The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021182	Clostridium pasteurianum BC1, complete sequence	4990707	276400	361077	4990707	terminase,integrase,portal,tail,protease,tRNA,capsid,coat	Clostridium_phage(29.17%)	80	294638:294664	369306:369332
WP_015613663.1|276400_277342_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015613664.1|277851_280959_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	35.8	8.7e-186
WP_015613665.1|281322_282321_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_015613666.1|282475_283054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613667.1|283121_284039_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015613668.1|284161_284320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015613669.1|284495_288551_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_015613670.1|288577_289165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613671.1|289874_291098_+	peptidase T	NA	NA	NA	NA	NA
WP_015613672.1|291304_291667_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_015613674.1|292244_294434_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	36.4	2.7e-48
294638:294664	attL	TACTGACTAGTTATTTATTTGAATGTG	NA	NA	NA	NA
WP_015613675.1|294718_295396_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015613676.1|295392_296793_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_015613677.1|297336_297906_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	43.9	3.6e-37
WP_015613678.1|297928_298414_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_041711107.1|298442_299249_+	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	30.1	3.7e-19
WP_015613680.1|299253_300078_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4VNV0	Pandoravirus	36.9	4.0e-13
WP_015613681.1|300414_301638_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_015613682.1|302185_304207_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_015613683.1|304584_305898_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_172638632.1|306016_306706_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.9	1.4e-35
WP_015613685.1|306702_307899_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015613686.1|309133_309817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613687.1|310111_311023_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_015613688.1|311024_313145_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_015613689.1|314012_315392_+	radical SAM protein	NA	NA	NA	NA	NA
WP_015613690.1|316040_317318_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015613691.1|317585_318731_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_041711109.1|319011_320028_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_015613693.1|320024_320237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613694.1|320243_321002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613695.1|321026_322055_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_015613696.1|322132_323260_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_015613697.1|323542_324547_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_015613698.1|324663_325443_+	YabG peptidase U57	NA	NA	NA	NA	NA
WP_015613699.1|325484_327143_-	recombinase family protein	NA	M9Q2G2	Clostridium_phage	55.0	1.3e-124
WP_015613700.1|327246_328002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080648359.1|328089_328722_-	GIY-YIG nuclease family protein	NA	X5JAC1	Clostridium_phage	50.8	3.0e-32
WP_172638595.1|329679_330024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015613703.1|330046_330466_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	47.0	1.4e-09
WP_015613704.1|330641_330848_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015613705.1|330987_331143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155241850.1|331286_331424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613707.1|331420_331957_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172638596.1|331962_332133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155241851.1|332175_332481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613710.1|332577_333141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613711.1|333140_334262_+	hypothetical protein	NA	A0A288WFS8	Bacillus_phage	52.6	1.9e-42
WP_015613712.1|334289_334592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613713.1|334596_335058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613714.1|335311_336010_+	amino acid racemase	NA	NA	NA	NA	NA
WP_015613715.1|336158_336344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613716.1|336374_336698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613717.1|336762_336906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613718.1|336916_337318_+	single-stranded DNA-binding protein	NA	D7RWG9	Brochothrix_phage	61.5	7.1e-32
WP_015613719.1|337454_337796_+	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_155241852.1|338003_338357_+	DNA-binding response regulator	NA	M9Q1J7	Clostridium_phage	43.4	1.9e-20
WP_015613721.1|338427_338595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613722.1|338594_339245_+|integrase	tyrosine-type recombinase/integrase	integrase	F6K8Q2	Clostridium_phage	41.5	9.8e-31
WP_015613723.1|339509_339983_+	hypothetical protein	NA	A0A0A7RTX1	Clostridium_phage	38.0	3.9e-13
WP_015613724.1|339984_340311_+	HNH endonuclease	NA	A0A1B1P8D2	Bacillus_phage	44.0	3.5e-13
WP_015613725.1|340434_340743_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_041710709.1|340726_342388_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	40.6	2.2e-111
WP_015613727.1|342402_342558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613728.1|342594_343770_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	36.4	1.1e-69
WP_015613729.1|343744_344485_+|protease	Clp protease ClpP	protease	A0A0K2CYC6	Paenibacillus_phage	46.0	3.3e-43
WP_015613730.1|344486_345938_+|capsid	phage major capsid protein	capsid	E2ELI5	Clostridium_phage	38.9	1.7e-67
WP_015613731.1|345950_346265_+	hypothetical protein	NA	Q8W603	Listeria_phage	42.7	8.1e-15
WP_015613732.1|346261_346606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613733.1|346602_346998_+	hypothetical protein	NA	A0A1S5SFC4	Streptococcus_phage	39.7	9.5e-13
WP_015613734.1|346984_347299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613735.1|347311_347857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613736.1|347880_348180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613738.1|348483_351639_+|tail	phage tail tape measure protein	tail	A0A1L2BYA6	Clostridium_phage	38.6	9.2e-50
