A2H4PQM9	Staphylococcus_phage	25.5	1.1e-27
WP_005019205.1|2738624_2739593_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005013271.1|2739710_2740235_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	58.9	2.4e-51
>prophage 181
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2743403	2746422	3696428		Indivirus(50.0%)	4	NA	NA
WP_005013279.1|2743403_2744198_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	26.3	1.6e-06
WP_005019211.1|2744301_2745057_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005019213.1|2745067_2745739_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017685452.1|2745735_2746422_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.7	5.7e-21
>prophage 182
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2762071	2770788	3696428		Vibrio_phage(33.33%)	7	NA	NA
WP_005013320.1|2762071_2762914_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.8	4.2e-42
WP_005013321.1|2763232_2764549_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_005013323.1|2764737_2765184_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013326.1|2765324_2765750_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_050427710.1|2765880_2766840_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.0	1.3e-23
WP_005013329.1|2767568_2768684_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_080601025.1|2768784_2770788_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	37.2	4.8e-20
>prophage 183
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2780501	2780813	3696428		Synechococcus_phage(100.0%)	1	NA	NA
WP_076879521.1|2780501_2780813_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	A0A0E3FP00	Synechococcus_phage	41.2	1.0e-06
>prophage 184
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2785666	2786689	3696428		Pseudomonas_phage(100.0%)	1	NA	NA
WP_005013355.1|2785666_2786689_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.2	3.9e-50
>prophage 185
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2791568	2796125	3696428	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_005013366.1|2791568_2792504_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.4e-41
WP_005013368.1|2792561_2794442_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_005013371.1|2794503_2794845_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.4	5.9e-11
WP_005013374.1|2794988_2796125_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.0	6.8e-88
>prophage 186
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2803359	2804580	3696428	transposase	Ralstonia_virus(100.0%)	1	NA	NA
WP_005011985.1|2803359_2804580_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 187
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2827992	2828934	3696428		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_005013423.1|2827992_2828934_+	DnaJ domain-containing protein	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	24.7	1.6e-10
>prophage 188
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2833088	2833886	3696428		Clostridium_phage(100.0%)	1	NA	NA
WP_005013436.1|2833088_2833886_+	M23 family metallopeptidase	NA	I2E8W3	Clostridium_phage	47.3	1.3e-16
>prophage 189
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2843667	2847553	3696428		Mollivirus(33.33%)	4	NA	NA
WP_005013460.1|2843667_2844549_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	36.1	1.3e-49
WP_005013461.1|2844744_2845266_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.2	2.9e-17
WP_005013462.1|2845266_2846532_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_005019292.1|2846524_2847553_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	37.8	9.1e-39
>prophage 190
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2857375	2861156	3696428		Ostreococcus_lucimarinus_virus(33.33%)	3	NA	NA
WP_005013479.1|2857375_2859040_-	thiamine pyrophosphate-binding protein	NA	E5ERI2	Ostreococcus_lucimarinus_virus	24.7	2.0e-27
WP_005013483.1|2859308_2860202_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	29.7	1.3e-20
WP_005013486.1|2860229_2861156_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	26.2	1.7e-23
>prophage 191
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2871307	2873377	3696428		Streptococcus_virus(100.0%)	1	NA	NA
WP_005013497.1|2871307_2873377_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.7	8.2e-47
>prophage 192
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2876838	2880846	3696428		Anomala_cuprea_entomopoxvirus(33.33%)	4	NA	NA
WP_005013506.1|2876838_2877648_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.5	1.1e-12
WP_005013510.1|2877653_2878448_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005013511.1|2878511_2879468_-	transaldolase	NA	M4SPL0	Cyanophage	30.7	3.6e-13
WP_005013512.1|2879691_2880846_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.1	2.6e-50
>prophage 193
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2884160	2885057	3696428		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_005013514.1|2884160_2885057_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	38.3	2.2e-36
>prophage 194
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	2892126	3000966	3696428	tRNA,integrase,transposase	Leptospira_phage(12.9%)	103	2951411:2951427	2997077:2997093
WP_005013523.1|2892126_2893443_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	68.0	2.9e-154
WP_005013526.1|2893643_2894072_+	helix-turn-helix domain-containing protein	NA	A0A1X9I5R1	Streptococcus_phage	30.3	4.2e-06
WP_005011985.1|2894137_2895358_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|2895712_2896189_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|2896447_2897056_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|2897074_2897746_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|2897919_2899806_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|2899833_2900676_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|2900672_2902016_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|2902200_2903016_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013534.1|2903081_2904563_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005013535.1|2904761_2906834_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013536.1|2907053_2908091_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
