The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_020417	Beta proteobacterium CB, complete sequence	2045720	1071545	1080610	2045720		uncultured_Mediterranean_phage(25.0%)	8	NA	NA
WP_015421250.1|1071545_1071971_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	40.9	2.1e-18
WP_015421251.1|1072264_1072966_+	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	31.7	2.3e-17
WP_051040244.1|1073042_1074470_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	23.3	2.7e-25
WP_015421253.1|1074462_1075284_-	3'-5' exonuclease	NA	K4EQ32	Epinotia_aporema_granulovirus	29.5	2.3e-05
WP_015421254.1|1075292_1076051_-	peptidoglycan DD-metalloendopeptidase family protein	NA	D7RWE0	Brochothrix_phage	36.2	1.6e-08
WP_015421255.1|1076059_1076716_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.2	2.2e-30
WP_015421256.1|1076712_1077507_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	1.3e-61
WP_015421257.1|1077532_1080610_-	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	21.3	2.6e-33
>prophage 2
NC_020417	Beta proteobacterium CB, complete sequence	2045720	1086905	1095868	2045720		Burkholderia_phage(25.0%)	11	NA	NA
WP_015421265.1|1086905_1088588_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	35.4	1.1e-41
WP_015421266.1|1088816_1089128_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	40.8	2.6e-13
WP_144050707.1|1089081_1089387_-	BrnT family toxin	NA	A0A089FGY4	Burkholderia_phage	60.7	1.3e-22
WP_015421268.1|1089724_1090105_+	HIT family protein	NA	D7NW73	Streptomyces_phage	40.6	4.0e-16
WP_051040326.1|1090638_1091511_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_015421270.1|1091532_1091928_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_041484876.1|1092021_1092288_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_015421272.1|1092333_1092990_+	exonuclease RNase T and DNA polymerase III	NA	A0A059VJT9	Pseudomonas_phage	48.4	4.0e-56
WP_015421273.1|1093011_1093554_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	30.9	1.6e-18
WP_015421275.1|1094072_1095383_-	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	42.8	1.2e-91
WP_144050708.1|1095379_1095868_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	43.7	2.3e-24
>prophage 3
NC_020417	Beta proteobacterium CB, complete sequence	2045720	1544831	1593089	2045720	integrase,transposase	Leptospira_phage(50.0%)	49	1549607:1549666	1593090:1593387
WP_095666456.1|1544831_1545918_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.8	5.6e-39
WP_015421757.1|1545925_1546132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095666457.1|1546218_1547329_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	2.6e-47
WP_015421808.1|1547277_1547580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015421761.1|1547987_1548437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015421763.1|1548657_1548837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144050719.1|1549132_1549606_-|integrase	integrase	integrase	NA	NA	NA	NA
1549607:1549666	attL	GGAGTGCCACTGACAATTGGGCAACCTAAAGCGGCATTGCCATTGATTGCTGCCTGATCG	NA	NA	NA	NA
WP_041484936.1|1551199_1552012_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	1.9e-47
WP_015421768.1|1553039_1554476_-	Electron transfer flavoprotein, alpha subunit	NA	NA	NA	NA	NA
WP_015421750.1|1554476_1555226_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_015421769.1|1555341_1556511_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_015421770.1|1556785_1557952_-	CoA transferase	NA	NA	NA	NA	NA
WP_015421771.1|1559025_1559808_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_015421772.1|1559866_1560508_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015421774.1|1560827_1562087_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_015421776.1|1562462_1563119_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_041484937.1|1563259_1563976_-	esterase	NA	NA	NA	NA	NA
WP_015421778.1|1563977_1565618_-	AAA family ATPase	NA	A0A172JHZ0	Bacillus_phage	46.1	2.1e-122
WP_015421779.1|1565852_1566269_-	thioesterase family protein	NA	NA	NA	NA	NA
WP_015421780.1|1566290_1567277_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_015421782.1|1567752_1567962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015421783.1|1568094_1568694_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_015421785.1|1569116_1570250_-	linear amide C-N hydrolase	NA	A0A2K9L5Y5	Tupanvirus	26.8	5.9e-23