WP_015613739.1|351635_352337_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_015613740.1|352413_353895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613741.1|353896_356239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613742.1|356317_357394_+	acyltransferase	NA	NA	NA	NA	NA
WP_015613743.1|357618_358839_+	family 16 glycosylhydrolase	NA	M1HYC6	Paramecium_bursaria_Chlorella_virus	28.9	3.7e-15
WP_015613744.1|359109_361077_+|tail	phage tail protein	tail	A0A1B2APX2	Phage_Wrath	29.6	1.3e-38
369306:369332	attR	CACATTCAAATAAATAACTAGTCAGTA	NA	NA	NA	NA
>prophage 2
NC_021182	Clostridium pasteurianum BC1, complete sequence	4990707	555153	593426	4990707	terminase,integrase,portal,holin,capsid,plate	Clostridium_phage(63.33%)	42	554981:554997	595389:595405
554981:554997	attL	ATTCCGCTCTTCGATGC	NA	NA	NA	NA
WP_015613925.1|555153_556314_-|integrase	site-specific integrase	integrase	H7BUX8	unidentified_phage	23.8	1.1e-13
WP_015613926.1|556373_557291_-	helix-turn-helix domain-containing protein	NA	A0A2H4J5K1	uncultured_Caudovirales_phage	30.9	6.6e-25
WP_155241966.1|557522_557753_+	helix-turn-helix domain-containing protein	NA	D6R414	Bacillus_phage	54.1	2.6e-10
WP_015613928.1|557766_558822_+	helix-turn-helix domain-containing protein	NA	A0A0A8WHY0	Clostridium_phage	64.8	7.9e-30
WP_015613929.1|558824_559064_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015613930.1|559102_559288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613932.1|559544_559772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613934.1|560310_561492_+	DUF2800 domain-containing protein	NA	H7BVP9	unidentified_phage	48.3	1.5e-98
WP_015613935.1|561484_562237_+	DUF2815 family protein	NA	A0A0A7RVM4	Clostridium_phage	47.6	7.6e-35
WP_015613936.1|562233_564207_+	DNA polymerase	NA	H7BVQ1	unidentified_phage	61.7	3.7e-238
WP_015613714.1|564460_565159_+	amino acid racemase	NA	NA	NA	NA	NA
WP_015613937.1|565302_565533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613938.1|565597_568018_+	P-loop ATPase	NA	A0A0A7RTG3	Clostridium_phage	43.8	4.6e-190
WP_015613939.1|568310_568592_+	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	55.2	1.1e-18
WP_015613940.1|568591_568798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613941.1|568804_570175_+	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	54.1	4.5e-142
WP_015613942.1|570187_570736_+	hypothetical protein	NA	A0A097BY45	Enterococcus_phage	36.9	2.8e-15
WP_015613943.1|571397_572165_+	hypothetical protein	NA	X5JB33	Clostridium_phage	65.3	5.0e-42
WP_015613944.1|572316_573636_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1J1J8Z1	Escherichia_phage	35.2	1.2e-72
WP_015613945.1|573638_575159_+|portal	phage portal protein	portal	M9Q246	Clostridium_phage	55.5	3.6e-161
WP_015613946.1|575161_576382_+|capsid	phage capsid protein	capsid	M9Q2F2	Clostridium_phage	58.3	2.3e-129
WP_015613947.1|576387_576558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613948.1|576558_576720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613949.1|576711_577416_-	nucleoside 2-deoxyribosyltransferase	NA	Q7Y4L3	Streptococcus_phage	37.2	2.0e-29
WP_015613950.1|577558_578134_+	phage scaffolding protein	NA	S5MUG0	Brevibacillus_phage	44.7	1.0e-31
WP_015613951.1|578151_579030_+	hypothetical protein	NA	M9Q2F4	Clostridium_phage	53.9	2.5e-77
WP_015613952.1|579041_579269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613953.1|579271_579631_+	hypothetical protein	NA	M9Q2K9	Clostridium_phage	57.0	3.2e-31
WP_015613954.1|579640_579967_+	hypothetical protein	NA	M9Q2I3	Clostridium_phage	55.2	2.4e-30
WP_015613955.1|579966_580350_+	hypothetical protein	NA	M9Q249	Clostridium_phage	69.3	4.1e-45
WP_015613956.1|580349_580736_+	hypothetical protein	NA	M9Q2F6	Clostridium_phage	68.0	6.4e-46
WP_015613957.1|580746_581193_+	hypothetical protein	NA	M9Q1I1	Clostridium_phage	65.1	5.8e-51
WP_015613958.1|581206_581536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613959.1|581550_581868_+	Bacteriophage Gp15 protein	NA	M9Q2I4	Clostridium_phage	72.3	6.9e-38
WP_155241857.1|582518_585887_+	hypothetical protein	NA	M9Q251	Clostridium_phage	42.9	2.9e-134
WP_015613962.1|585897_586245_+	hypothetical protein	NA	M9Q2F8	Clostridium_phage	54.8	9.8e-30
WP_015613963.1|586262_586532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015613964.1|586548_586929_+	hypothetical protein	NA	M9Q2L1	Clostridium_phage	45.6	3.0e-24
WP_015613965.1|586952_589772_+	hypothetical protein	NA	M9Q2I5	Clostridium_phage	41.0	5.1e-68
WP_015613966.1|589818_591978_+|plate	BppU family phage baseplate upper protein	plate	NA	NA	NA	NA
WP_041711183.1|592097_592469_+|holin	phage holin family protein	holin	D9ZNF2	Clostridium_phage	55.4	9.5e-31
WP_015613968.1|592472_593426_+	peptidoglycan-binding protein	NA	Q0SPG7	Clostridium_phage	31.3	4.5e-16
595389:595405	attR	ATTCCGCTCTTCGATGC	NA	NA	NA	NA
>prophage 3
NC_021182	Clostridium pasteurianum BC1, complete sequence	4990707	998057	1031258	4990707	protease,transposase	Bacillus_phage(37.5%)	35	NA	NA
WP_015614310.1|998057_999047_-|protease	cysteine protease	protease	A0A2K9L1Z4	Tupanvirus	33.3	1.5e-30
WP_172638597.1|999522_1000104_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155241977.1|1000107_1000254_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015614311.1|1000458_1002780_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015614312.1|1002784_1003543_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	6.9e-28
WP_015614313.1|1003656_1004358_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.2	3.2e-35
WP_041710791.1|1004350_1005292_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_041710793.1|1005338_1005740_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGR3	Hokovirus	33.3	6.7e-06
WP_015614314.1|1006085_1006598_-	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_015614315.1|1006676_1007564_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_015614316.1|1007556_1008480_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	42.5	2.5e-40
WP_015614317.1|1008485_1009295_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015614318.1|1009525_1010221_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015614319.1|1010897_1011971_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q332I1	Clostridium_botulinum_C_phage	73.8	1.9e-143
WP_051115603.1|1012102_1012948_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_051115604.1|1012982_1013543_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_155241978.1|1013682_1014258_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_015614321.1|1014582_1015074_-	MogA/MoaB family molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