WP_005013537.1|2909277_2910135_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|2910162_2910939_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_005013539.1|2911766_2912276_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005013542.1|2913353_2914124_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|2914120_2915131_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_101557920.1|2915189_2916270_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_101557831.1|2916438_2917558_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_080601033.1|2917559_2918303_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|2918307_2918679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|2918739_2918985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|2919091_2920591_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|2921212_2921548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|2921806_2921938_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013555.1|2921967_2922465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|2922474_2922849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|2922939_2924232_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|2924348_2925248_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|2925399_2925618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685641.1|2926091_2927717_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013563.1|2927952_2929476_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_005013564.1|2929447_2930143_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|2930482_2931544_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013566.1|2931589_2932141_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013567.1|2932147_2933068_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013568.1|2933207_2935505_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|2935560_2936781_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|2937039_2937645_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|2937655_2938816_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|2938837_2939719_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|2940015_2940714_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|2940855_2941578_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005019317.1|2941696_2942635_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|2942665_2943445_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005013578.1|2943431_2944655_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013579.1|2944659_2946207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013580.1|2946242_2946776_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|2947019_2947715_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|2947729_2947861_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|2947908_2949033_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013584.1|2949038_2951378_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013585.1|2951374_2951782_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
2951411:2951427	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_005013586.1|2952043_2952304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2952526_2953477_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|2953575_2954526_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013587.1|2954575_2955784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|2956005_2956545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013589.1|2956769_2957174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013590.1|2957238_2957994_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013591.1|2957993_2959355_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013592.1|2959351_2959975_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2960018_2961138_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|2961790_2962546_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|2962722_2963517_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|2963513_2963951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|2964062_2964215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|2964635_2965604_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|2965760_2966768_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|2966825_2967284_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|2967357_2968704_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|2968721_2969093_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|2969092_2970562_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|2970717_2971443_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|2971456_2974171_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|2974422_2975787_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|2975826_2976885_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|2976912_2977731_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|2977768_2978047_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|2979310_2979610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|2980179_2981583_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|2981595_2982246_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|2982387_2983608_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|2983638_2984715_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|2984861_2985992_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|2986178_2987804_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|2987810_2988626_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|2988640_2989711_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|2989762_2990422_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|2991061_2992224_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|2992265_2992580_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|2992563_2992950_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|2992988_2993255_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|2993647_2994337_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|2994436_2994598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|2994748_2994913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|2995039_2995276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|2995465_2995714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|2995827_2997198_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
2997077:2997093	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|2997198_2997939_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|2998444_3000397_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
WP_076879490.1|3000417_3000966_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	29.3	3.8e-12
>prophage 195
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3010939	3011389	3696428		Xanthomonas_phage(100.0%)	1	NA	NA
WP_005013645.1|3010939_3011389_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	62.8	2.3e-47
>prophage 196
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3016901	3065370	3696428	tRNA,integrase,holin,transposase	Leptospira_phage(28.57%)	42	3061186:3061200	3067662:3067676
WP_005013654.1|3016901_3018113_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.4	2.2e-36
WP_005013655.1|3018173_3018689_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_005019367.1|3018691_3021553_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|3021542_3022508_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|3023264_3024740_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|3024744_3025020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|3025356_3026476_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|3026350_3026599_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|3026777_3027986_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|3027982_3030265_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|3030275_3032657_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|3032920_3034828_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|3034842_3035733_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|3035739_3036873_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|3036872_3037694_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|3037718_3038909_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|3039210_3039492