WP_015421786.1|1570352_1571147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015421787.1|1571248_1572070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015421783.1|1572202_1572802_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_041484938.1|1572801_1574376_-	MCE family protein	NA	NA	NA	NA	NA
WP_015421789.1|1574368_1575019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015421790.1|1575015_1575642_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_051040272.1|1575684_1576182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144050720.1|1576195_1576915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015421793.1|1577112_1578261_-	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_144050721.1|1578272_1579427_-	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_015421795.1|1579529_1580297_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015421796.1|1580317_1582201_-	signal transduction histidine kinase	NA	NA	NA	NA	NA
WP_015421798.1|1582639_1583680_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_015421799.1|1584080_1584698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015421800.1|1584856_1585315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015421801.1|1585469_1585883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015421802.1|1586252_1586525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015421803.1|1586695_1587538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015421804.1|1587732_1588464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015421805.1|1588489_1589425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015421806.1|1589449_1590016_-|integrase	site-specific integrase	integrase	K4JX14	Caulobacter_virus	36.6	2.4e-17
WP_015421807.1|1590459_1590681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015421808.1|1590760_1591063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015421761.1|1591470_1591920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015421763.1|1592140_1592320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144050719.1|1592615_1593089_-|integrase	integrase	integrase	NA	NA	NA	NA
1593090:1593387	attR	GGAGTGCCACTGACAATTGGGCAACCTAAAGCGGCATTGCCATTGATTGCTGCCTGATCGCTTAAAGAGACTTACTAAACCTCGGTGGAGGTGAATTACATCAGCAGACTGGGATGCACTAGATTTGAAGAAAAGCTGGTTTAGATTTTGCACTCAAGTGTCGTGTTTCGAGACACTTGTAGCTTAACTTCAGATTTCAGGAAGGTCGATCGGAAAATTTGTCGAGTAAACCGACATTTCATGTGTGGATATCTGGTAGGCAGACTCCGACCTTGATTTCAACCCGTCGATGCAACAC	NA	NA	NA	NA
>prophage 4
NC_020417	Beta proteobacterium CB, complete sequence	2045720	1671282	1677634	2045720	protease	Methanothermobacter_phage(16.67%)	7	NA	NA
WP_015421883.1|1671282_1672494_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	31.4	1.0e-33
WP_015421884.1|1672513_1672963_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	3.7e-45
WP_015421885.1|1672963_1673650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015421886.1|1673916_1676223_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.7e-165
WP_051040337.1|1676219_1676576_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	41.6	1.1e-12
WP_011903586.1|1676851_1677055_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	74.2	6.3e-21
WP_144050772.1|1677214_1677634_+	DUF192 domain-containing protein	NA	A0A222YVT9	Synechococcus_phage	43.4	1.4e-14
>prophage 5
NC_020417	Beta proteobacterium CB, complete sequence	2045720	1735348	1742362	2045720		uncultured_virus(33.33%)	9	NA	NA
WP_015421938.1|1735348_1737001_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	59.6	4.2e-171
WP_015421939.1|1737027_1737318_-	co-chaperone GroES	NA	A0A221S4A8	uncultured_virus	43.6	3.6e-17
WP_015421940.1|1737537_1737894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015421941.1|1737924_1738374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015421942.1|1738483_1739593_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	29.3	6.8e-32
WP_015421943.1|1739607_1739889_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_015421944.1|1740084_1740903_-	alpha/beta hydrolase	NA	D3JZC6	Mycobacterium_phage	33.3	4.3e-07
WP_051040343.1|1740912_1741617_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.1	4.3e-16
WP_015421946.1|1741621_1742362_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.7	8.3e-10