WP_015614322.1|1015851_1017993_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_015614323.1|1018020_1019229_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_015614324.1|1019206_1019731_+	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_015614325.1|1019821_1020337_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_015614326.1|1020356_1020929_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_015614327.1|1020932_1021538_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_015614328.1|1021863_1022820_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_015614329.1|1022858_1023305_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_015614330.1|1023370_1024183_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_015614331.1|1024432_1025260_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_015614332.1|1025397_1026033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015614333.1|1026449_1027121_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.3	1.3e-25
WP_015614334.1|1027108_1028314_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	39.6	4.7e-10
WP_015614336.1|1028956_1029496_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015614337.1|1029532_1030135_-	accessory gene regulator B family protein	NA	NA	NA	NA	NA
WP_080648278.1|1030421_1030952_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015613496.1|1030973_1031258_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_021182	Clostridium pasteurianum BC1, complete sequence	4990707	1588141	1639544	4990707	terminase,integrase,transposase,protease	Clostridium_phage(28.57%)	50	1583027:1583043	1629582:1629598
1583027:1583043	attL	AAAGTTATATCCTTATT	NA	NA	NA	NA
WP_015614808.1|1588141_1588720_+|integrase	site-specific integrase	integrase	E2ELN7	Clostridium_phage	41.4	3.1e-28
WP_015614809.1|1588858_1589203_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015614810.1|1589195_1589864_+	DUF1048 domain-containing protein	NA	NA	NA	NA	NA
WP_041711341.1|1590018_1590348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015614812.1|1590373_1590694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155241880.1|1591573_1591738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041710831.1|1591801_1592029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015614813.1|1592178_1592637_+	GtrA family protein	NA	NA	NA	NA	NA
WP_015614814.1|1593899_1595969_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_155241881.1|1596024_1596240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015614553.1|1596946_1598167_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.4	2.6e-53
WP_015614815.1|1598785_1599169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015614816.1|1599186_1599366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015614817.1|1599337_1599748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015614818.1|1599961_1600465_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_015614819.1|1600600_1600837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015614820.1|1601020_1602745_+	mismatch repair ATPase (MutS family)	NA	F2QAF8	Phaeocystis_pouchetii_virus	27.8	7.9e-11
WP_051115623.1|1602802_1603144_-	DUF4865 family protein	NA	NA	NA	NA	NA
WP_015614821.1|1603526_1604570_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_155241882.1|1604656_1605634_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_015614823.1|1605989_1606295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015614824.1|1607121_1607415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015614825.1|1608613_1608823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080648371.1|1609091_1609307_+|terminase	terminase small subunit	terminase	E5DV49	Deep-sea_thermophilic_phage	66.7	2.2e-16
WP_015614826.1|1610413_1610680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080648372.1|1611818_1611920_+	DUF255 domain-containing protein	NA	NA	NA	NA	NA
WP_015614827.1|1612164_1613430_+	DUF2088 domain-containing protein	NA	NA	NA	NA	NA
WP_041710833.1|1613474_1613747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172638602.1|1613934_1614123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015614828.1|1614653_1614914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015614829.1|1616273_1616669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015614830.1|1616920_1619701_+	bifunctional YncE family protein/alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_015614831.1|1620432_1621008_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_015614832.1|1621038_1621722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080648290.1|1622747_1622828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015614835.1|1624671_1625256_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080648373.1|1626632_1627304_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_015614838.1|1627541_1628342_-	polysaccharide deacetylase family protein	NA	A0A0E3D9F7	Bacillus_phage	32.2	1.6e-11
WP_041710836.1|1628452_1629637_-	amidase domain-containing protein	NA	NA	NA	NA	NA
1629582:1629598	attR	AATAAGGATATAACTTT	NA	NA	NA	NA
WP_155241984.1|1629966_1630692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015614841.1|1631377_1631755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015614842.1|1631936_1632089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041711346.1|1632435_1633389_+	peptidoglycan-binding protein	NA	I2E8W9	Clostridium_phage	33.0	2.6e-16
WP_015614844.1|1633474_1633861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015614845.1|1634066_1634219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015614846.1|1634880_1635270_+	DUF1523 family protein	NA	NA	NA	NA	NA
WP_015614847.1|1635395_1635575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015614848.1|1635797_1636706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015614849.1|1636961_1637261_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	NA	NA	NA	NA
WP_015614850.1|1637264_1639544_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	39.4	1.2e-152
>prophage 5
NC_021182	Clostridium pasteurianum BC1, complete sequence	4990707	1881694	1938724	4990707	terminase,integrase,portal,tail,protease,tRNA,capsid,head	Bacillus_phage(15.79%)	67	1878385:1878401	1920351:1920367
1878385:1878401	attL	ATAAAAAAAATAATTTA	NA	NA	NA	NA
WP_015615058.1|1881694_1882453_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	S4VW33	Pandoravirus	32.0	3.1e-20
WP_015615059.1|1882657_1882966_-	MTH1187 family thiamine-binding protein	NA	NA	NA	NA	NA
WP_015615060.1|1883120_1883990_-	cation transporter	NA	NA	NA	NA	NA
WP_015615061.1|1884503_1886423_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SGN0	Hokovirus	30.2	1.3e-51