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|3039657_3039978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|3040017_3041104_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|3041300_3041561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|3042053_3042824_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|3042820_3043831_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|3043865_3044708_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|3045170_3045956_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|3046815_3047935_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|3049001_3050006_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|3050081_3050894_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|3051121_3053293_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|3053346_3054666_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|3054754_3055975_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|3056193_3057054_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|3057050_3058274_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|3058572_3059070_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|3059108_3059891_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|3059916_3060135_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|3060209_3060479_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|3060698_3061163_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
3061186:3061200	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|3061236_3061518_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|3061634_3062618_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_005013688.1|3062861_3063860_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_005013689.1|3063962_3064394_+	TonB family protein	NA	NA	NA	NA	NA
WP_005013690.1|3064458_3065370_+	phosphoglycerate dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	30.7	3.7e-20
3067662:3067676	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 197
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3075657	3077433	3696428		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_005013701.1|3075657_3077433_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.4	3.5e-38
>prophage 198
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3084756	3129285	3696428	transposase	Ralstonia_virus(40.0%)	41	NA	NA
WP_005013706.1|3084756_3085611_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.8	1.4e-29
WP_005013707.1|3085730_3087785_+	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_005012067.1|3087894_3088845_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|3088841_3089357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|3089714_3090335_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|3090434_3090686_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|3090773_3092252_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|3092248_3095419_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|3095431_3096628_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|3096816_3097749_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|3097817_3098549_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|3098614_3099250_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|3099235_3100414_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|3100574_3101123_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|3101203_3101563_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|3101610_3102831_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|3102906_3104028_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|3104065_3104779_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|3104789_3106010_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|3106092_3106647_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|3106792_3107743_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|3107702_3107864_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|3107904_3108831_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|3108844_3109717_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|3109879_3110827_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|3111165_3111747_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|3112324_3113275_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|3113254_3114007_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|3114019_3114751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|3114907_3117073_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|3117162_3117432_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|3117520_3117727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|3117725_3118244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|3118262_3119042_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|3119209_3120226_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|3120298_3120790_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|3120800_3122516_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|3123679_3124630_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|3126281_3127523_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|3127534_3128308_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|3128334_3129285_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 199
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3139239	3140463	3696428		Salmonella_phage(100.0%)	1	NA	NA
WP_005013755.1|3139239_3140463_+	alcaligin siderophore export MFS transporter Bcr	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
>prophage 200
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3145880	3146861	3696428		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_005013759.1|3145880_3146861_+	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	29.2	5.6e-14
>prophage 201
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3152330	3153059	3696428		Bacillus_virus(100.0%)	1	NA	NA
WP_005013766.1|3152330_3153059_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	42.7	2.5e-11
>prophage 202
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3160072	3161698	3696428		Rhizobium_phage(100.0%)	1	NA	NA
WP_005013772.1|3160072_3161698_+	ATP-dependent DNA ligase	NA	A0A068CDF3	Rhizobium_phage	38.1	5.3e-25
>prophage 203
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3165225	3167955	3696428		Staphylococcus_phage(100.0%)	1	NA	NA
WP_005013781.1|3165225_3167955_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	2.7e-21
>prophage 204
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3174293	3177721	3696428		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_005013802.1|3174293_3174653_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	57.1	2.3e-29
WP_005013805.1|3174699_3176103_-	CoA transferase	NA	NA	NA	NA	NA
WP_005013807.1|3176308_3177721_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	25.9	4.0e-37
>prophage 205
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3181040	3181535	3696428		Canarypox_virus(100.0%)	1	NA	NA
WP_005013814.1|3181040_3181535_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	38.4	7.5e-23
>prophage 206
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3193352	3193976	3696428		Bacteriophage(100.0%)	1	NA	NA
WP_005013846.1|3193352_3193976_-	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	37.0	3.5e-25