WP_015615062.1|1886627_1887890_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_015615063.1|1887987_1889247_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_015615064.1|1889400_1890711_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_015615065.1|1890907_1891357_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_015615066.1|1891658_1891799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155241891.1|1891799_1891958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615068.1|1892056_1892257_-	alpha/beta-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_015615069.1|1892449_1892986_+	guanylate kinase	NA	A0A0E3X9J6	Bacillus_phage	37.4	2.4e-19
WP_015615070.1|1893113_1894772_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.0	3.2e-41
WP_015615071.1|1894776_1895493_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	30.0	4.7e-18
WP_015615072.1|1895627_1896845_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_015615074.1|1897472_1898093_+	O-methyltransferase	NA	NA	NA	NA	NA
WP_015615075.1|1898676_1898982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015615076.1|1899045_1900137_-	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_015615077.1|1901257_1901950_+	iron-sulfur cluster assembly scaffold protein	NA	NA	NA	NA	NA
WP_015615078.1|1901971_1902970_+	GGGtGRT protein	NA	NA	NA	NA	NA
WP_015615079.1|1903105_1904062_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	25.4	3.2e-22
WP_015615080.1|1904068_1904317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615081.1|1905071_1906010_+	Malarial early transcribed membrane protein (ETRAMP)	NA	NA	NA	NA	NA
WP_015615082.1|1906468_1906690_-	helix-turn-helix transcriptional regulator	NA	Q331Y7	Clostridium_botulinum_C_phage	65.7	2.2e-19
WP_015615084.1|1907303_1907981_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015615085.1|1908069_1908399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615086.1|1908410_1908563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615087.1|1908900_1909773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615088.1|1909813_1910116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615089.1|1910193_1911066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615090.1|1911087_1914105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615091.1|1914180_1914393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615092.1|1914615_1915797_+	hypothetical protein	NA	Q331U0	Clostridium_botulinum_C_phage	43.5	1.2e-39
WP_015615093.1|1916778_1917873_+	hypothetical protein	NA	A0A0F6N3N8	Staphylococcus_phage	35.0	1.9e-10
WP_015615094.1|1918019_1918367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615095.1|1918368_1918668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615096.1|1918669_1919176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615097.1|1919250_1919631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615098.1|1919900_1920215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615099.1|1920305_1921127_+	hypothetical protein	NA	NA	NA	NA	NA
1920351:1920367	attR	ATAAAAAAAATAATTTA	NA	NA	NA	NA
WP_015615100.1|1921227_1922007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615101.1|1922089_1922236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615102.1|1922559_1922754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615103.1|1922883_1923153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615104.1|1923244_1923418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615105.1|1923536_1923938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615106.1|1923977_1924280_+	hypothetical protein	NA	A0A0S2MVH6	Bacillus_phage	35.4	1.7e-06
WP_015615107.1|1924344_1924560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615108.1|1924602_1925022_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015615109.1|1925207_1925777_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	36.6	3.9e-23
WP_015615110.1|1925828_1927070_+|terminase	PBSX family phage terminase large subunit	terminase	I1TJV3	Clostridium_phage	55.4	9.7e-128
WP_015615111.1|1927188_1927485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615112.1|1927527_1927797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615113.1|1927841_1929986_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	25.7	2.6e-48
WP_015615114.1|1930049_1930958_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B1IQC0	uncultured_Mediterranean_phage	28.3	9.9e-13
WP_015615115.1|1930960_1932076_+|capsid	phage major capsid protein	capsid	A0A0F7L2V9	uncultured_marine_virus	23.8	4.2e-13
WP_015615116.1|1932130_1932448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615117.1|1932458_1933058_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_015615118.1|1933062_1933374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615119.1|1933370_1933853_+	Bacteriophage protein of unknown function (DUF646)	NA	A0A1S5SAL3	Streptococcus_phage	34.6	7.1e-10
WP_015615120.1|1933853_1934237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615121.1|1934279_1934828_+|tail	phage major tail protein, phi13 family	tail	NA	NA	NA	NA
WP_015615122.1|1934913_1935225_+	hypothetical protein	NA	A0A2H4JBA8	uncultured_Caudovirales_phage	35.0	2.5e-08
WP_015615123.1|1935260_1935458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615124.1|1935465_1935624_-	ribbon-helix-helix domain-containing protein	NA	A0A0H3UYU6	Geobacillus_virus	50.0	4.5e-06
WP_015615125.1|1935757_1936093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615126.1|1936153_1938724_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	40.1	2.4e-32
>prophage 6
NC_021182	Clostridium pasteurianum BC1, complete sequence	4990707	2062400	2073063	4990707		Synechococcus_phage(28.57%)	7	NA	NA
WP_015615244.1|2062400_2066162_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	24.0	6.9e-36
WP_015615245.1|2066928_2067408_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	48.1	2.7e-30
WP_015615246.1|2067407_2068118_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	43.2	2.0e-45
WP_015615247.1|2068143_2069553_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	4.4e-60
WP_015615248.1|2069573_2070569_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SQF5	Cyanophage	45.2	2.7e-64
WP_015615249.1|2070556_2071174_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.9	9.6e-20
WP_015615250.1|2071560_2073063_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	44.4	1.7e-62
>prophage 7
NC_021182	Clostridium pasteurianum BC1, complete sequence	4990707	2344890	2358257	4990707	tRNA	uncultured_Mediterranean_phage(42.86%)	13	NA	NA
WP_015615492.1|2344890_2346021_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	6.6e-91
WP_015615493.1|2346037_2346331_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_015615494.1|2346382_2346763_+	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
WP_010233516.1|2346826_2346964_+	six-cysteine peptide SCIFF	NA	NA	NA	NA	NA
WP_015615495.1|2347033_2348395_+	thioether cross-link-forming SCIFF peptide maturase	NA	NA	NA	NA	NA
WP_015615496.1|2348630_2349869_+	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	25.4	2.5e-06
WP_015615497.1|2349873_2350770_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	36.2	6.3e-36
WP_015615498.1|2350896_2351754_+	DHH family phosphoesterase	NA	V9VGA2	Lactococcus_phage	24.7	8.7e-11
WP_015615499.1|2351911_2352430_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.0	3.0e-30
WP_015615500.1|2352717_2354940_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.6	1.1e-12
WP_015615501.1|2354949_2355549_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_015615502.1|2355572_2356994_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_015615503.1|2357009_2358257_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	26.6	1.1e-27
>prophage 8
NC_021182	Clostridium pasteurianum BC1, complete sequence	4990707	2536605	2547982	4990707		Bacillus_phage(27.27%)	21	NA	NA
WP_051115694.1|2536605_2537343_-	potassium channel family protein	NA	A0A1B0Y2S3	Lactobacillus_phage	51.0	4.4e-27
WP_015615666.1|2537419_2537866_-	ImmA/IrrE family metallo-endopeptidase	NA	S6B1N5	Thermus_phage	45.8	4.8e-29
WP_015615667.1|2537888_2538323_-	helix-turn-helix transcriptional regulator	NA	D2XR39	Bacillus_phage	46.2	8.3e-26
WP_015615668.1|2538478_2538715_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015615669.1|2538767_2539256_+	hypothetical protein	NA	A0A2K9V3J3	Faecalibacterium_phage	42.6	1.2e-25
WP_015615670.1|2539281_2539455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615671.1|2539447_2539657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155241905.1|2539672_2539882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615673.1|2539882_2540041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155241997.1|2540042_2540171_+	Spo0E family sporulation regulatory protein-aspartic acid phosphatase	NA	NA	NA	NA	NA
WP_015615675.1|2540247_2542209_+	AAA family ATPase	NA	A0A0A0RNI0	Bacillus_phage	36.8	1.7e-86
WP_015615676.1|2542210_2543161_+	recombinase RecT	NA	A0A1L2JY28	Aeribacillus_phage	44.0	1.9e-59
WP_015615677.1|2543170_2543911_+	MBL fold metallo-hydrolase	NA	U5PWH0	Bacillus_phage	46.1	1.3e-58
WP_015615678.1|2543903_2544092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615679.1|2544157_2545021_+	DUF4373 domain-containing protein	NA	F0PII1	Enterococcus_phage	39.2	7.7e-15
WP_015615680.1|2545001_2545769_+	ATP-binding protein	NA	A0A2H4J4P8	uncultured_Caudovirales_phage	38.2	2.9e-42
WP_041710875.1|2545784_2546378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155241906.1|2546433_2546706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615682.1|2546702_2546900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615683.1|2546913_2547333_+	DUF1064 domain-containing protein	NA	A0A0A7RTV9	Clostridium_phage	64.2	3.2e-43
WP_015615684.1|2547334_2547982_+	hypothetical protein	NA	A0A0A7RW43	Clostridium_phage	61.0	1.2e-65
>prophage 9
NC_021182	Clostridium pasteurianum BC1, complete sequence	4990707	2552094	2577497	4990707	terminase,portal,tail,capsid,coat	Brevibacillus_phage(16.67%)	28	NA	NA
WP_015615693.1|2552094_2552643_+	hypothetical protein	NA	S5MNT8	Brevibacillus_phage	31.6	5.2e-17
WP_015615694.1|2553087_2553303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615695.1|2553366_2554179_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_015615696.1|2554207_2555176_+|terminase	terminase small subunit	terminase	E5DV49	Deep-sea_thermophilic_phage	48.7	3.0e-60
WP_155241998.1|2555219_2556425_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1L2JY46	Aeribacillus_phage	64.8	3.0e-150
WP_015615698.1|2556434_2557934_+|portal	phage portal protein	portal	A0A0N7GFE4	Paenibacillus_phage	32.1	5.9e-39
WP_155241907.1|2557930_2558971_+|capsid	phage capsid protein	capsid	M9Q2F2	Clostridium_phage	23.2	5.2e-10
WP_015615700.1|2558970_2559294_+	hypothetical protein	NA	D9ZNC9	Clostridium_phage	46.3	3.6e-18
WP_015615701.1|2559312_2559495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015615702.1|2559598_2559766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615703.1|2559823_2560492_+	phage scaffolding protein	NA	S5MUG0	Brevibacillus_phage	41.2	3.5e-07
WP_015615704.1|2560516_2561632_+|coat	coat protein	coat	A0A2H5BLD0	Streptomyces_phage	33.2	1.0e-19
WP_015615705.1|2561658_2561844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615706.1|2561846_2562110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615707.1|2562121_2562652_+	hypothetical protein	NA	K7XXD8	uncultured_Mediterranean_phage	35.7	4.7e-07
WP_015615708.1|2562663_2562969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615709.1|2562965_2563436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615710.1|2563432_2563810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615711.1|2563821_2564616_+	IPT/TIG domain-containing protein	NA	NA	NA	NA	NA
WP_015615712.1|2564671_2565094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172638613.1|2565171_2565372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615713.1|2565372_2568930_+	hypothetical protein	NA	A0A2H4J4V9	uncultured_Caudovirales_phage	32.5	4.4e-24
WP_015615714.1|2568926_2569649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615715.1|2569723_2571856_+	SGNH/GDSL hydrolase family protein	NA	Q597U1	Lactobacillus_virus	39.4	6.3e-34
WP_015615716.1|2572081_2572465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615717.1|2573094_2573982_+	hydrogenase small subunit	NA	NA	NA	NA	NA
WP_015613743.1|2574207_2575428_+	family 16 glycosylhydrolase	NA	M1HYC6	Paramecium_bursaria_Chlorella_virus	28.9	3.7e-15
WP_080648307.1|2575697_2577497_+|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 10
NC_021182	Clostridium pasteurianum BC1, complete sequence	4990707	2701307	2748503	4990707	protease,terminase,transposase	uncultured_Mediterranean_phage(33.33%)	52	NA	NA
WP_080648312.1|2701307_2701511_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015615833.1|2701571_2702204_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015615834.1|2702241_2703024_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_015615836.1|2703412_2703772_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015615837.1|2703963_2704770_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_015615838.1|2704975_2706772_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.2	2.1e-70
WP_015614406.1|2707069_2708194_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_041710882.1|2708483_2709200_-	IMP cyclohydrolase	NA	NA	NA	NA	NA