>prophage 207
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3197903	3199124	3696428	transposase	Ralstonia_virus(100.0%)	1	NA	NA
WP_005011985.1|3197903_3199124_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 208
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3204392	3208103	3696428	transposase	Staphylococcus_phage(50.0%)	4	NA	NA
WP_005013871.1|3204392_3204854_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.9	2.5e-28
WP_005013873.1|3204952_3205903_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|3206001_3206952_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013876.1|3206963_3208103_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.5	9.8e-18
>prophage 209
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3211534	3216742	3696428		Hokovirus(50.0%)	5	NA	NA
WP_005013893.1|3211534_3213901_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.0	4.5e-166
WP_005013895.1|3214059_3214887_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_005013898.1|3214897_3215296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013899.1|3215357_3216137_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013901.1|3216133_3216742_-	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	42.0	2.0e-25
>prophage 210
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3227011	3227770	3696428		Flavobacterium_phage(100.0%)	1	NA	NA
WP_005013920.1|3227011_3227770_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	30.8	4.7e-16
>prophage 211
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3236685	3238206	3696428		Mollivirus(100.0%)	1	NA	NA
WP_005013935.1|3236685_3238206_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.3	2.0e-95
>prophage 212
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3261824	3263571	3696428		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_005013977.1|3261824_3263018_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.5	1.7e-12
WP_076879492.1|3262860_3263571_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	52.5	2.5e-27
>prophage 213
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3275830	3276025	3696428		Pseudomonas_phage(100.0%)	1	NA	NA
WP_005013988.1|3275830_3276025_-	DUF3596 domain-containing protein	NA	A0A1W6JTA0	Pseudomonas_phage	52.8	1.1e-06
>prophage 214
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3283324	3284077	3696428		Planktothrix_phage(100.0%)	1	NA	NA
WP_005013994.1|3283324_3284077_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	4.3e-30
>prophage 215
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3289021	3290511	3696428		Staphylococcus_phage(50.0%)	2	NA	NA
WP_005014002.1|3289021_3289750_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.1	1.8e-09
WP_005014003.1|3289746_3290511_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.3e-18
>prophage 216
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3297053	3298598	3696428		Moraxella_phage(100.0%)	1	NA	NA
WP_005019488.1|3297053_3298598_-	CBS domain-containing protein	NA	A0A0R6PEZ3	Moraxella_phage	42.9	8.8e-38
>prophage 217
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3301607	3305264	3696428		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_005019492.1|3301607_3305264_+	transporter substrate-binding domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	32.0	6.5e-39
>prophage 218
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3309534	3310654	3696428	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_101557770.1|3309534_3310654_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
>prophage 219
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3317877	3319575	3696428		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_005014020.1|3317877_3319575_+	thiamine pyrophosphate-binding protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.7	4.0e-31
>prophage 220
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3326428	3327549	3696428	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_101557831.1|3326428_3327549_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
>prophage 221
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3331009	3334865	3696428	transposase	Ralstonia_virus(33.33%)	4	NA	NA
WP_005011985.1|3331009_3332230_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005019508.1|3332534_3333305_+	amino acid racemase	NA	NA	NA	NA	NA
WP_005014033.1|3333395_3334097_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.0	2.1e-15
WP_005014034.1|3334097_3334865_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-15
>prophage 222
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3338594	3339143	3696428		Vibrio_phage(100.0%)	1	NA	NA
WP_005014038.1|3338594_3339143_-	queuosine precursor transporter	NA	A0A2I7SAW6	Vibrio_phage	34.6	1.7e-15
>prophage 223
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3343562	3345975	3696428	transposase	Planktothrix_phage(50.0%)	2	NA	NA
WP_005014047.1|3343562_3344651_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.2	1.3e-22
WP_005014079.1|3344754_3345975_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	2.7e-183
>prophage 224
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3356999	3357695	3696428		Catovirus(100.0%)	1	NA	NA
WP_076879525.1|3356999_3357695_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	27.7	9.2e-11
>prophage 225
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3362183	3363795	3696428		Pithovirus(50.0%)	2	NA	NA
WP_005014060.1|3362183_3362684_-	DNA starvation/stationary phase protection protein	NA	W5S6G8	Pithovirus	36.1	1.4e-13
WP_005019523.1|3362835_3363795_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	26.1	2.7e-13
>prophage 226
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3367808	3369029	3696428	transposase	Ralstonia_virus(100.0%)	1	NA	NA
WP_005011985.1|3367808_3369029_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 227
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3372979	3373756	3696428		Planktothrix_phage(100.0%)	1	NA	NA
WP_005014068.1|3372979_3373756_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.0	1.9e-25
>prophage 228
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3378191	3379256	3696428		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_005014073.1|3378191_3379256_-	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.6	2.5e-07
>prophage 229
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3384695	3387731	3696428	transposase	uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_033903456.1|3384695_3386357_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.7	2.1e-13
WP_005014079.1|3386510_3387731_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	2.7e-183
>prophage 230
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3396906	3402461	3696428		Clostridium_phage(25.0%)	6	NA	NA
WP_005014088.1|3396906_3397449_+	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	42.3	1.8e-22
WP_005014089.1|3397485_3398256_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_025341458.1|3398429_3399062_+	guanylate kinase	NA	A0A223FN12	Murmansk_poxvirus	34.0	7.8e-17
WP_003811126.1|3399105_3399309_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_005014092.1|3399332_3401630_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	32.8	2.0e-06
WP_017685303.1|3401732_3402461_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.4	9.6e-35