WP_015615841.1|2709855_2710356_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_015615842.1|2710601_2711399_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010237355.1|2711788_2712118_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015615843.1|2712243_2712897_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_015615844.1|2712944_2713463_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_155241909.1|2715407_2715737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155241910.1|2715870_2716080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615847.1|2716117_2716585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015615848.1|2716571_2716805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015615849.1|2716955_2718068_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_015615850.1|2718070_2718457_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015615851.1|2718542_2719697_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_015615852.1|2719709_2720486_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_015615853.1|2720605_2721607_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_051115648.1|2721935_2722154_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_015615854.1|2722496_2723609_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_015615855.1|2723882_2724434_+	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
WP_015615856.1|2724434_2724884_+	sporulation protein YtfJ	NA	NA	NA	NA	NA
WP_015615857.1|2725239_2725833_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.6	2.7e-19
WP_015615858.1|2725819_2726578_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	35.1	2.9e-10
WP_015615859.1|2727130_2728330_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	29.4	1.8e-30
WP_015615860.1|2728692_2729994_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	60.2	1.0e-140
WP_015615861.1|2730381_2731200_-	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	47.5	2.3e-61
WP_015615862.1|2731221_2732037_-	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	39.9	2.9e-56
WP_015615863.1|2732048_2733215_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_015615864.1|2733424_2734303_-	site-specific tyrosine recombinase XerD	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	24.5	1.0e-14
WP_015615866.1|2734586_2735213_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_015615867.1|2735323_2735842_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_041710883.1|2736474_2737035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615868.1|2737353_2737866_-	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_015615869.1|2738126_2738810_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_015615870.1|2738880_2739396_-	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_041710884.1|2739552_2739747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615872.1|2739869_2740013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015615873.1|2740228_2740639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080648314.1|2740898_2741021_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_015615874.1|2741246_2741831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615875.1|2741934_2742159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015615876.1|2742338_2742545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015615877.1|2743504_2744380_-	DMT family transporter	NA	NA	NA	NA	NA
WP_015614406.1|2744826_2745951_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_015615880.1|2746707_2747001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015615881.1|2747093_2747255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015615882.1|2748014_2748503_-|terminase	phage terminase small subunit P27 family	terminase	A0A0A7RUQ4	Clostridium_phage	38.8	2.4e-21
>prophage 11
NC_021182	Clostridium pasteurianum BC1, complete sequence	4990707	2752703	2782459	4990707	integrase,portal,holin,tail,capsid,plate,head	uncultured_Caudovirales_phage(25.0%)	40	2756506:2756521	2765772:2765787
WP_080648316.1|2752703_2753099_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_051115653.1|2753123_2753585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015615891.1|2753677_2753947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015615892.1|2754040_2754325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155241913.1|2754473_2754671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015615894.1|2754844_2755048_-	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_015615895.1|2755310_2755490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172638617.1|2755510_2755804_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_015615897.1|2755933_2756179_-	hypothetical protein	NA	A0A2H4J8H2	uncultured_Caudovirales_phage	48.1	9.4e-11
WP_015615898.1|2756301_2756988_-	hypothetical protein	NA	NA	NA	NA	NA
2756506:2756521	attL	AAATAAAATATTATTC	NA	NA	NA	NA
WP_015615899.1|2757365_2757629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015615900.1|2757814_2757979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015615901.1|2757981_2758386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015615903.1|2760341_2760950_-	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_015615904.1|2761738_2761882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615905.1|2762465_2762606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015615906.1|2763009_2763462_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015615907.1|2763461_2764469_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	26.1	8.6e-26
WP_015615908.1|2765082_2766177_+	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
2765772:2765787	attR	GAATAATATTTTATTT	NA	NA	NA	NA
WP_015615909.1|2766297_2766498_-|holin	bacteriophage holin	holin	NA	NA	NA	NA
WP_015615910.1|2766513_2766657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015615911.1|2766668_2767508_-	peptidoglycan-binding protein	NA	Q0SPG7	Clostridium_phage	42.2	1.5e-36
WP_015615912.1|2767527_2767752_-	hemolysin XhlA family protein	NA	NA	NA	NA	NA
WP_015615913.1|2767826_2770484_-|plate	BppU family phage baseplate upper protein	plate	NA	NA	NA	NA
WP_015615914.1|2770568_2771243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015615915.1|2771266_2772304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015615916.1|2772317_2773109_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_015615918.1|2774019_2775390_-|tail	phage tail length tape measure family protein	tail	A0A142KC22	Gordonia_phage	43.9	2.3e-29