>prophage 231
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3413198	3441572	3696428	transposase	uncultured_Mediterranean_phage(20.0%)	20	NA	NA
WP_005019539.1|3413198_3421991_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	29.1	3.2e-23
WP_005014105.1|3422337_3423288_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014106.1|3423284_3423965_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.3	5.8e-34
WP_005014107.1|3423999_3424623_+	arylesterase	NA	NA	NA	NA	NA
WP_005014109.1|3424604_3426560_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005014110.1|3426831_3427581_+	glycerophosphodiester phosphodiesterase	NA	A0A1J0F961	Only_Syngen_Nebraska_virus	27.5	6.2e-13
WP_005014111.1|3427592_3428465_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_005014112.1|3428475_3429888_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_005014113.1|3429997_3430726_-	glutathione peroxidase	NA	A0A1D8KSL1	Synechococcus_phage	56.0	7.3e-43
WP_005014114.1|3430862_3431063_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_005014115.1|3431214_3433488_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.2	4.1e-92
WP_005014116.1|3433484_3433880_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_005014117.1|3433876_3435403_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	25.4	1.7e-28
WP_101557770.1|3435474_3436594_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014119.1|3436638_3437391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014121.1|3437682_3438105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014122.1|3438374_3439154_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_005014123.1|3439150_3440014_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	40.5	8.5e-14
WP_005014124.1|3440031_3440829_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.5	9.8e-33
WP_005014125.1|3440813_3441572_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.3	1.9e-70
>prophage 232
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3446375	3450481	3696428	tRNA	Moraxella_phage(66.67%)	4	NA	NA
WP_005014139.1|3446375_3447413_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.7	5.6e-97
WP_005014141.1|3447497_3448790_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.7	2.9e-66
WP_005014142.1|3448972_3449989_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014143.1|3450097_3450481_+	thioredoxin	NA	V9SJ74	Achromobacter_phage	26.8	1.2e-09
>prophage 233
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3453726	3517620	3696428	tRNA,transposase,protease	Ralstonia_virus(20.0%)	61	NA	NA
WP_005014168.1|3453726_3454491_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	6.3e-29
WP_005014169.1|3454663_3456268_-	ABC-F family ATPase	NA	A0A1V0SKJ1	Klosneuvirus	28.9	7.7e-53
WP_005019565.1|3456521_3457502_-	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_005014173.1|3457498_3457987_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|3457979_3458828_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|3458919_3459417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|3459554_3459914_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|3459910_3460192_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|3460191_3460674_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|3460675_3462304_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|3462300_3462645_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|3462646_3465589_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|3466034_3467006_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|3466995_3468378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|3468520_3469471_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|3469430_3470672_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|3470668_3471790_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|3473281_3473749_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|3473819_3474470_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|3474556_3475696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|3475864_3476869_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|3476865_3478113_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|3478465_3479332_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|3479291_3480896_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014223.1|3481589_3482630_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|3482745_3483417_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019577.1|3483413_3484406_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|3484402_3485341_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|3485337_3486492_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|3486500_3487952_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|3487982_3488465_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|3488466_3489360_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|3489356_3489800_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|3489812_3490187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|3490329_3490728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|3490854_3491142_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|3491138_3491555_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|3491730_3492363_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|3492391_3492838_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|3493124_3494276_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|3494389_3495394_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|3496377_3497085_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|3497017_3498469_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|3498474_3501633_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|3501645_3502167_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|3502156_3502981_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|3502977_3503577_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|3503685_3505542_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|3505690_3506695_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|3506903_3508166_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|3508170_3508506_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|3508502_3509432_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|3509436_3510150_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|3510253_3511711_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|3511707_3512004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|3512128_3513487_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|3513587_3514388_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|3514567_3515686_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|3515758_3516130_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|3516136_3516988_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|3517008_3517620_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 234
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3535349	3535961	3696428		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_005014322.1|3535349_3535961_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	71.8	4.4e-81
>prophage 235
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3540345	3542837	3696428		Planktothrix_phage(50.0%)	2	NA	NA