WP_015615919.1|2775376_2775697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015615920.1|2775747_2776092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015615921.1|2776159_2776717_-	hypothetical protein	NA	A0A1S5S8X5	Streptococcus_phage	30.4	8.1e-18
WP_155241999.1|2776745_2777126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015615923.1|2777138_2777471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015615924.1|2777489_2777807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015615925.1|2777796_2778186_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_015615926.1|2778217_2778382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015615927.1|2778401_2779334_-	hypothetical protein	NA	A0A1V0DZW0	Clostridioides_phage	48.2	2.0e-69
WP_015615928.1|2779415_2780009_-	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	36.7	3.8e-21
WP_015615929.1|2780139_2781042_-|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_015615930.1|2781016_2782459_-|portal	phage portal protein	portal	A0A1V0DZW8	Clostridioides_phage	39.3	3.0e-80
>prophage 12
NC_021182	Clostridium pasteurianum BC1, complete sequence	4990707	3079866	3139987	4990707	portal,coat,tRNA,transposase	Tupanvirus(25.0%)	52	NA	NA
WP_015615434.1|3079866_3081375_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	29.4	7.1e-24
WP_015616196.1|3082256_3082964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080648325.1|3083303_3083564_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_041710908.1|3083550_3084165_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_015616198.1|3084554_3086945_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_015616199.1|3087116_3088136_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	33.9	7.6e-30
WP_015616200.1|3088723_3089521_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_015616201.1|3089644_3090001_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003443614.1|3090029_3090227_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_041711509.1|3090247_3090775_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_015616203.1|3091164_3093078_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	39.0	6.2e-142
WP_015616204.1|3093419_3094343_-	putative sporulation protein YtxC	NA	NA	NA	NA	NA
WP_015616205.1|3094467_3095166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015616206.1|3095930_3096815_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_015616207.1|3096956_3097700_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015616208.1|3097968_3098244_-	small, acid-soluble spore protein, alpha/beta type	NA	NA	NA	NA	NA
WP_015616209.1|3098733_3099624_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_051115698.1|3099660_3100377_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_015616211.1|3100673_3102320_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015616212.1|3102425_3103403_-	dipeptide ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.7	6.7e-07
WP_015616213.1|3103402_3104410_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	9.6e-17
WP_015616214.1|3104423_3105338_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015616215.1|3105351_3106272_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015616216.1|3106791_3107943_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_015616217.1|3108173_3108884_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_015616218.1|3108948_3109653_-	single-stranded DNA-binding protein	NA	A0A2H4J8K3	uncultured_Caudovirales_phage	52.2	6.0e-50
WP_015616219.1|3109905_3110676_-	polysaccharide deacetylase family sporulation protein PdaB	NA	A0A2K9L357	Tupanvirus	24.2	1.6e-08
WP_015616220.1|3110830_3111358_+	DUF4364 family protein	NA	NA	NA	NA	NA
WP_015616221.1|3111354_3112239_-	YncE family protein	NA	NA	NA	NA	NA
WP_015616222.1|3112475_3112727_+	TIGR03905 family TSCPD domain-containing protein	NA	NA	NA	NA	NA
WP_015616223.1|3112824_3113991_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	29.5	1.8e-35
WP_015616224.1|3113972_3114866_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_015616225.1|3115020_3116058_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_015616226.1|3116259_3117483_+	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_015616227.1|3117611_3118547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015616228.1|3118727_3120044_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_015616229.1|3120574_3123226_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	42.6	1.6e-175
WP_015616230.1|3124037_3124586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015616231.1|3124697_3128999_-	2-hydroxyacyl-CoA dehydratase	NA	NA	NA	NA	NA
WP_015616232.1|3129483_3129843_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015616233.1|3130860_3131562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155242001.1|3132027_3132651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015616235.1|3132866_3133088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015616236.1|3133266_3133452_-	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_015616237.1|3134321_3134540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015616238.1|3134541_3134841_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015616239.1|3135354_3136053_+	amino acid racemase	NA	NA	NA	NA	NA
WP_015616240.1|3136393_3136870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015616241.1|3137051_3137336_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_172638650.1|3137344_3138244_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.6	2.4e-35
WP_015616243.1|3138288_3138699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041711514.1|3138691_3139987_-|portal	phage portal protein	portal	A0A1V0DZW8	Clostridioides_phage	48.8	1.2e-101
>prophage 13
NC_021182	Clostridium pasteurianum BC1, complete sequence	4990707	3152310	3163166	4990707	integrase	Clostridium_phage(50.0%)	16	3151804:3151819	3161546:3161561
3151804:3151819	attL	TTTCATTTTTTCTTTT	NA	NA	NA	NA
WP_015616259.1|3152310_3153267_-	phage recombination protein Bet	NA	A0A1B1IN99	uncultured_Mediterranean_phage	47.3	7.9e-37
WP_015616260.1|3155042_3155222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015616261.1|3155236_3155785_-	sigma-70 family RNA polymerase sigma factor	NA	M9Q2I8	Clostridium_phage	35.0	5.2e-25
WP_015616262.1|3155790_3155997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015616263.1|3155989_3156187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015616264.1|3156186_3156549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041710913.1|3156561_3156765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015616265.1|3156779_3156989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015616266.1|3157063_3157231_-	Sugar-specific transcriptional regulator TrmB	NA	Q8SBM7	Clostridium_phage	60.4	2.6e-12