WP_005014333.1|3540345_3541074_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	1.4e-09
WP_005014336.1|3541073_3542837_-	branched-chain amino acid ABC transporter ATP-binding protein/permease	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	1.2e-17
>prophage 236
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3549645	3550185	3696428		Streptococcus_phage(100.0%)	1	NA	NA
WP_005014350.1|3549645_3550185_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	48.5	4.8e-31
>prophage 237
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3564242	3565703	3696428		Klosneuvirus(100.0%)	1	NA	NA
WP_005014377.1|3564242_3565703_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.3	1.0e-96
>prophage 238
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3573662	3575668	3696428		Planktothrix_phage(100.0%)	2	NA	NA
WP_005014398.1|3573662_3574661_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.7	3.6e-16
WP_005014400.1|3574666_3575668_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.5	1.8e-15
>prophage 239
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3583255	3587305	3696428		Burkholderia_phage(100.0%)	1	NA	NA
WP_005019633.1|3583255_3587305_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	68.4	2.2e-160
>prophage 240
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3595187	3596408	3696428	transposase	Ralstonia_virus(100.0%)	1	NA	NA
WP_005011985.1|3595187_3596408_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 241
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3609970	3684997	3696428	tRNA,integrase,transposase,protease	Leptospira_phage(14.81%)	72	3644279:3644338	3665586:3665860
WP_005014461.1|3609970_3610921_+	D-3-phosphoglycerate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	28.4	4.8e-18
WP_005014462.1|3610952_3611753_+	aldolase	NA	NA	NA	NA	NA
WP_005014464.1|3611767_3612922_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_101557807.1|3612749_3613912_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|3614024_3614993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|3614989_3615910_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|3616006_3620485_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|3620863_3625198_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|3625836_3626400_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|3626411_3626657_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|3626812_3627322_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|3627367_3628348_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|3628559_3630911_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|3630957_3631788_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|3631784_3632474_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|3632466_3633747_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|3633844_3634783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|3634764_3636471_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|3636548_3637652_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|3637704_3638454_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|3638460_3639975_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|3639987_3640275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|3640295_3641183_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|3641333_3641840_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|3641836_3642793_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|3642980_3644327_+	TonB-dependent receptor	NA	NA	NA	NA	NA
3644279:3644338	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|3644294_3644525_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|3644554_3645118_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|3645272_3646043_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|3646039_3647050_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|3647364_3647811_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|3647866_3648061_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|3648062_3648404_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|3648413_3650276_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|3650315_3650822_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|3650825_3651149_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|3651150_3651555_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|3651591_3652803_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|3652824_3653373_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|3653597_3654089_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|3654303_3656334_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|3656408_3657611_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|3658153_3659089_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|3660122_3660404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|3660490_3660664_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|3660775_3661120_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|3661191_3661860_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|3663275_3664319_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|3664315_3664417_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|3664508_3665628_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|3665878_3666532_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
3665586:3665860	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|3666647_3667868_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|3667918_3670348_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|3670513_3671812_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|3671916_3672570_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|3672572_3673883_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|3674110_3674650_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|3675128_3675395_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|3675433_3675799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|3675680_3676691_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|3676687_3677458_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|3677543_3678203_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|3678170_3678662_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|3678771_3678975_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|3679292_3679613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|3679596_3679932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|3679986_3680199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|3680274_3680613_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|3680609_3680945_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|3681007_3682579_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|3683372_3683684_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|3683876_3684997_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
>prophage 242
NZ_CP007158	Bordetella holmesii H558 chromosome, complete genome	3696428	3691401	3696095	3696428	transposase	Shigella_phage(50.0%)	3	NA	NA
WP_101557807.1|3691401_3692563_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|3692948_3694412_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|3694544_3696095_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