WP_015616267.1|3157245_3157455_-	helix-turn-helix transcriptional regulator	NA	I3VYZ0	Thermoanaerobacterium_phage	59.0	1.5e-12
WP_015616268.1|3157684_3158152_+	helix-turn-helix transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	34.5	1.6e-14
WP_015616269.1|3158174_3158621_+	ImmA/IrrE family metallo-endopeptidase	NA	I3VYZ2	Thermoanaerobacterium_phage	26.2	4.8e-05
WP_041711518.1|3158699_3159749_+|integrase	site-specific integrase	integrase	Q8SBN2	Clostridium_phage	64.1	3.9e-130
WP_015616271.1|3159822_3161004_-	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_015616272.1|3161065_3161914_-	recombination regulator RecX	NA	NA	NA	NA	NA
3161546:3161561	attR	TTTCATTTTTTCTTTT	NA	NA	NA	NA
WP_015616273.1|3161903_3163166_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	29.9	8.0e-37
>prophage 14
NC_021182	Clostridium pasteurianum BC1, complete sequence	4990707	3325601	3360581	4990707	holin,tail,protease,tRNA,capsid	Streptococcus_phage(28.57%)	34	NA	NA
WP_015616423.1|3325601_3326399_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015616424.1|3326740_3329581_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_015616425.1|3329581_3330928_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_015616426.1|3331017_3331665_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_015616427.1|3331773_3332328_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_015616428.1|3333535_3334180_+	DUF4397 domain-containing protein	NA	NA	NA	NA	NA
WP_015616429.1|3334435_3335902_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015616430.1|3335998_3337396_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_015616431.1|3337397_3338597_-	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_015616432.1|3338879_3339668_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_015616433.1|3340037_3340748_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015616434.1|3341220_3341976_-	A24 family peptidase	NA	NA	NA	NA	NA
WP_015616436.1|3342639_3342795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015616437.1|3343256_3343493_+	helix-turn-helix transcriptional regulator	NA	A0A2K9V4D5	Faecalibacterium_phage	60.8	3.8e-17
WP_015616438.1|3343524_3344286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015616439.1|3344889_3345408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015616440.1|3345472_3346324_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_015616441.1|3346325_3346742_-|holin	phage holin family protein	holin	D9ZNF2	Clostridium_phage	57.9	3.7e-31
WP_015616442.1|3346784_3347057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172638622.1|3347075_3348929_-|tail	phage tail protein	tail	A0A1S5SAI3	Streptococcus_phage	31.0	3.1e-37
WP_015616444.1|3349086_3349851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015616445.1|3350001_3352095_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_015616446.1|3352159_3352861_-|tail	phage tail family protein	tail	C5IUK4	Streptococcus_phage	25.7	5.1e-09
WP_015616447.1|3352857_3355494_-	tape measure protein	NA	M1I8I2	Bacillus_virus	27.8	1.5e-24
WP_015616448.1|3355551_3356184_-	SHOCT domain-containing protein	NA	I3VYV9	Thermoanaerobacterium_phage	31.1	6.4e-11
WP_015616449.1|3356248_3356536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015616450.1|3356604_3356943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015616451.1|3356957_3357518_-|tail	phage major tail protein 2	tail	NA	NA	NA	NA
WP_015616452.1|3357528_3357891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015616453.1|3357899_3358337_-	HK97 gp10 family phage protein	NA	A0A0U4JVS2	Gordonia_phage	33.8	7.1e-09
WP_015616454.1|3358333_3358612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015616455.1|3358608_3359121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015616456.1|3359122_3359347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015616457.1|3359339_3360581_-|capsid	N4-gp56 family major capsid protein	capsid	NA	NA	NA	NA
>prophage 15
NC_021182	Clostridium pasteurianum BC1, complete sequence	4990707	3373722	3381344	4990707	integrase	Listeria_phage(16.67%)	14	3371761:3371775	3382757:3382771
3371761:3371775	attL	TTCTTATCTTCAATG	NA	NA	NA	NA
WP_015616472.1|3373722_3374163_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	62.4	2.2e-34
WP_015616473.1|3374173_3374797_-	HD domain-containing protein	NA	A0A2H4J8L1	uncultured_Caudovirales_phage	44.7	5.0e-40
WP_015616474.1|3374793_3375084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015616475.1|3375095_3376052_-	phage recombination protein Bet	NA	A0A1B1IN99	uncultured_Mediterranean_phage	41.7	2.5e-35
WP_015616476.1|3376051_3377731_-	AAA family ATPase	NA	A0A2I7SCX8	Paenibacillus_phage	25.2	1.6e-16
WP_015616477.1|3377825_3378005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155241927.1|3377970_3378243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015616479.1|3378260_3378398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015616480.1|3378397_3378760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015616481.1|3378772_3378976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015616482.1|3379132_3379438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015616483.1|3379430_3379643_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155241928.1|3379841_3380243_+	helix-turn-helix domain-containing protein	NA	A0A1U9WQN6	Geobacillus_phage	50.8	1.1e-08
WP_015616485.1|3380255_3381344_+|integrase	site-specific integrase	integrase	B3GVW7	Streptococcus_phage	30.7	2.0e-28
3382757:3382771	attR	TTCTTATCTTCAATG	NA	NA	NA	NA
>prophage 16
NC_021182	Clostridium pasteurianum BC1, complete sequence	4990707	4377832	4383620	4990707		uncultured_Caudovirales_phage(33.33%)	9	NA	NA
WP_015617295.1|4377832_4378420_-	ERCC4 domain-containing protein	NA	A0A2H4J819	uncultured_Caudovirales_phage	40.7	8.0e-32
WP_015617296.1|4378518_4378692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015617297.1|4378770_4379238_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	62.4	5.2e-34
WP_015617298.1|4379238_4379856_-	HD domain-containing protein	NA	A0A2H4J8L1	uncultured_Caudovirales_phage	44.4	9.0e-42
WP_015617299.1|4379852_4380137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015617300.1|4380148_4381105_-	phage recombination protein Bet	NA	A0A1B1IN99	uncultured_Mediterranean_phage	48.4	7.1e-38
WP_015617301.1|4381104_4382784_-	AAA family ATPase	NA	A0A2I7SCX8	Paenibacillus_phage	26.9	4.1e-20
WP_015617302.1|4382877_4383057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015617303.1|4383071_4383620_-	sigma-70 family RNA polymerase sigma factor	NA	M9Q2I8	Clostridium_phage	37.2	1.8e-25
